ID: 1099221310

View in Genome Browser
Species Human (GRCh38)
Location 12:79918339-79918361
Sequence TGTTGTGCACACATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099221310 Original CRISPR TGTTGTGCACACATGGAGGA GGG (reversed) Intronic
900822277 1:4898862-4898884 TGTAATGCACACCTGCAGGATGG - Intergenic
901316534 1:8313813-8313835 TGCTGTGCAAACATAGAGAAAGG - Intergenic
901916589 1:12504983-12505005 TGCTGTGCTCACCTAGAGGAAGG + Intronic
902162041 1:14538517-14538539 TGCTGTCCTCACATGGTGGAAGG + Intergenic
903160998 1:21489103-21489125 TGGTCTGGACACAGGGAGGAAGG + Intergenic
903916859 1:26771153-26771175 TGATGTGCCCACATTGAGGTTGG - Exonic
905868530 1:41389934-41389956 TATTCTGCACATATGAAGGAAGG + Intergenic
909753648 1:79195598-79195620 TGTTGTGGAGAGATGGAGGAAGG - Intergenic
912420129 1:109536983-109537005 TGCTGTGCACACACCCAGGAAGG - Intergenic
917608226 1:176658165-176658187 TGCTGGCCACACCTGGAGGAAGG + Intronic
919527065 1:198666348-198666370 TTTTTTCCACACATGTAGGAAGG + Intronic
920631701 1:207659159-207659181 TGCTGGCCAGACATGGAGGATGG + Intronic
921955135 1:220974613-220974635 TGTTGTGAACACCTGATGGAGGG - Intergenic
923520444 1:234731305-234731327 TGATTTGCAAACCTGGAGGATGG - Intergenic
1063217741 10:3939211-3939233 TGGTGTCCTCACAGGGAGGAAGG - Intergenic
1063585178 10:7345843-7345865 CGCTGTGAAGACATGGAGGAAGG - Intronic
1064873981 10:19971989-19972011 CGTTGTGCATAGAGGGAGGAAGG + Intronic
1064951711 10:20858558-20858580 TGTTGTTCACATATTCAGGAAGG + Intronic
1067050207 10:43011589-43011611 TGATGTCCTCACATGGTGGAAGG - Intergenic
1067755538 10:49001728-49001750 TCTGGTGCAGACATGGAGAAGGG + Intergenic
1068779084 10:60900043-60900065 TGTGGTGCCCTCCTGGAGGAAGG + Intronic
1069795031 10:71046498-71046520 TTTTGTGCACATAACGAGGAGGG - Intergenic
1069880302 10:71588641-71588663 GGTTATACAGACATGGAGGAAGG - Intronic
1070306511 10:75242673-75242695 TGGTGTGCACATCTGGAAGATGG - Intergenic
1070487727 10:76946535-76946557 TATTGTGCAACTATGGAGGAAGG + Intronic
1075782875 10:125028062-125028084 TGGTGTGCTCACATGGACCAGGG + Intronic
1075937036 10:126351381-126351403 TGTAGTGCAAGCATGCAGGATGG - Intronic
1076023355 10:127092356-127092378 TGGTGGGCACACAGGGAGGCTGG - Intronic
1077326316 11:1965548-1965570 GGTTGTGCACACACTGGGGAGGG + Intronic
1077954751 11:7004287-7004309 TGTTGTGTATACATGGAAGAAGG - Intronic
1078890832 11:15557035-15557057 TTTTGTTCTCACATGGTGGAAGG - Intergenic
1079183214 11:18212456-18212478 TGAAGTGCACACATGAATGAGGG - Intronic
1082285716 11:50316026-50316048 TTTTGTGGCCAAATGGAGGAAGG + Intergenic
1083170788 11:60923027-60923049 AGTTGTGCAGACAAGGAGGCGGG - Exonic
1084863951 11:72040886-72040908 TTTTGTTCAAACATGGACGAGGG - Intronic
1086701281 11:89902667-89902689 AGTTGTTCACACATGGATAACGG + Intergenic
1086704886 11:89941858-89941880 AGTTGTTCACACATGGATAACGG - Intergenic
1087749460 11:101990753-101990775 TACTGTGCGCACATGCAGGAAGG + Intronic
1088363857 11:109018635-109018657 GGCTGTGCACACGTGGAGTAGGG - Intergenic
1088364172 11:109021426-109021448 TGTTGTCCTCACATGGTAGAAGG + Intergenic
1088966529 11:114727755-114727777 TGTTGTGTACACATGGGTGGGGG - Intergenic
1091033526 11:132213168-132213190 CGGTGTGCACAGATGGATGAAGG + Intronic
1091120194 11:133051038-133051060 GTATGTACACACATGGAGGAGGG - Intronic
1202809297 11_KI270721v1_random:20727-20749 GGTTGTGCACACACTGGGGAGGG + Intergenic
1091952971 12:4610499-4610521 TGTTTTGCACGTATGGAGGTTGG + Intronic
1094435688 12:30418638-30418660 TGCCGTGGACCCATGGAGGATGG + Intergenic
1096103985 12:48986192-48986214 TGATGTGAGCACATGGAGTAGGG - Intergenic
1098430757 12:70417449-70417471 TGTTATGCACACATTGGGGTTGG + Intronic
1099221310 12:79918339-79918361 TGTTGTGCACACATGGAGGAGGG - Intronic
1100277693 12:93086337-93086359 TGGTGTCCTCACATGGTGGAAGG - Intergenic
1100705362 12:97194874-97194896 TGATGTTAACACTTGGAGGATGG + Intergenic
1100951948 12:99860554-99860576 TCTGGAGGACACATGGAGGATGG + Intronic
1102556967 12:113733132-113733154 GGTTGTGCCCACCTGGAAGATGG + Intergenic
1104052133 12:125202476-125202498 TGCTGTGCTCACATGGTGGTTGG + Intronic
1104822369 12:131684473-131684495 TGTGGGGCTCACATCGAGGATGG + Intergenic
1104955283 12:132461896-132461918 TTGTGTGCTCGCATGGAGGATGG - Intergenic
1106708178 13:32303483-32303505 AGTTGTGTATACTTGGAGGAAGG + Intergenic
1106845885 13:33737395-33737417 TGTTGTGCACAGATGGCCCAAGG + Intergenic
1108083957 13:46765260-46765282 TCTTGTGCACCCCTGAAGGACGG + Intergenic
1110114718 13:71798606-71798628 TGTTTTTCACAAATGGATGAAGG - Intronic
1110521169 13:76478541-76478563 AGTTGTTCACACATGGAGAAAGG - Intergenic
1111816652 13:93162494-93162516 TGTTGTCCTCAGATGGTGGAAGG + Intergenic
1113352767 13:109545589-109545611 TGTTTTGTACCCATGGAGGGAGG - Intergenic
1114543664 14:23482794-23482816 TGTTGTGCTTCCAGGGAGGAAGG - Intronic
1117155447 14:52935546-52935568 TGGTTTCCTCACATGGAGGAGGG - Intronic
1118126821 14:62914651-62914673 TTTTGTCCTCACATGGTGGAAGG - Intronic
1118821789 14:69350625-69350647 GGATGTGCACACAGGGTGGAAGG - Intronic
1119613106 14:76080355-76080377 CTTTGTGCACATTTGGAGGAGGG + Intronic
1121200162 14:92110173-92110195 TTTTGTCCTCACATGGTGGAAGG + Intergenic
1123413946 15:20081654-20081676 AGTTCTGCACATAAGGAGGAAGG - Intergenic
1123523288 15:21088765-21088787 AGTTCTGCACATAAGGAGGAAGG - Intergenic
1125613112 15:40985977-40985999 TGCTTTGCACACATTGAGCATGG + Intronic
1127858406 15:62972150-62972172 TGTTTTGCAAACAGAGAGGATGG - Intergenic
1128858710 15:71045888-71045910 CACTGTGCACACATGGAAGATGG - Intronic
1129666765 15:77583548-77583570 TGGTGTCCTCACATGGTGGAAGG - Intergenic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1132379586 15:101357551-101357573 TATTGTGTACACAGGGAGGCAGG - Intronic
1135514775 16:23122070-23122092 TGTTATGCACACACAGGGGAGGG + Intronic
1136227708 16:28870166-28870188 TGTTGGACAGACTTGGAGGATGG + Intronic
1137846757 16:51697561-51697583 TGCTGTGGGCACATGGGGGATGG - Intergenic
1141030849 16:80587082-80587104 TGGTGTGCACCCCTGGAGGGAGG - Intergenic
1141507670 16:84489477-84489499 TGTCATGCCCACATGGAGAAGGG + Intronic
1141867834 16:86762885-86762907 TTTTGTGCAGACAGGGAGGAAGG + Intergenic
1143092809 17:4459046-4459068 TGCTCTGGACACATGGAGAAGGG - Intronic
1146523508 17:33546314-33546336 TGTTGAGAAAACATGAAGGAAGG - Intronic
1151563326 17:74882699-74882721 GGCTGTGCACACCTAGAGGAGGG + Exonic
1153309651 18:3665832-3665854 TATTGTGCACTCAGGGAGGGAGG - Intronic
1156196733 18:34782606-34782628 TGTAGGGCACACCTGGTGGAGGG + Intronic
1156401964 18:36747699-36747721 TGTTGTGCCCACAAGGAGAATGG + Intronic
1159610092 18:70515065-70515087 TGTTAGGAACACATGGAGGTTGG - Intergenic
1160299262 18:77665466-77665488 TGTTCTGCAGACATAGAGAAAGG - Intergenic
1163474547 19:17517379-17517401 TGGTGTGCTCACCTGTAGGAGGG - Exonic
1167845564 19:52161447-52161469 TGTTGTCCCCACATGGCAGAAGG + Intronic
1168383593 19:55944473-55944495 TGTCCTCCTCACATGGAGGAAGG - Intergenic
924974652 2:161486-161508 TGCGGTGCTCACAGGGAGGAGGG + Intergenic
925328984 2:3043742-3043764 TGTTTTGCACACAGGGCGAAGGG + Intergenic
927186673 2:20487139-20487161 TGGTCTGCAGCCATGGAGGAGGG - Intergenic
927293048 2:21423213-21423235 TGTTGTGGAAACATGGCAGAGGG + Intergenic
930046990 2:47181128-47181150 TGTGGAGTACACCTGGAGGAAGG + Intergenic
933892619 2:86785680-86785702 TGTTGTGCGCACATCGCGGTAGG - Exonic
935448534 2:103183017-103183039 TGTTCTGCACGCATGGAAAATGG - Intergenic
935918059 2:107979415-107979437 TGTTGGGAACACATGGATGCAGG + Intergenic
937952405 2:127398572-127398594 TGTGGGGGACACATGGAGAAGGG - Intergenic
942613140 2:177762662-177762684 TGCTGTGCTAACATGGGGGAGGG + Intronic
943533727 2:189121098-189121120 TGTTGTGGGAACATGTAGGAAGG + Intronic
944332969 2:198494154-198494176 GGATGTGCACATACGGAGGAAGG - Intronic
946320379 2:218950629-218950651 TCTTGTCCCCACATGGAGAAAGG - Intergenic
946673440 2:222131190-222131212 TGTTGTTGTCACATGGAGGAAGG + Intergenic
948162019 2:235832899-235832921 TGTTGTACACTCATGAAGCAGGG - Intronic
948883305 2:240871133-240871155 TTTGGTGCAGAGATGGAGGAGGG - Intronic
948924171 2:241083209-241083231 TGCTGAACAGACATGGAGGAGGG + Intronic
1169357372 20:4918914-4918936 GTGTGTGCACACATTGAGGAGGG - Intronic
1169747046 20:8953161-8953183 TGTTATGCACTCAGGAAGGATGG - Intronic
1173109105 20:40168798-40168820 TGTAGTGTAAACATTGAGGAAGG - Intergenic
1173408046 20:42784220-42784242 TTTTGTTCATACTTGGAGGAGGG + Intronic
1174520791 20:51129013-51129035 TGCTGTGCATGCCTGGAGGAGGG - Intergenic
1174676328 20:52360456-52360478 GGTAGTGCACACGTGGAGGACGG - Intergenic
1174941221 20:54930737-54930759 TGTTGTCCACACAGGGAGGCTGG - Intergenic
1175782847 20:61694585-61694607 TAATGAGCACACTTGGAGGAAGG + Intronic
1175860857 20:62149308-62149330 TCTTGTGATCACATGGAGGGAGG - Intronic
1177608139 21:23408573-23408595 TGCTGTGGAAACTTGGAGGATGG + Intergenic
1178239668 21:30884063-30884085 TCTTGTTCACACTTGAAGGAAGG - Intergenic
1178631490 21:34265098-34265120 TTGTGTCCTCACATGGAGGAAGG - Intergenic
1178960260 21:37058627-37058649 TGTGCAGCACCCATGGAGGAGGG + Intergenic
1179146599 21:38773931-38773953 TGAGCTGCACACATGCAGGATGG + Intergenic
1179623354 21:42633084-42633106 TGGTGGGCAGAGATGGAGGACGG - Intergenic
1180720269 22:17902771-17902793 TGATGGGAACACATGGAGAAGGG + Intronic
1182546173 22:31077913-31077935 AGTTCTGCACATAAGGAGGAAGG + Intronic
1183587193 22:38759724-38759746 TGTGCTGCCCACATGGAGGAAGG + Intronic
1184489333 22:44800042-44800064 TGGTCTGCAGGCATGGAGGATGG + Intronic
949755867 3:7410165-7410187 TTTTGTGAACACATGGAGTTGGG + Intronic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
952113296 3:30149389-30149411 TTTTGTCCTCACATGGTGGAAGG - Intergenic
955027412 3:55183061-55183083 TGTTGTCCATACATGCAGCATGG - Intergenic
955740228 3:62082746-62082768 TGTTGAGCACAAGTGAAGGAAGG + Intronic
957770818 3:84690470-84690492 AGATGTGCAGACATGGAGGCAGG + Intergenic
959110736 3:102119433-102119455 TGCTGTCCTCACATGGTGGAAGG + Intronic
960555157 3:119020005-119020027 TGGTGTCCTCACATGGTGGAAGG - Intronic
964832748 3:160903714-160903736 GTGTGTGCACACATGGAGGTGGG + Intronic
967051773 3:185791589-185791611 TGTGATGCACACCTGGAGGAAGG - Intronic
968344931 3:197994844-197994866 TGTTGTGTAAACATGGAACAAGG - Intronic
969963054 4:10965503-10965525 TGTTCTGCACGTGTGGAGGATGG + Intergenic
970245718 4:14060248-14060270 TATTCTGCACACATGTAGTAAGG + Intergenic
971118769 4:23680286-23680308 TCTTGTTCACACATGGCAGAAGG - Intergenic
971903691 4:32697599-32697621 TGGTGTCCTCACATGGTGGAAGG - Intergenic
974181907 4:58395408-58395430 TGTGGTCCTCACATGGTGGAAGG + Intergenic
974290118 4:59918869-59918891 TCTTGTCCTCACATGGTGGAAGG - Intergenic
974587187 4:63895185-63895207 TTTTTTGTACACATGTAGGAGGG - Intergenic
974842437 4:67313376-67313398 TGGCGTGAATACATGGAGGATGG + Intergenic
975499109 4:75065651-75065673 AGTTGTGGACAGATAGAGGAAGG + Intergenic
975904774 4:79196322-79196344 TGTTATGGAAACATGGAGGAGGG - Intergenic
978394642 4:108265658-108265680 TAATGTGCACACCTGGTGGAAGG - Intergenic
978494967 4:109348807-109348829 CTTTGTGCTCACATGGTGGAAGG - Intergenic
980153501 4:129078014-129078036 TGTTCTGAAGATATGGAGGATGG + Intronic
980311470 4:131136192-131136214 TGTTGTGGCAACTTGGAGGAGGG - Intergenic
980597658 4:134975869-134975891 TGTGGGGCACACAGGGAAGAAGG - Intergenic
981421478 4:144555386-144555408 TCTTGTGGACAGATGGAGAATGG + Intergenic
984210341 4:176839722-176839744 ACTTGTCCACCCATGGAGGATGG - Intergenic
985776964 5:1849438-1849460 TGCTGTGCGCACATGAGGGAAGG - Intergenic
994042859 5:95277248-95277270 TATTGTGCTCCCATGGAGGATGG - Intronic
995434883 5:112124324-112124346 TGTTTTCTTCACATGGAGGAGGG + Intergenic
997352118 5:133238635-133238657 GAGTGTGCACACATGGGGGAGGG + Intronic
1000300153 5:159949780-159949802 TGAAGTGCACAAATGGAGGCAGG - Intronic
1002437255 5:179239142-179239164 TGTTGAGGACACATGGGGGTGGG + Intronic
1003540822 6:7016632-7016654 TGATGTGCTCACATGGAGCCTGG - Intergenic
1004129220 6:12902964-12902986 TGTTTGGAACTCATGGAGGAAGG - Intronic
1004640845 6:17513967-17513989 TTTTTTACACACGTGGAGGAAGG - Intronic
1005205335 6:23396716-23396738 TAATGTGCACACATGGAAGCAGG + Intergenic
1005427063 6:25713779-25713801 TGTTGTGCACAGTTGGGAGAGGG + Intergenic
1005904886 6:30253597-30253619 TGGTGTCCTCACATGGTGGAAGG - Intergenic
1005963069 6:30707098-30707120 TGTTCTCCACACGTGGATGATGG + Intronic
1007115585 6:39340946-39340968 TGTGGGGCACAAGTGGAGGAAGG - Intronic
1007345787 6:41228593-41228615 TGATGCCCACACATGGAAGAGGG - Intronic
1008652219 6:53575167-53575189 TGTTATGCAGATATGGAGCATGG + Intronic
1009815918 6:68734610-68734632 TATTGTGAACACTGGGAGGATGG + Intronic
1010024960 6:71204403-71204425 TGTTGTGAAGACTTGGAGAAAGG + Intergenic
1010579626 6:77578478-77578500 TGCTGTGCAAACTTGGAGGAGGG - Intergenic
1011902289 6:92313773-92313795 TGTTCAGCACCCATGGAGGCTGG + Intergenic
1013268007 6:108519162-108519184 TGTTGTTCTCGCATGGTGGAAGG + Intronic
1015985479 6:138880296-138880318 TGGAGTGCTCACATGGTGGAAGG + Intronic
1017303462 6:152889251-152889273 TGGTGTCCTCACATGGAGGAAGG - Intergenic
1017630588 6:156392782-156392804 TGGTGTGCCCACCTGGAGGGTGG - Intergenic
1018647499 6:165961850-165961872 GGTTGTGCCCAGATGGAGGGTGG - Intronic
1018663075 6:166106185-166106207 TTCTGTGCACACACAGAGGAGGG + Intergenic
1018698148 6:166406480-166406502 TGTTGTCCTCACTTGGAGGGAGG + Intergenic
1021468219 7:20969866-20969888 CTTTGTTCTCACATGGAGGAAGG - Intergenic
1021689107 7:23214967-23214989 TGCTGGGCACACAGGGAGAAGGG - Intergenic
1023613911 7:41999246-41999268 TGTTGTGCATACAGTGATGAAGG - Intronic
1024588323 7:50859868-50859890 TGCTGTGTCCACATGAAGGAAGG - Intergenic
1026501705 7:70948274-70948296 AGATGTCCTCACATGGAGGAAGG - Intergenic
1027804543 7:82800407-82800429 TGAAGTGCACACATGGAACAAGG - Intronic
1028231291 7:88309308-88309330 GGGTGTGCACCCATGGAAGAAGG + Intergenic
1029542554 7:101192675-101192697 TCTGGTGGCCACATGGAGGATGG + Intergenic
1029982699 7:104894014-104894036 TGCTGTGCACAGATGGAGACTGG - Intronic
1030644293 7:112042393-112042415 TGTCTTGCAGACATTGAGGAAGG + Intronic
1032089415 7:128903884-128903906 TGTTGGGCACCCTCGGAGGAGGG + Intronic
1032335489 7:131020984-131021006 TATTCTGCACACATGGATGGGGG - Intergenic
1032591372 7:133194819-133194841 TGGTGCACACACATTGAGGATGG - Intergenic
1033142596 7:138840793-138840815 TGTGGTGCTCACAGGGAGGAGGG - Intronic
1034676889 7:152898419-152898441 AGGTGTGCACACCTGGAGCATGG + Intergenic
1035646416 8:1225073-1225095 TTTTGGGCACACAGGCAGGATGG - Intergenic
1035705115 8:1669388-1669410 TGTTGTGCACCCAGGGAGGCCGG + Intronic
1035915689 8:3619334-3619356 TGTTCTGCAAACATGGAGCACGG + Intronic
1037388796 8:18370735-18370757 TGTGGGGAACACATGGAGTAGGG + Intergenic
1038380535 8:27089047-27089069 TTATGTCCTCACATGGAGGAAGG + Intergenic
1038695176 8:29799947-29799969 TGCTGTGAACACAGGCAGGAAGG - Intergenic
1040399516 8:47034319-47034341 TGTTGTGCACCTTTGGAGCAGGG - Intergenic
1041174760 8:55183918-55183940 AGGTGTGTACACATTGAGGATGG + Intronic
1043585207 8:81760680-81760702 TTGTGTCCTCACATGGAGGAAGG - Intergenic
1044329244 8:90897002-90897024 TGGAGTGCACACTTGGAGAAGGG - Intronic
1049577193 8:143394792-143394814 AGCTGTGCACACAGAGAGGAAGG - Intergenic
1052637036 9:31119859-31119881 TGTTGGGCATAGCTGGAGGATGG + Intergenic
1055168328 9:73223701-73223723 TGTGGTGAACACCTGCAGGAAGG + Intergenic
1055425628 9:76193164-76193186 TGATGTACACACATGGAAGAAGG - Intronic
1055694425 9:78868390-78868412 CTTTGAGCACACCTGGAGGATGG - Intergenic
1056494143 9:87139302-87139324 TGTTGAGCACACATGGTGTGGGG + Intergenic
1057179699 9:93023124-93023146 TGCTGTGCCCAGATGCAGGAGGG + Intronic
1058596824 9:106623822-106623844 TATTGTGCTCACATGGAGATTGG - Intergenic
1058632109 9:107000003-107000025 TGCTGTGAACACATGGAACAAGG + Intronic
1058745666 9:107988176-107988198 TATTGAGCACACATGTAGCATGG + Intergenic
1059921064 9:119160216-119160238 TGTTCTCCTCACATGGTGGAAGG - Intronic
1060462042 9:123865485-123865507 CATTCTGCACACATGGTGGAGGG - Intronic
1061194111 9:129098217-129098239 TGTGGCCCACCCATGGAGGAGGG - Intronic
1061418563 9:130461326-130461348 TCTGGTGGCCACATGGAGGAGGG - Intronic
1186250353 X:7659552-7659574 TTTTGTGTCCACATAGAGGAGGG + Intergenic
1186576240 X:10768974-10768996 GGGTGTGCACACATGTAGGAGGG + Intronic
1189206709 X:39246113-39246135 TATTGTGCACCAATAGAGGATGG - Intergenic
1192824214 X:74678249-74678271 TGATGTTCTCACATGGTGGAAGG + Intergenic
1194567961 X:95517237-95517259 TGTGATTCTCACATGGAGGAGGG + Intergenic
1197756083 X:129995837-129995859 TGTTGAATACACATGGAAGAAGG + Intronic
1198641959 X:138766049-138766071 AGTTATGTAGACATGGAGGATGG - Intronic
1201518918 Y:14850896-14850918 AGTTGTGCAATCATGGGGGAGGG + Intergenic