ID: 1099214172

View in Genome Browser
Species Human (GRCh38)
Location 12:79834060-79834082
Sequence GGTACATTGTTAGATGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099214167_1099214172 21 Left 1099214167 12:79834016-79834038 CCATCCATACATTTAATATATAC 0: 1
1: 1
2: 4
3: 43
4: 448
Right 1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG 0: 1
1: 0
2: 1
3: 11
4: 70
1099214170_1099214172 -8 Left 1099214170 12:79834045-79834067 CCTACTATTTTGCCAGGTACATT 0: 1
1: 0
2: 0
3: 17
4: 168
Right 1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG 0: 1
1: 0
2: 1
3: 11
4: 70
1099214168_1099214172 17 Left 1099214168 12:79834020-79834042 CCATACATTTAATATATACTGAG 0: 1
1: 0
2: 2
3: 40
4: 351
Right 1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG 0: 1
1: 0
2: 1
3: 11
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099214172 Original CRISPR GGTACATTGTTAGATGCTAC AGG Intronic
903268757 1:22174674-22174696 GGGACATGATGAGATGCTACTGG + Intergenic
906787537 1:48629129-48629151 AGTACATAGTTAGATGCTAGTGG + Intronic
909648168 1:77940161-77940183 GGTACATGTTTAAGTGCTACAGG - Intronic
910803561 1:91167979-91168001 GGTAGGTTGGTAGATGCTCCAGG + Intergenic
916287683 1:163128967-163128989 GGTACCTAGTCAGATGCTACTGG - Intronic
917040184 1:170797135-170797157 GCTACATTCTGAGATACTACTGG - Intergenic
919210202 1:194472707-194472729 GGTACAATTTTAGACCCTACTGG + Intergenic
920923186 1:210315340-210315362 GGCACATTTCTAGGTGCTACTGG + Intergenic
1063443262 10:6089971-6089993 GGTACGTTGTTAGATGTGAGAGG + Exonic
1064537426 10:16372079-16372101 TGAAAATTGTAAGATGCTACTGG + Intergenic
1072290767 10:93962249-93962271 GGTACAGTGTAAGGTGCTGCAGG - Intergenic
1073252036 10:102126411-102126433 GGTACTCTGTTAGATGCTGGAGG - Intergenic
1081552428 11:44126310-44126332 AGCACACTGTTAGATGCTATGGG + Intronic
1081554551 11:44146271-44146293 GTTACATTTTGAGATGCTAGGGG + Intronic
1084893396 11:72248461-72248483 GCTTTATTGTAAGATGCTACAGG + Intergenic
1089644156 11:119867016-119867038 GGTACCTTGATAGATGTTGCTGG - Intergenic
1094180081 12:27583277-27583299 GGAACACTGTTAGATGCTTCTGG + Intronic
1095678575 12:44948683-44948705 TGTACAGTGTTGGATACTACAGG - Intergenic
1099019878 12:77390326-77390348 GGTATCTTGTTAGGTGCTATTGG + Intergenic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1101548629 12:105740696-105740718 GGTACATTGTTGAATGCTGGGGG + Intergenic
1106797219 13:33219087-33219109 GGTACTATGTAAGATGCTAAGGG + Intronic
1107757801 13:43644396-43644418 CATAAATTGTTAGATGCTAATGG - Intronic
1109121552 13:58464105-58464127 TGCACATTGTTAAATGCTACTGG - Intergenic
1113578292 13:111410179-111410201 GGTACATGTTTAAATGATACAGG - Intergenic
1118455507 14:65942488-65942510 GGTATATTGTAGGATGCTATTGG + Intergenic
1123020434 14:105395474-105395496 GGTACATAGTGAGATGCTGCTGG + Exonic
1140171055 16:72605392-72605414 GGTACAATGTTAAATGCAAATGG - Intergenic
1141954819 16:87363662-87363684 GCTACATGGTTAAGTGCTACGGG + Intronic
1143891427 17:10105441-10105463 GCTACCATGTTAGATGGTACAGG + Intronic
1153039685 18:800575-800597 GGTACATTCTTAGATACAATTGG + Intronic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1153604155 18:6814621-6814643 GGTAAATTCTTAGATGATGCTGG + Intronic
1157578124 18:48757594-48757616 GGTTCACTGTTATCTGCTACTGG + Intronic
925311820 2:2890185-2890207 GGTGCCTTGTTAGAAACTACAGG - Intergenic
927081347 2:19633886-19633908 GGTACTTAGATAGATGCAACTGG - Intergenic
929307126 2:40376219-40376241 TGTACATTGTTAGATGCTTAAGG - Intronic
930716151 2:54595851-54595873 GATTCATGGGTAGATGCTACTGG - Intronic
931190135 2:59992312-59992334 TGGAGATTGTTAGATGCTAATGG - Intergenic
938648158 2:133352323-133352345 GGCACAGTGTCAGATGCTAGAGG - Intronic
940893569 2:159058490-159058512 GGTACATTGCTAGATGCCATGGG + Intronic
942723094 2:178974747-178974769 GGAACCTTGCTAGATGCTAAGGG + Intronic
942941578 2:181624835-181624857 GGTACATATTTAGAGGCTGCAGG + Intronic
945146451 2:206743298-206743320 TCTACACTGTCAGATGCTACTGG - Intronic
946032027 2:216712994-216713016 GGAACATTGTTGGATGCTACAGG - Intergenic
1170207650 20:13816368-13816390 GGTATACTGTTAGATGAGACGGG + Intronic
1171430559 20:25081263-25081285 GGTACCTTGTTCGGTGCTGCTGG + Intronic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
949526724 3:4912225-4912247 GGTTCATAATTAGATGCCACAGG - Intergenic
950537925 3:13591950-13591972 GTTACATTGTTAGCTTCTCCAGG + Intronic
960316629 3:116186407-116186429 GGTACATTTTTAGTTTCTGCTGG + Intronic
960746246 3:120892263-120892285 GGTACAATGCTAGATGTTATAGG - Intergenic
964741940 3:159975425-159975447 GAGACAGTGTTAGATCCTACAGG - Intergenic
971139615 4:23909885-23909907 GGTCCAATGTTAGCTGCTAAGGG + Intergenic
979553153 4:122013971-122013993 GGAACATTGTTGTATGCTGCCGG - Intergenic
980632756 4:135457539-135457561 GGTACATTCTCAGATACTACAGG + Intergenic
987144100 5:14974975-14974997 GGTACTGAGTTAAATGCTACAGG - Intergenic
989986853 5:50711055-50711077 GGTGAATTGTTTGTTGCTACTGG + Intronic
993839765 5:92863561-92863583 GCTACATTGTTAAATCCTTCAGG + Intergenic
999895602 5:156030242-156030264 GTCACATTCTTAGATCCTACAGG - Intronic
1003711077 6:8590745-8590767 TGTACATTTTTAAATGCCACAGG - Intergenic
1005702426 6:28415342-28415364 AGTACAATGTAAGCTGCTACAGG - Intergenic
1007122151 6:39391307-39391329 GGCACATTGTTTGAGGCTGCGGG + Intronic
1008460047 6:51758090-51758112 AGAACATTGTTAGGTGCTATGGG - Intronic
1010049426 6:71485269-71485291 GTTACATTCTGAGATGCTAGAGG + Intergenic
1013146483 6:107399230-107399252 GGTACCTTGTTAGAGGCTAAGGG - Intronic
1013831253 6:114275330-114275352 GGGACAATGTTAGCTACTACTGG - Intronic
1015947546 6:138518284-138518306 GTGACACTGTTAAATGCTACTGG - Intronic
1026585270 7:71650994-71651016 GGTAAATTGTTAGAAGTTAAAGG + Intronic
1031456631 7:121988627-121988649 GGTACTTTATCAGATGTTACAGG - Intronic
1034854703 7:154531821-154531843 GGTACATTATTAACTGCTTCTGG + Intronic
1045184422 8:99822561-99822583 GCTACTTTGTTAGGTGCTAGAGG - Intronic
1047110881 8:121787819-121787841 GGGACATTGTTAGATGACAATGG + Intergenic
1050744829 9:8863192-8863214 GGTACAATGCTATTTGCTACTGG + Intronic
1052574476 9:30274532-30274554 TGTTCATTTTTATATGCTACTGG - Intergenic
1056078981 9:83071339-83071361 TGTATTTTGTTAGATGCTTCTGG + Intergenic
1059029195 9:110671799-110671821 GGTGCAATGTTAGATTCTGCAGG + Intronic
1060577494 9:124709967-124709989 GGGACATTGTTAGAAAGTACTGG - Intronic
1188348143 X:29093805-29093827 GGTAAGGTATTAGATGCTACAGG + Intronic
1189387769 X:40551320-40551342 TGCACATTGTTAGGTGCTGCTGG - Intergenic
1190283048 X:48943930-48943952 GACACATTGTCAGGTGCTACAGG - Intronic
1196536033 X:116845534-116845556 GGTACACTGTTATATGCTATGGG + Intergenic
1202090654 Y:21185179-21185201 GCTGCATTGTTTGAGGCTACAGG - Intergenic