ID: 1099222212

View in Genome Browser
Species Human (GRCh38)
Location 12:79928462-79928484
Sequence AGGTTTTTAAAAATGGATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1163
Summary {0: 1, 1: 1, 2: 14, 3: 118, 4: 1029}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099222208_1099222212 17 Left 1099222208 12:79928422-79928444 CCAGTTTGGGGTTGGGAGGGTTT 0: 1
1: 0
2: 3
3: 18
4: 224
Right 1099222212 12:79928462-79928484 AGGTTTTTAAAAATGGATTTAGG 0: 1
1: 1
2: 14
3: 118
4: 1029

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099222212 Original CRISPR AGGTTTTTAAAAATGGATTT AGG Intronic
901347315 1:8557311-8557333 ACTTTTTGAAAAATGGATTTTGG - Intronic
901943163 1:12679390-12679412 ATGTTTTTAAAAATTACTTTAGG - Intergenic
903196573 1:21693638-21693660 AGGCTTTTAAAAATGTCTTTAGG + Intronic
903204872 1:21773964-21773986 AGTTTTTTAAAAATAGAGATGGG - Intronic
903413068 1:23162653-23162675 AGTATTTTAAAAATGTATTATGG - Intronic
903840880 1:26239206-26239228 AGGTTTTCTATACTGGATTTGGG + Intronic
904073689 1:27823273-27823295 AGATTTTTAAAGATAGATTGAGG + Exonic
904223264 1:28991399-28991421 AGGTTTAAAATCATGGATTTTGG + Intronic
904314386 1:29650820-29650842 AGCTTGTTAAAAATAGATCTGGG - Intergenic
904406469 1:30293181-30293203 AAGTTTTTAAAAAGTCATTTAGG + Intergenic
904557768 1:31376446-31376468 AGGTTTTTCAGAATGGGTTGGGG + Intronic
905116049 1:35641719-35641741 AAGATTTTAAAAGTGGCTTTAGG + Exonic
905878290 1:41447550-41447572 ATGTTCTTAAAAATGGAGATGGG + Intergenic
905926771 1:41756462-41756484 AAGTTTGTAAAAGTGGAATTTGG - Intronic
906450442 1:45941566-45941588 AGTTTTTTAAAAATTTCTTTGGG + Intronic
907095398 1:51774904-51774926 AACTTTTTAAAAATGTTTTTTGG + Intronic
907192956 1:52663999-52664021 TGGTTTTTCAGAATGCATTTTGG - Intronic
907928377 1:58975730-58975752 AGGTTTTAACACATGGATTTTGG + Intergenic
907948924 1:59162048-59162070 AGGTTTTAACATATGGATTTTGG + Intergenic
907963295 1:59303960-59303982 ACATTTTTAAAAATATATTTTGG + Intronic
908379623 1:63583972-63583994 AGGTTTTAAGATATGGATCTTGG + Intronic
908634253 1:66144933-66144955 TGGTTTTTAAAAGTGGAGATGGG - Intronic
908646613 1:66285347-66285369 TGATTTTTAAAAATATATTTAGG + Intronic
908752318 1:67435994-67436016 ATTTTTTTAAAAATAGTTTTAGG + Intergenic
908810265 1:67975051-67975073 AGGTTTCAACATATGGATTTTGG + Intergenic
908947290 1:69514465-69514487 TGGTTTTTAAAGATGGTGTTTGG - Intergenic
909037958 1:70616107-70616129 TGGTTTTTAAAAGTGATTTTTGG + Intergenic
909197052 1:72640493-72640515 AAATTTTTAAAAATTGATTTGGG - Intergenic
909388653 1:75091572-75091594 ATGGTTTTAAAAATGCCTTTAGG + Intergenic
909452782 1:75817154-75817176 ATCTTTTTAAAACTTGATTTTGG - Intronic
909538179 1:76761668-76761690 AGGTTTCAACACATGGATTTTGG - Intergenic
911409491 1:97484448-97484470 AGATTTCTAAACATGGATTTAGG - Intronic
911548113 1:99245665-99245687 AGATTTTTAAAAATATCTTTTGG - Intergenic
911871722 1:103108052-103108074 AGGTAAGAAAAAATGGATTTGGG - Exonic
912453109 1:109779477-109779499 AGGTTTTAACATATGAATTTTGG + Intergenic
912828500 1:112928723-112928745 AGATTTTTAAAAATTGATGTTGG - Intronic
912882598 1:113431827-113431849 TGGTTTTTAAAAATGAAATTTGG + Intronic
912885110 1:113462819-113462841 AGATTTTTAAAAATATAGTTGGG + Intronic
912985953 1:114430653-114430675 AGGTTTTTAAAATTTACTTTTGG - Intronic
913180884 1:116320131-116320153 ATGTTTTTTAAAAAGGTTTTTGG + Intergenic
913249261 1:116898836-116898858 ACTTTTTTAAAAATTGTTTTTGG - Intergenic
915561061 1:156688356-156688378 ATGTTTTTAAAAATAGAGATAGG + Intergenic
915853430 1:159352931-159352953 ATGATTTTAAAAATGATTTTTGG - Intergenic
916010911 1:160704826-160704848 AGGTTTTTAAAAATGACCTGAGG - Intronic
916563007 1:165949420-165949442 AGATTTTTAAAAATAAATTTGGG - Intergenic
916968037 1:169974454-169974476 TGTTTTTTAAAAATAGGTTTAGG + Intronic
917416506 1:174816038-174816060 AGCTTCTTAAACTTGGATTTTGG + Intronic
918119664 1:181527393-181527415 AGGTTTCAACATATGGATTTTGG + Intronic
918127329 1:181596029-181596051 AGGTTATTTAAACTGGATCTTGG + Intronic
918553320 1:185769561-185769583 GGGTTGTTAAAAATGTATATGGG + Intronic
918965868 1:191347132-191347154 AGGTTCTTAAATATGAACTTCGG - Intergenic
919033598 1:192277420-192277442 GATTTTTTAAAAATGGGTTTTGG + Intergenic
919093564 1:193002294-193002316 ACTTTTTAAAAAATAGATTTGGG - Intergenic
919094598 1:193015427-193015449 TGATTTTTAAAAATTGATTTGGG - Exonic
919468313 1:197948752-197948774 AAGTTTTTAAAAGGGGAGTTGGG - Intergenic
919667201 1:200303512-200303534 AACTTTTTTAAAATGCATTTAGG - Intergenic
919858390 1:201721057-201721079 AATTTTTAAAAAATGGATTCGGG - Intronic
920644782 1:207792920-207792942 ATGTTTTTAAAAGTGGCTTCTGG + Intronic
920756003 1:208733623-208733645 AGGATTCTAAAAATCTATTTTGG - Intergenic
921028156 1:211309012-211309034 AATTTTTTAAAATTTGATTTTGG - Intronic
921162198 1:212481090-212481112 TGCTTTTTAAAAATTTATTTTGG + Intergenic
921652873 1:217699577-217699599 GAGTTTTTAAAAATGTATTCTGG + Intronic
921686446 1:218094613-218094635 AGGTTTCTACATATGAATTTTGG - Intergenic
921989649 1:221350697-221350719 AGGTTTTAACACATGAATTTGGG + Intergenic
922360096 1:224813330-224813352 AGGTTTTGACAAATGAATTTGGG - Intergenic
922649639 1:227326597-227326619 TGGTTTTAAAAAAGGAATTTGGG - Intergenic
922681428 1:227600550-227600572 AGCTTTTTAAAAATGATTGTTGG + Intronic
922904210 1:229161519-229161541 ATGTTTCTAAAATTGGAATTAGG - Intergenic
923167041 1:231375525-231375547 GGATTTTTAAATAAGGATTTAGG - Intronic
923829087 1:237535239-237535261 AGGTTTTTAAAACAGGCTCTTGG - Intronic
923841573 1:237677842-237677864 AGCTTTTTAAATTTAGATTTGGG + Intronic
923876288 1:238052287-238052309 ATTTGTTTAAAAATTGATTTTGG - Intergenic
924170189 1:241330921-241330943 GGGTTTTTAAAAATAGATTTAGG - Intronic
924700195 1:246443667-246443689 AGGTTTTTCAAAATTCTTTTAGG - Intronic
924842159 1:247723793-247723815 AGGTTGTTGACAATGAATTTTGG + Exonic
924843735 1:247743692-247743714 GAGTTTTTAAAAAAGTATTTTGG + Intergenic
1063082443 10:2781548-2781570 TGGTTATTAAATATTGATTTGGG + Intergenic
1063746415 10:8888569-8888591 AGGTTTTTCACAATGGGTTATGG + Intergenic
1063977246 10:11427288-11427310 AGGTTTTAACATATGAATTTAGG + Intergenic
1064024090 10:11833151-11833173 GAGTTTTTAAATATGAATTTTGG + Intronic
1064248341 10:13687538-13687560 AGTTCTTTCAACATGGATTTTGG + Intronic
1064512327 10:16109093-16109115 AGGAATTTAAAAATGCATGTAGG + Intergenic
1064658126 10:17577093-17577115 ATTTTTTTAAAAAGGGACTTAGG + Intergenic
1064820280 10:19321825-19321847 AGGTTTTAAGAAGTGGATTGGGG + Intronic
1064924472 10:20555191-20555213 AGGTCTTTGAAAATAGATTTAGG - Intergenic
1065289120 10:24212571-24212593 AGGATTTTAAAAATCTAATTTGG - Intronic
1065313199 10:24436167-24436189 AGTTTTTTAAAAATAACTTTAGG - Intronic
1065576557 10:27126140-27126162 ATGATTTTTAAAATGGAGTTAGG + Intronic
1065930508 10:30474520-30474542 TGGCTTTTAATAATGTATTTAGG + Intergenic
1066333569 10:34452232-34452254 AGATTTTTAAAAATACTTTTGGG - Intronic
1066449612 10:35516805-35516827 ATCTTTTTAAAAAATGATTTTGG + Intronic
1066587839 10:36957375-36957397 AGATTTTTAAATGTGAATTTTGG + Intergenic
1066708565 10:38207056-38207078 AAGTCTTTAAAAATGTTTTTGGG - Intergenic
1066980937 10:42415530-42415552 AAGTCTTTAAAAATGTTTTTGGG + Intergenic
1067027277 10:42855065-42855087 CGGTTTTTAAAAATTTATTAAGG + Intergenic
1067257272 10:44653884-44653906 AGAGTTTTAAAAATATATTTTGG + Intergenic
1068104253 10:52593454-52593476 AGCTTATTAAGAATGGATATAGG + Intergenic
1068357447 10:55928129-55928151 AGGCTTTTATAAATGGAATCGGG - Intergenic
1068450074 10:57175023-57175045 AGGTTTTAACATATGAATTTTGG - Intergenic
1068955749 10:62817762-62817784 AAGTTTTTAAAAATTGCTTTGGG - Intronic
1068957808 10:62835847-62835869 AGTTTTTTAAAAATGTGTTTTGG - Intronic
1069205792 10:65683701-65683723 AATTTTTTAAAAATTGACTTTGG + Intergenic
1069258708 10:66366414-66366436 AGGTTTTAACATATGAATTTTGG - Intronic
1069730783 10:70611104-70611126 ATTTTTTTAAAAATGGCTTTAGG + Intergenic
1070216643 10:74389486-74389508 AGATTTTTAAAAATCAGTTTAGG - Intronic
1070794074 10:79206901-79206923 AGGTATTTAAAAATGGGTGGAGG - Intronic
1070991085 10:80732725-80732747 AGGTTTTTATAAATTGCATTTGG + Intergenic
1071030083 10:81167647-81167669 AGGTTTGTAGAAATATATTTTGG + Intergenic
1071195953 10:83159912-83159934 AGGTTTATAAAGTTGGCTTTAGG + Intergenic
1071276195 10:84057772-84057794 AGGTTTTTAAAAAATGATCAAGG - Intergenic
1071865779 10:89729819-89729841 ATGTCTTTTAAAATGGCTTTTGG + Intronic
1071874574 10:89830613-89830635 AAGTTTTTAAAAATATATTTTGG + Intergenic
1072264975 10:93718640-93718662 AGTTTTTAAAAAATTGTTTTTGG - Intergenic
1072748906 10:97962337-97962359 TGGTTTTGAAAAATGGTTCTGGG - Intronic
1073008786 10:100344297-100344319 AAGTTTTAAAAAATGATTTTTGG + Intergenic
1074148317 10:110736775-110736797 AGGTTTCAAAATATGCATTTTGG - Intronic
1074178663 10:111036823-111036845 TGCTTTTTAAAAATTTATTTAGG - Intergenic
1074264938 10:111892359-111892381 AGGTTTTTAAAAATAGTTTTAGG - Intergenic
1074759100 10:116652558-116652580 ACTTTTTTAAAAATGAATCTGGG + Intergenic
1075113236 10:119604903-119604925 AGGTTTTAACATATGAATTTTGG - Intergenic
1075141222 10:119837869-119837891 AGCTTTTTAAAAAGCTATTTGGG + Intronic
1075485288 10:122817303-122817325 AGGTTTTGGAAAGTGAATTTTGG - Intergenic
1075748691 10:124745581-124745603 TGCTTTTTAAAAATGCATTAAGG + Intronic
1075886573 10:125904683-125904705 CTGTTTTTAAAAATGACTTTTGG + Intronic
1076058187 10:127392448-127392470 AGCTTTTTAAGAGTGGTTTTAGG + Intronic
1076234332 10:128852076-128852098 AGTTTTTAAAAAAGGGACTTGGG - Intergenic
1076712165 10:132343474-132343496 AGCTTTTTAAAGAAGGAGTTTGG + Intronic
1078226792 11:9399460-9399482 AGCATTTTAAAGAAGGATTTTGG + Intronic
1078349261 11:10579436-10579458 AGGGGTCTAAAAATAGATTTTGG + Intronic
1078465059 11:11543981-11544003 AACTTAATAAAAATGGATTTTGG + Intronic
1078640739 11:13093454-13093476 AGGTTTTGACATATGAATTTTGG - Intergenic
1078711776 11:13799331-13799353 TTGTTTTTAAAAATAGCTTTCGG - Intergenic
1079036019 11:17020750-17020772 ATCTTTTTAAAAATTAATTTTGG - Intergenic
1079044752 11:17091417-17091439 ATGTTTTGACATATGGATTTGGG + Exonic
1079677671 11:23251114-23251136 AAGAAATTAAAAATGGATTTTGG - Intergenic
1080210879 11:29783452-29783474 ATGTTTTTAAAAAATGGTTTTGG + Intergenic
1080310467 11:30884943-30884965 TGATTTTTAAAGATGAATTTTGG - Intronic
1080336185 11:31199108-31199130 AAGTAATTAAAATTGGATTTTGG - Intronic
1080808885 11:35682516-35682538 AGATTTTTAAAAAAGCCTTTGGG + Intronic
1080995203 11:37591115-37591137 TGTTTTTTAAAAATGAATATTGG - Intergenic
1081216485 11:40405333-40405355 AGGTTATCAAAAATGGAATCTGG + Intronic
1081509466 11:43754597-43754619 AGTTTTTTAAAAATTGTTTTAGG + Intronic
1081766492 11:45614861-45614883 AAGTTTTAAAAAATGCAATTTGG - Intergenic
1082648158 11:55753715-55753737 AAATTTTTAAAAATAAATTTTGG + Intergenic
1082759380 11:57112304-57112326 AGTTTATTAAGAATGGATTTTGG + Intergenic
1082995735 11:59253688-59253710 AAGTTTCTAAAATTAGATTTTGG - Intergenic
1083980151 11:66160820-66160842 AGTTTTTAAAAAATGCTTTTTGG - Intronic
1084217365 11:67656296-67656318 GAGTTTTAAAATATGGATTTAGG + Intergenic
1084789721 11:71466134-71466156 AGGTTTTTAAAAATTGAGAATGG + Intronic
1085687015 11:78632736-78632758 TTGTTTTTAAAAATTGTTTTTGG + Intergenic
1085753171 11:79180157-79180179 AAGATTCTAAAAATGCATTTTGG + Intronic
1085941305 11:81208894-81208916 AAGTTTTTAAAAATTAATTTGGG + Intergenic
1086221883 11:84455562-84455584 CTTTTTTTAAAAATGCATTTGGG - Intronic
1086635819 11:89083124-89083146 AGCTTTTTAAAAATGTTTTGTGG + Intergenic
1086790408 11:91030588-91030610 AGGTTTCAACAAATGAATTTGGG - Intergenic
1087422487 11:97947901-97947923 AGGTTTCAAAATATGCATTTGGG + Intergenic
1087536962 11:99460657-99460679 AAGTTTTTAAAAATCGCTTTAGG - Intronic
1087741662 11:101894899-101894921 AGATTTTTTAAAATGCACTTAGG - Exonic
1087767305 11:102169600-102169622 AAGTTTTTAAAAAAGGTATTTGG - Intronic
1088128150 11:106453203-106453225 AGGTTTTTCAGTATGTATTTTGG + Intergenic
1088474605 11:110222355-110222377 AGGATATTTAAAATGAATTTGGG - Intronic
1088558184 11:111084070-111084092 AGATTTTTAAAAATGCATTTTGG - Intergenic
1088959376 11:114647320-114647342 AAGTTTTATAAAATGAATTTTGG + Intergenic
1089026806 11:115279254-115279276 AAGGTTGCAAAAATGGATTTGGG + Intronic
1089087763 11:115837688-115837710 AGTTTTTTAAAAATGGGTTTTGG - Intergenic
1089356156 11:117855360-117855382 AGATTTTTAAAAATGGGTTTAGG - Intronic
1089500103 11:118926890-118926912 ATGTTTTTAAAAAGCGCTTTGGG - Intronic
1089766187 11:120767420-120767442 AGAGTTTTAAAAATAAATTTTGG + Intronic
1090290845 11:125542988-125543010 AGTTTTTTAAAATTGAACTTTGG + Intergenic
1090299851 11:125626042-125626064 AGGTTTCTAAAGAAGGAGTTCGG + Intronic
1090537720 11:127662742-127662764 AGGTTTTAACATATGAATTTTGG + Intergenic
1090875025 11:130781314-130781336 AGTTTTATATAAAGGGATTTGGG + Intergenic
1091117104 11:133023562-133023584 TGGTTTTAAAAAATAGATCTAGG + Intronic
1091904103 12:4169063-4169085 ATGTGTTAAAAAATAGATTTTGG + Intergenic
1092488347 12:8922112-8922134 TGGTTTAAAAAAATGGCTTTTGG - Intronic
1092705984 12:11285349-11285371 AAGTTAGTAAAAATGTATTTTGG + Intergenic
1093008098 12:14072922-14072944 GGGTTTTTAAAAATATATTTGGG + Intergenic
1093086690 12:14873275-14873297 TGCTTTGTAAAAATGGAATTTGG - Intronic
1093246191 12:16740074-16740096 AACTTTTTGAAAATGCATTTAGG + Intergenic
1093313516 12:17620284-17620306 TGGATTTTACAAATTGATTTAGG + Intergenic
1093818709 12:23584332-23584354 ATATTTTTAAAAAGGAATTTTGG - Intronic
1093892027 12:24533464-24533486 ATGTTTTTAAATATGCATTTAGG + Intergenic
1095051951 12:37562390-37562412 TGGTTTTTAAAAATAGAGATGGG - Intergenic
1095139325 12:38642261-38642283 AGTTTTTTAAAAAACTATTTTGG + Intergenic
1095211681 12:39501697-39501719 GGGTTTTTAAAAATTCATATAGG - Intergenic
1095287282 12:40429264-40429286 AGATTTTTTAAAATGGAATACGG - Intronic
1095288449 12:40445430-40445452 AGCATTTTAACAAGGGATTTGGG - Intronic
1095656860 12:44680413-44680435 AATTTTTTAAAAATCTATTTGGG + Intronic
1095760471 12:45828421-45828443 AGGGTTTTATATATGCATTTTGG + Intronic
1096999681 12:55866065-55866087 AGCTTTTTGAAAAAGGAGTTTGG + Intergenic
1097523211 12:60695475-60695497 AGATTTTTAAAAATTATTTTGGG + Intergenic
1097786588 12:63766727-63766749 AGTTTTTAAAAACTGCATTTTGG + Intergenic
1097787553 12:63778471-63778493 AAGCTTTTAAAAATGTATTTAGG - Intergenic
1098107735 12:67088115-67088137 AACTTTTTAAAAATGGAATGAGG + Intergenic
1098439859 12:70505924-70505946 AGCTTTTTAAATATATATTTTGG - Intergenic
1098555902 12:71818589-71818611 AGCTTTTAAAAAATTTATTTAGG - Intergenic
1098594955 12:72261524-72261546 TGGCTTTTGAAAATGGAATTTGG + Intronic
1098622163 12:72614830-72614852 TGGTTTTTAAAAAGCAATTTGGG + Intronic
1098777738 12:74642654-74642676 AGGTTTTTAAAAATGTATCCTGG + Intergenic
1099085533 12:78242034-78242056 AGGCTTTTAAAAATACATTTGGG + Intergenic
1099087737 12:78266476-78266498 GCTTTTTTAAAAATGGAATTTGG - Intergenic
1099222212 12:79928462-79928484 AGGTTTTTAAAAATGGATTTAGG + Intronic
1099390354 12:82071644-82071666 AGATTTTAACATATGGATTTGGG - Intergenic
1099478435 12:83137549-83137571 AAGTTTTCAAAAATGTATTGAGG + Intergenic
1099521041 12:83662880-83662902 AGCTTTTTAAAAATGCAGTCTGG + Intergenic
1099603335 12:84769530-84769552 AGGCTTTTAAAATTTTATTTCGG - Intergenic
1099657187 12:85508580-85508602 AGGTATTGAAAAATAGATTCTGG + Intergenic
1099675293 12:85753934-85753956 GGGTTTTTAAAAATTTAATTTGG - Intergenic
1099783775 12:87234930-87234952 AGATTATTAAAAATGGTTTGTGG - Intergenic
1099818279 12:87675977-87675999 AGGTTTCAAAATACGGATTTTGG + Intergenic
1099913406 12:88861644-88861666 AGGTATTTAATAATTGCTTTGGG - Intergenic
1099967127 12:89459768-89459790 AGGTTTTTACAAATAGTATTTGG - Intronic
1100141961 12:91630155-91630177 AGGATATTAAATATGGATTATGG + Intergenic
1100151748 12:91746270-91746292 ATGTTTTTAAAAATAATTTTTGG - Intergenic
1100298081 12:93281190-93281212 AGGTTTTAACATATGAATTTGGG + Intergenic
1100338203 12:93652851-93652873 TGATTTTTAAAAATACATTTGGG + Intergenic
1100687242 12:97000151-97000173 GGGTTTTTAGTAATGCATTTTGG + Intergenic
1100988521 12:100227939-100227961 AAGTTATTAAAAATAGCTTTTGG + Intronic
1101128785 12:101667105-101667127 AACTTTTTAAAATTAGATTTTGG + Intronic
1101146728 12:101847785-101847807 ATCTTTTGAAAAATGTATTTCGG + Intergenic
1102354329 12:112220215-112220237 AGATTTTTAAAAATTAATTTAGG - Intronic
1102404406 12:112660705-112660727 AGGATTTAAAAAATAGTTTTGGG - Intronic
1102493923 12:113306333-113306355 AGGCTTTAAAATAGGGATTTGGG - Intronic
1102743769 12:115231560-115231582 AGGCTATTAAAAATGTATTTTGG - Intergenic
1102845346 12:116175377-116175399 AGCTTTTTAAGAATGTTTTTAGG - Intronic
1102848894 12:116219737-116219759 ACTTCTTTAAAAATGGCTTTTGG - Intronic
1103483322 12:121265458-121265480 AGGTTTTGACATATGAATTTTGG - Intronic
1103620047 12:122181980-122182002 AGGTTCTGACAAATGAATTTTGG - Intronic
1104314767 12:127687482-127687504 ATGTATTTTAAAATAGATTTTGG + Intergenic
1104860752 12:131922198-131922220 AGGTGTTTAAGAATTGGTTTTGG + Exonic
1105241513 13:18612868-18612890 AGGTGTTTAAATGTTGATTTTGG + Intergenic
1105418621 13:20233346-20233368 AAGTTTTTAAAACTTGACTTGGG - Intergenic
1105720268 13:23106840-23106862 AGTTTTTTAAAAAAGGAGTTTGG - Intergenic
1105972583 13:25443985-25444007 AGGTATATAAAAATGCATTCAGG - Intronic
1106114414 13:26804599-26804621 ATCTTTTTAAAAATCTATTTAGG - Intergenic
1106171939 13:27296146-27296168 AGGTTTTGAATTATGAATTTTGG - Intergenic
1106507825 13:30386934-30386956 AGGTTTTTATAAGTGCAGTTGGG - Intergenic
1106725804 13:32484456-32484478 TGCTTCTTAAAAATGGATCTAGG + Intronic
1106955582 13:34935217-34935239 ATTTTTTTAAAAGTGGAATTGGG + Intergenic
1107064370 13:36196668-36196690 GGGTTTTCAAAAATGGACATAGG - Intronic
1107477176 13:40748974-40748996 AGGTTTTTTAAAAAAGATGTTGG - Intronic
1107590921 13:41904221-41904243 AGCTTTTTAGAAATTGTTTTAGG - Intronic
1108090116 13:46840727-46840749 AGGTTTTTAACATTGGCTTCAGG + Intronic
1108108664 13:47043319-47043341 AGCTTTCTGAAAATGTATTTTGG + Intergenic
1108337274 13:49457854-49457876 AAGTATTTAAAAATAGCTTTTGG - Intronic
1108568035 13:51720899-51720921 AGGTTTTGACATATGAATTTTGG + Intronic
1108761185 13:53567418-53567440 AGGTAATTAAAAGTGGTTTTAGG + Intergenic
1109080396 13:57892325-57892347 ATGTTTCTAAAACTGGTTTTTGG - Intergenic
1109284004 13:60390479-60390501 TTTTTGTTAAAAATGGATTTTGG + Intergenic
1109387990 13:61657613-61657635 AGATTTTAAAAAGTGGAGTTGGG - Intergenic
1109649637 13:65309534-65309556 AGCATTTTAAAGATGGTTTTAGG + Intergenic
1109979493 13:69888273-69888295 AGGTTTTAACATATGGAATTTGG + Intronic
1110311568 13:74056115-74056137 ATGTTTTTAAAATAGGATATAGG + Intronic
1110347751 13:74467897-74467919 ATTTTTTTAAAAATGTATATTGG - Intergenic
1110386676 13:74920315-74920337 AGTATTTTAAAAGTAGATTTGGG - Intergenic
1110709861 13:78638792-78638814 TGGTTTTTAAAAATCTATTATGG - Intronic
1110886678 13:80646451-80646473 AATTTTTTAAAAATAGTTTTTGG + Intergenic
1110932823 13:81244240-81244262 AGCTTTTTAAAATTTAATTTTGG + Intergenic
1111000215 13:82168906-82168928 AGATTAATAAAAATGGAATTTGG + Intergenic
1111016049 13:82383459-82383481 AAATTTTTAAAAATATATTTGGG + Intergenic
1111091254 13:83451148-83451170 AGAATGTAAAAAATGGATTTGGG + Intergenic
1111195018 13:84863534-84863556 GTGTTTTTAATAATGGGTTTAGG - Intergenic
1111203235 13:84967335-84967357 AAATTTTGAAAAATGTATTTTGG + Intergenic
1111344950 13:86939496-86939518 AGGTTTTCAAAAATGTTTCTGGG + Intergenic
1111497419 13:89070483-89070505 AGATTTTAACAAATGGATTTAGG - Intergenic
1111666149 13:91271540-91271562 AATTTTTTAAAAATGAAGTTAGG + Intergenic
1111696971 13:91637235-91637257 AGTTTGTTAAAATTGGATTTAGG + Intronic
1112745376 13:102521731-102521753 AGATTTTTAAAGAGAGATTTGGG + Intergenic
1112754504 13:102616255-102616277 AGGTTTTAAAAAATCATTTTTGG - Intronic
1112998504 13:105603371-105603393 AGGTGTGTCAAGATGGATTTTGG + Intergenic
1113014523 13:105813251-105813273 AGGAATTTCAAAATGCATTTAGG + Intergenic
1113054665 13:106255166-106255188 ATGTTATTCATAATGGATTTGGG - Intergenic
1113380661 13:109802473-109802495 TAGTTTTTAAAAATGGATACTGG - Intergenic
1114289112 14:21273120-21273142 TGGTTTTTAAAAATGATATTGGG - Intergenic
1114412566 14:22514682-22514704 ATGTATTTAAAAATGGCTTTTGG - Intergenic
1114543213 14:23479062-23479084 GAGTTTTTAAAAAAGGCTTTGGG + Intronic
1114732479 14:25008171-25008193 AAATTTTTAAAAATGAATTGTGG - Intronic
1114910584 14:27190888-27190910 AGATTTTAACATATGGATTTTGG - Intergenic
1114976719 14:28110586-28110608 AGGTTTCTAAAATTGAATGTGGG - Intergenic
1115050252 14:29051557-29051579 AGGATTTAAAAAATGCAATTAGG + Intergenic
1115167324 14:30463675-30463697 TGATTTTTAAAAATGGAGATGGG - Intergenic
1115230049 14:31150792-31150814 AGCTTTTTAAAGATAAATTTTGG + Intronic
1115322392 14:32097216-32097238 GGGTTTTAAATAAGGGATTTTGG + Intronic
1115481299 14:33864023-33864045 ATATTTTTAAAAGAGGATTTAGG + Intergenic
1115566095 14:34627005-34627027 AAATTTTTAAAATTGTATTTCGG - Intronic
1115625167 14:35184508-35184530 AAGTTTTTTAAAAAAGATTTAGG - Intronic
1115838581 14:37439553-37439575 AGCTTTTCAAAAATGTATTTAGG - Intronic
1116075909 14:40110620-40110642 AAGTTTTTAAAAAATGATTATGG + Intergenic
1116355992 14:43930822-43930844 TGTTATTTAAAAGTGGATTTGGG + Intergenic
1116528843 14:45941186-45941208 AGGTTTCAACATATGGATTTTGG + Intergenic
1116585482 14:46697723-46697745 AGGTTTTAACAGATGAATTTTGG + Intergenic
1116631885 14:47346478-47346500 GGATTTTTAAAAATGCAATTAGG - Intronic
1116704146 14:48275294-48275316 AATTTTTTATAAATGGAATTAGG - Intergenic
1116742432 14:48774091-48774113 AGGTATTTAAAAATGTGTTAGGG - Intergenic
1116937955 14:50761525-50761547 ATGTTTTTAAAAAAGAAATTGGG + Intronic
1117677955 14:58173936-58173958 AAATTTTTAAAAATACATTTGGG + Intronic
1117949448 14:61067108-61067130 ATGTTTTTAAAAAAAGATTTTGG + Intronic
1118409632 14:65464989-65465011 CAGGTTTTAAAAATTGATTTAGG + Intronic
1118676491 14:68190711-68190733 AACTTTTTAAAAATGGAGTCAGG - Intronic
1118677859 14:68207812-68207834 AGGTTTTTAAATCTGGATTTAGG + Intronic
1119893998 14:78204437-78204459 AGGTATATAAAAATATATTTAGG + Intergenic
1120117388 14:80636012-80636034 ATTTTTTAAAAATTGGATTTTGG - Intronic
1120134486 14:80849630-80849652 TATTTTTTAAAAAGGGATTTGGG + Intronic
1120367629 14:83591049-83591071 TGGTTTTGAAAAAGGGGTTTGGG - Intergenic
1120386672 14:83855348-83855370 AGATTTTTTAAAATAGAATTGGG + Intergenic
1120465062 14:84845851-84845873 TTGTTTTTGAAAATGTATTTGGG - Intergenic
1120756370 14:88248182-88248204 AGTTTTTTAAAAATAGAAATTGG - Intronic
1120794251 14:88614785-88614807 AAGTTTTTACAAATGGAGTTGGG + Exonic
1120846322 14:89129243-89129265 GGGTATTTACAACTGGATTTGGG + Intronic
1120935105 14:89888141-89888163 AGGTTTTAACATATGCATTTGGG - Intronic
1121069119 14:91000222-91000244 AGCTTTTTAAAAACTTATTTTGG + Intronic
1121281162 14:92699603-92699625 AAATTTTAAAAAATGGATGTTGG + Intergenic
1121810326 14:96881659-96881681 AGGTGTTTAATAAAAGATTTTGG - Intronic
1121949703 14:98160645-98160667 AGGTTTTTTATAATAGATTTTGG + Intergenic
1122010553 14:98743006-98743028 AGTTTTATAATAATGGGTTTTGG + Intergenic
1122395978 14:101431541-101431563 TTGTTTTTAGAAATGGATATTGG + Intergenic
1122617984 14:103034209-103034231 ATGTTTTTAAAAATAAAGTTTGG - Intronic
1122866602 14:104608013-104608035 TGGCTTTTAAAAGTGAATTTTGG - Intergenic
1123137365 14:106040827-106040849 AGGTCTTTTAAAATGGATTTTGG - Intergenic
1202871513 14_GL000225v1_random:169258-169280 CTGTTTTTAAAAATGACTTTTGG - Intergenic
1123489842 15:20772278-20772300 AGGTGTTTAAATGTTGATTTTGG - Intergenic
1123546341 15:21341365-21341387 AGGTGTTTAAATGTTGATTTTGG - Intergenic
1123828752 15:24110958-24110980 CTGTTATCAAAAATGGATTTTGG + Intergenic
1123843665 15:24274391-24274413 CTGTTATCAAAAATGGATTTTGG + Intergenic
1124131480 15:26991434-26991456 AGTTTTTTAAAATTTTATTTTGG + Intronic
1124228627 15:27919929-27919951 AAGTTTTTAAGAATAGTTTTAGG - Intronic
1124459182 15:29873315-29873337 AGATTTTAAAAAATTGATTCTGG + Intronic
1124477900 15:30051312-30051334 TGTGTTTTAAAAATAGATTTAGG + Intergenic
1124484248 15:30101454-30101476 AGTTTCTTAAAAATGTTTTTTGG + Intergenic
1124490630 15:30152797-30152819 AGTTTCTTAAAAATGTTTTTTGG + Intergenic
1124503087 15:30247763-30247785 AGTTTTTAAACAATGAATTTGGG - Intergenic
1124519334 15:30395770-30395792 AGTTTCTTAAAAATGTTTTTTGG - Intergenic
1124539321 15:30570451-30570473 AGTTTCTTAAAAATGTTTTTTGG + Intergenic
1124740468 15:32290883-32290905 AGTTTTTAAACAATGAATTTGGG + Intergenic
1124752903 15:32385532-32385554 AGTTTCTTAAAAATGTTTTTTGG - Intergenic
1124759329 15:32437121-32437143 AGTTTCTTAAAAATGTTTTTTGG - Intergenic
1124936747 15:34179686-34179708 AGGTTTTTCAAAAGAGATATAGG + Intronic
1124936775 15:34180066-34180088 AGATTTTTAAAAAGGGTTTGTGG - Intronic
1125243734 15:37608787-37608809 AGTTTTTTAAAAATTTATTCTGG - Intergenic
1125253256 15:37731133-37731155 AGGCTTTTGGAAATGGATTCGGG + Intergenic
1125762555 15:42106948-42106970 TGGTCTTTAAAAAGGGATGTTGG + Intergenic
1126019456 15:44385909-44385931 AGGTTTTTGAAAAGGTATTCTGG + Intronic
1126261735 15:46701141-46701163 TGGTTTTAAAAATTGTATTTAGG + Intergenic
1126509315 15:49449911-49449933 AGGTTTTTAGAAATGTATGGAGG + Intronic
1126514178 15:49516440-49516462 TACTTTTTAAAAATAGATTTTGG + Intronic
1126805342 15:52342611-52342633 AGGTTTTTAAAGAAGGTGTTTGG + Intronic
1127018450 15:54716541-54716563 AGTTCTCCAAAAATGGATTTGGG - Intergenic
1127407559 15:58667555-58667577 AGATTTTTAAAAATTGGCTTTGG - Intronic
1127683703 15:61321435-61321457 ATGTTTTTAAAAATAGACTTTGG + Intergenic
1127690566 15:61391965-61391987 ATGTTTTTAAAAAAGGTCTTTGG + Intergenic
1127886246 15:63203803-63203825 TGGGGTTTAAAAATGGATTCTGG - Intronic
1128243665 15:66118531-66118553 AGGATTTCCAAAAAGGATTTGGG - Intronic
1128430562 15:67589149-67589171 ATGTTTTTAAAAGTGATTTTTGG + Intronic
1128643657 15:69359245-69359267 AGGTTTTGACACATGAATTTTGG + Intronic
1129063126 15:72877234-72877256 AGGTTTTTAAATTTAAATTTTGG + Intergenic
1129146683 15:73654382-73654404 ATGTTTTTAAAAATGTACCTAGG + Intergenic
1129306043 15:74663571-74663593 GGATTTTTTAAAAAGGATTTTGG - Intronic
1129553517 15:76479795-76479817 AGGTGTATGACAATGGATTTTGG - Intronic
1129882123 15:79014072-79014094 AAATTTTTAAAAATAGATGTTGG + Intronic
1130191171 15:81737722-81737744 GGTTTTTTAAAAATAGAATTGGG - Intergenic
1130568420 15:85018949-85018971 TCTGTTTTAAAAATGGATTTTGG + Intronic
1130950577 15:88583806-88583828 AGGTTTTTAAAAATATGATTTGG - Intergenic
1131021755 15:89104959-89104981 AGATTTTTAAAAATATGTTTAGG + Intronic
1132058464 15:98670353-98670375 AGAACTTTAAAAATGTATTTTGG + Intronic
1132316236 15:100892430-100892452 AGGTTGTTAAAGATGGAAGTTGG - Intronic
1132378059 15:101344913-101344935 ATGTATTTAAAAATGTATTTGGG - Intronic
1202954668 15_KI270727v1_random:68580-68602 AGGTGTTTAAATGTTGATTTTGG - Intergenic
1133090422 16:3400129-3400151 TATATTTTAAAAATGGATTTGGG + Intronic
1133131789 16:3680670-3680692 AGGTCTTAATATATGGATTTGGG - Intronic
1133665394 16:7962319-7962341 AGGTTTTCTAAATTGGACTTGGG + Intergenic
1133830244 16:9316339-9316361 AGGTTTTAAAATATGAATTTTGG + Intergenic
1133866240 16:9646226-9646248 AAGATATTAAGAATGGATTTGGG - Intergenic
1133957453 16:10457189-10457211 GAGTTTTTAAAAATTCATTTTGG + Intronic
1134425449 16:14139185-14139207 AGAGTTTTAAAAATATATTTTGG - Intronic
1134622765 16:15702052-15702074 AGGTTTTTAGAAATGTATCCGGG + Intronic
1134802795 16:17100898-17100920 AGGTTTTGACAAATGAATCTTGG + Intergenic
1135094616 16:19554975-19554997 ACGTTTTTAAAAATTATTTTAGG - Intergenic
1135279648 16:21142966-21142988 AGGATCTTAAAAATTTATTTTGG - Intronic
1135720654 16:24814802-24814824 AAATGTTTAAAAATGGATTGTGG - Intronic
1135875206 16:26192511-26192533 ATGTTTTATAAAATGTATTTTGG - Intergenic
1136004677 16:27320678-27320700 AGTTTTTCAAAAATGGTTCTGGG - Intronic
1136053411 16:27669856-27669878 AAGTTTTTAAAAATAGAGTTGGG + Intronic
1136252713 16:29016681-29016703 AGTTTTTTAAAAAAATATTTAGG + Intergenic
1137260722 16:46827517-46827539 ACTTTTTTAAAAAAAGATTTAGG + Intronic
1137327027 16:47450329-47450351 AGGTTTTTAATAAAGAATATGGG - Intronic
1137601915 16:49762110-49762132 CAGCTTTTAAATATGGATTTGGG - Intronic
1137739000 16:50746696-50746718 AGGTTTATAAAAATGTTTTAGGG - Intronic
1137952111 16:52793119-52793141 AAATTTTTAAAAATAGGTTTAGG - Intergenic
1138052534 16:53795284-53795306 AGATTTTTTAAAAGGCATTTAGG + Intronic
1138799184 16:60005408-60005430 AGGTTTTTAGAAAAGGCTTCTGG - Intergenic
1138816854 16:60212509-60212531 AGGTTTCAACATATGGATTTTGG - Intergenic
1139779899 16:69342055-69342077 GGGGTTTTAAAAATGAAATTTGG + Exonic
1140706201 16:77632717-77632739 AGGTTTCAAAATATGAATTTGGG + Intergenic
1140717110 16:77736579-77736601 ATATTTTTAAAAATGAATTTTGG + Intronic
1141332018 16:83119448-83119470 AGGCTTTTAAAAAGGCATTTTGG - Intronic
1141978710 16:87535860-87535882 AGGCTTTTAATCATGTATTTGGG - Intergenic
1142553923 17:759243-759265 AGATTTTTAAAAATAAACTTAGG - Exonic
1142837262 17:2595860-2595882 ATTTTTTTAAAAAAGGATGTGGG - Intronic
1143229157 17:5337132-5337154 ATGTTTTTGAGAATGGACTTGGG + Intronic
1143351898 17:6295045-6295067 TGGTTTTTAAAAAATAATTTAGG + Intergenic
1144158380 17:12531682-12531704 AGGTTTATAATAATATATTTGGG - Intergenic
1145211734 17:21018414-21018436 AGGTTTTTAAAAATGTTCTAGGG + Intronic
1145846457 17:28042423-28042445 AGGTGTTTAGAAAAGGATGTGGG + Exonic
1146146530 17:30423388-30423410 AATTTTTTAAACATGTATTTTGG - Intronic
1146226165 17:31068210-31068232 TGCTTGTTAAAAATGGATTTTGG - Intergenic
1146257161 17:31398361-31398383 AGGTTTTGCCAAATGGATTCAGG - Intronic
1146306992 17:31737866-31737888 AGTTTTTAAAAAATATATTTAGG + Intergenic
1146459544 17:33034523-33034545 AGGTTTTTTAAGTTGGTTTTGGG - Intronic
1146664228 17:34686406-34686428 AGGATTTTTAACATGAATTTGGG - Intergenic
1147552366 17:41452965-41452987 AATTTTTTAAAAATGAAGTTAGG + Intergenic
1148355980 17:46976230-46976252 AAGTTTTTAAAAAAGAAATTTGG + Intronic
1148498144 17:48067348-48067370 AGGTATTTAAAAATTTAATTAGG + Intergenic
1148659663 17:49319080-49319102 AGCTTTTTAAAAATTAATATTGG - Intronic
1148942478 17:51226940-51226962 ACGTTTTTAAAAATTGCTTTGGG + Intronic
1149384902 17:56132906-56132928 AGGTTTTAAGACATGAATTTTGG + Intronic
1149427553 17:56569752-56569774 ATGATTTGAAAAATGGATCTTGG + Intergenic
1149435109 17:56627169-56627191 AGTTATTTAAAAATAAATTTAGG + Intergenic
1149725475 17:58889298-58889320 AGCTTTTTAAAAATCATTTTAGG + Intronic
1150032886 17:61758849-61758871 AGTTTTTAAAAAATGTATCTGGG + Intronic
1150119264 17:62586017-62586039 ATGTATTTAATAATGTATTTTGG + Intronic
1150179231 17:63097607-63097629 AAGTTTATAAAATTTGATTTGGG + Intronic
1150526533 17:65929142-65929164 TGGTTTTAAAAAATGTATTCAGG - Intronic
1153060960 18:994721-994743 AGGTTATAAAAAATGGACATGGG + Intergenic
1153261506 18:3228695-3228717 AGTGTTTTAAAACTGGATTTTGG - Intergenic
1153637421 18:7125005-7125027 AGACTTTTAAAAATTGGTTTTGG + Intergenic
1153651580 18:7245640-7245662 AGGTATTTAAAAATGCACATTGG + Intergenic
1153683134 18:7519708-7519730 TGGTTTTGGAAAATGAATTTTGG - Intergenic
1153908361 18:9684255-9684277 AAGTTTCAAAACATGGATTTAGG - Intergenic
1154007335 18:10543529-10543551 AGGTAGTTAAAAATAGGTTTTGG + Intronic
1154183311 18:12156775-12156797 ATGTTTTTAAAAATTAATATAGG - Intergenic
1154402386 18:14053227-14053249 AGATTTTTAAAAATTGCTTTTGG + Intergenic
1154447444 18:14447038-14447060 AGGTGTTTAAATGTTGATTTTGG - Intergenic
1154958469 18:21283550-21283572 AGCTTTTTAAAATTTGTTTTTGG - Intronic
1155131097 18:22935132-22935154 AAGTTTTTAAAAGTAGAATTAGG - Intronic
1155329584 18:24701186-24701208 AGGTTTTTAAAAATAAAATGAGG - Intergenic
1155573283 18:27218535-27218557 AGTTTTTTAAAAATAGATTTTGG + Intergenic
1155752175 18:29439097-29439119 AGATTTCTAAAAATGGGTTTGGG - Intergenic
1155848947 18:30745980-30746002 AGGTTTTAAATAATGCATTGTGG + Intergenic
1155911543 18:31509955-31509977 AGCTCTTTAAGAATGGATTGGGG + Intronic
1156029685 18:32698044-32698066 AGATTTTTTAAAATAAATTTGGG - Intronic
1156733771 18:40228380-40228402 ACATTTTAAAAAATGGAATTTGG - Intergenic
1156836649 18:41563179-41563201 ATGTTTTTAACAATGTATTAAGG + Intergenic
1157380226 18:47207731-47207753 AGTCTTTTAAAAAAGGATATTGG - Intergenic
1158034616 18:53011525-53011547 ATTTCTTTAAAAATGGTTTTTGG - Intronic
1158094124 18:53751064-53751086 GGGTTTTAAAAAATTTATTTTGG - Intergenic
1158164701 18:54527512-54527534 AGTTTTTTAAAAATCCATTTAGG + Intergenic
1158218565 18:55126411-55126433 AGGTTTTTATAAATGGACTCAGG - Intergenic
1158445049 18:57512188-57512210 AGGCTTTTGAAAATGGAATAAGG - Intergenic
1158903069 18:61984281-61984303 AGGTTTTAACATATGAATTTTGG + Intergenic
1158939870 18:62397487-62397509 AGGTTTCAAAATATGAATTTGGG + Intergenic
1158953012 18:62513709-62513731 CTGTTTTTAAAAATTCATTTGGG - Intergenic
1159218891 18:65433912-65433934 AGCTTTTTATAAATTGTTTTTGG - Intergenic
1159232666 18:65629313-65629335 AGGTTTCAAAATATGAATTTTGG - Intergenic
1159238132 18:65704397-65704419 AGGTTTTAAAAAATAGAATGAGG + Intergenic
1159294642 18:66468516-66468538 AAGTTTTTAAAAAGGAATTAAGG + Intergenic
1159349791 18:67257972-67257994 AGGTTTCTAAATATGAATTTTGG + Intergenic
1159524963 18:69576714-69576736 AAGTTATTAAAAATGCATTAGGG + Intronic
1159733770 18:72066752-72066774 AAATTTTGAAAGATGGATTTTGG + Intergenic
1159851794 18:73534111-73534133 AGTTTTTTTAATATGTATTTGGG - Intergenic
1159869550 18:73744912-73744934 AGGTTTTAAAAAAAGACTTTAGG - Intergenic
1159968363 18:74619140-74619162 AGTATCTTAATAATGGATTTGGG - Intronic
1160321813 18:77903345-77903367 AGGATTTTAAAGACGCATTTAGG - Intergenic
1160382460 18:78471067-78471089 AGGTTTCAACATATGGATTTCGG - Intergenic
1160856392 19:1219857-1219879 AAGTTTTTAAAAACAGTTTTGGG + Intronic
1161539694 19:4842917-4842939 AGTTTTTAAAAAATCGATCTGGG + Intronic
1161787966 19:6339971-6339993 AGGTTTTTAAAAGAGGGGTTTGG + Intergenic
1162200241 19:9014796-9014818 AGTTTTTTAAAAAAGGAACTGGG + Intergenic
1162521849 19:11185480-11185502 ATGATTTTAAAAATATATTTTGG - Intronic
1162674932 19:12292025-12292047 AGTTTTTAAAAAATGGAATAGGG + Intronic
1163087049 19:14989251-14989273 ATTTTTTTTAAAATAGATTTTGG - Intronic
1163868407 19:19795828-19795850 AATTTTTTACAAATGTATTTTGG - Intronic
1163911359 19:20196774-20196796 AATTTTTTACAAATGTATTTTGG + Intronic
1163922346 19:20302715-20302737 AATTTTTTACAAATGTATTTTGG + Intergenic
1163946917 19:20546144-20546166 AATTTTTTACAAATGTATTTTGG - Intronic
1163971848 19:20805637-20805659 AATTTTTTACAAATGTATTTTGG + Intronic
1164020118 19:21294896-21294918 AATTTTTTACAAATGTATTTTGG - Intronic
1164454934 19:28398981-28399003 AATTTTTTAAAAATTTATTTTGG - Intergenic
1164920751 19:32086788-32086810 AGAACTTTAAAAAGGGATTTTGG + Intergenic
1165345247 19:35243098-35243120 TGGTTTTTAAAAATACATTCTGG - Intergenic
1165653178 19:37509088-37509110 AGATTTGAAAAAATAGATTTAGG + Intronic
1165948080 19:39457412-39457434 TAGTTTTTTAAAAGGGATTTGGG + Intronic
1166570858 19:43796193-43796215 AGGTTTCAAAAGATGAATTTTGG + Exonic
1167211053 19:48134347-48134369 AGTTTTTAAAAAAAGGTTTTTGG + Intronic
1167321904 19:48802042-48802064 AGGTTTTAAAAAATTCATCTGGG - Intronic
1168188197 19:54715455-54715477 AGGTTTTTAAAAATATCTTTTGG + Intergenic
1168555116 19:57331991-57332013 TTCTTTTTAAAAATTGATTTGGG + Intergenic
925272971 2:2627632-2627654 TGGTTTTTGAAAAAGGATCTGGG - Intergenic
925456627 2:4021866-4021888 AGGATTTGAAATATGAATTTGGG + Intergenic
925515656 2:4678031-4678053 AGGTTTTAACATATGAATTTTGG + Intergenic
925694357 2:6560104-6560126 AGGTTTTTAAATATGGAATGTGG + Intergenic
925727443 2:6887486-6887508 AGAGTTTTAAAAATAAATTTAGG - Intronic
925736170 2:6965720-6965742 AGATTTATAAAAATTGCTTTTGG + Intronic
926399125 2:12477671-12477693 TTGTTTTTAAAAATACATTTTGG - Intergenic
926400945 2:12495944-12495966 AGGTTTTTAAAAATGGCCACAGG - Intergenic
926642711 2:15254294-15254316 AGGTTTTTTAAAATGCAGTTTGG - Intronic
926666318 2:15527680-15527702 AAGTTTTAATACATGGATTTTGG + Intronic
926674477 2:15609157-15609179 ACGTCTTTATAAAAGGATTTGGG + Intronic
926882420 2:17561402-17561424 AGCTTCTTAAAAAGGGACTTGGG + Intronic
928327917 2:30334733-30334755 AGCTTTTTAAAAAGGGAGTGGGG - Intergenic
928569606 2:32591428-32591450 TTCTTTTTAAAAGTGGATTTAGG + Intronic
928876146 2:36042254-36042276 AGGTTTTTAAAATTGCAGATGGG + Intergenic
929037479 2:37708425-37708447 AGGAATTCAAAAGTGGATTTGGG - Intronic
929305821 2:40360369-40360391 AGCTTTTTAAAAATAGAATTAGG + Intronic
929414442 2:41732969-41732991 ATATTTTTAAAAATGAATTTGGG + Intergenic
929436617 2:41933504-41933526 AGGTTTTTAAGAAAGGATAAAGG - Intergenic
929663307 2:43811892-43811914 AGGTTATTAAAAATGGGTTCTGG - Intergenic
929971680 2:46583908-46583930 AAGTTCTTAAAAATAAATTTAGG + Intronic
930260319 2:49139196-49139218 AGAACTTTAAAAAGGGATTTTGG + Intronic
930332564 2:50004423-50004445 TGATTTTTAAAAATTGTTTTTGG + Intronic
930967309 2:57345382-57345404 ATGTTTTAAAAAGTGGAGTTGGG - Intergenic
931013202 2:57943096-57943118 AGGATTATAAAAATGGATTCAGG - Intronic
931275241 2:60738455-60738477 AGGTTTTAAAAAAACCATTTGGG - Intergenic
931596960 2:63957659-63957681 AGGTTTCTACTAATGGATTTGGG - Intronic
931692538 2:64847495-64847517 TGATTTTTAAAAAAGGAGTTGGG - Intergenic
931747058 2:65299746-65299768 AGGTTGTTAACAGTAGATTTGGG + Intergenic
931813912 2:65881277-65881299 GTGTTTTTCAGAATGGATTTGGG + Intergenic
932092883 2:68822530-68822552 AGATCTTTAAAAATGAATTCTGG + Exonic
932269086 2:70393260-70393282 AGGTTTCAACATATGGATTTTGG - Intergenic
932918708 2:75884913-75884935 TAATTTTTAAAAATGGAATTAGG + Intergenic
932988970 2:76763260-76763282 AGGCTTTAAAAAATAAATTTTGG - Intronic
933113863 2:78441240-78441262 ATTTTTTTAAAAATAGATTCAGG - Intergenic
933184837 2:79267522-79267544 AGGTTTTAACATATGAATTTTGG + Intronic
933244707 2:79962419-79962441 AGGTTTTAACATATGAATTTTGG + Intronic
933412718 2:81945948-81945970 AGCTTTTTAAATATGTTTTTTGG + Intergenic
933566713 2:83959027-83959049 AGGTACCTAACAATGGATTTGGG - Intergenic
933638160 2:84729768-84729790 ATTTTTTTAGAAATGTATTTGGG + Intronic
933763803 2:85694046-85694068 AGCTGTTTAAAAATAGTTTTTGG + Intronic
934167736 2:89310251-89310273 ACGTTTTTAAAAATGAGCTTAGG + Intergenic
934199549 2:89872332-89872354 ACGTTTTTAAAAATGAGCTTAGG - Intergenic
934893418 2:98089985-98090007 AGATTTTGTAAAGTGGATTTGGG - Intronic
935296031 2:101650429-101650451 AGGTCTTCAAACATGGATGTTGG - Intergenic
935520558 2:104098785-104098807 ATGTGTTAAAAAAGGGATTTCGG + Intergenic
935550534 2:104448710-104448732 TTGTTTTTAAAAATATATTTAGG - Intergenic
935590252 2:104841812-104841834 AGGTTATCAAAAATACATTTTGG + Intergenic
935698311 2:105788905-105788927 GGGTTTCTAAAAATGTATTCTGG + Intronic
936023587 2:109014309-109014331 AGGGTTTTCAAATTGGGTTTTGG - Intergenic
936084508 2:109457399-109457421 ACTATTTTAAAAATGCATTTTGG - Intronic
936143846 2:109965733-109965755 AGGTTTTGAAATACGAATTTTGG - Intergenic
936180528 2:110263695-110263717 AGGTTTTGAAATACGAATTTTGG - Intergenic
936200841 2:110405736-110405758 AGGTTTTGAAATACGAATTTTGG + Intronic
936272962 2:111065668-111065690 AGGTTTTTAAAAATCCAGTTAGG + Intronic
936470837 2:112797424-112797446 AGGTTTTAACATATGAATTTTGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936561779 2:113545179-113545201 ACTTTTTTAAAAATTTATTTTGG + Intergenic
936930603 2:117784733-117784755 AGGTTTTAACATATGAATTTTGG - Intergenic
937073176 2:119080942-119080964 AGGCTGTTAAAAATGTATTGTGG - Intergenic
938099407 2:128488038-128488060 AGGTTTTTAAAATGGATTTTGGG - Intergenic
938099408 2:128488039-128488061 GAGGTTTTTAAAATGGATTTTGG - Intergenic
938404107 2:131018471-131018493 AGTTTTTCAAAAATGTATTCTGG + Intronic
938819761 2:134945140-134945162 AGGTTTTACAAAAGGGATTGGGG - Intronic
939142579 2:138372818-138372840 AGGTTATTAAAATTTGATTTGGG - Intergenic
939309992 2:140463557-140463579 TTGTTTTGAAAAATTGATTTTGG - Intronic
939312837 2:140506542-140506564 ATGTTTATAAAAATGTCTTTGGG - Intronic
939373262 2:141330244-141330266 ATATTTTTAAAAATGTAATTGGG - Intronic
939606179 2:144257161-144257183 AGATTTTTAAAAATAGTTTGTGG - Intronic
939997808 2:148936663-148936685 ACGATCTTAAACATGGATTTAGG + Intronic
940015286 2:149098322-149098344 AGATTTTAAAAAATGGCTTTGGG + Intronic
940298270 2:152152248-152152270 GGATTTTTAAAAATGTTTTTGGG + Intronic
940300726 2:152174500-152174522 ATGTTTTTTAAAATGGCTTAGGG + Intronic
940722123 2:157293468-157293490 AGGTTTCAAAATATGAATTTTGG + Intronic
940942108 2:159573763-159573785 TGTTTTTTAAAAATATATTTTGG - Intronic
941160799 2:162031942-162031964 AAGTTTTTAAAAATGTTTCTGGG - Intronic
941216548 2:162716903-162716925 TGGTTGTTAAAAATGTCTTTAGG + Intronic
941233057 2:162935333-162935355 AAGTTTTAAAAAAAGGAATTTGG + Intergenic
941251628 2:163172512-163172534 AGTTCTTTAAAAGTGGAGTTTGG - Intergenic
941415243 2:165212490-165212512 CTATTTTAAAAAATGGATTTTGG - Intergenic
941460534 2:165766244-165766266 AGGACTTTTAACATGGATTTAGG - Intronic
941764236 2:169278950-169278972 AGATTTTTAAAGATGGAGGTTGG - Intronic
941835000 2:170006338-170006360 ATGTTTGTAGAATTGGATTTAGG + Intronic
942364470 2:175209017-175209039 AGTTTTTTAAAAATCAAATTAGG - Intergenic
942390567 2:175487993-175488015 AGTTTTTTAAACATTTATTTTGG - Intergenic
942770116 2:179507096-179507118 ATTTTTTTAAAAAAAGATTTAGG + Intronic
942789741 2:179746999-179747021 AATTTTTTAAAAAGGGTTTTAGG + Intronic
943313832 2:186360931-186360953 AGGTTTTAACATATGAATTTGGG - Intergenic
943671205 2:190663155-190663177 TGATTTTTAAAAATGAATTATGG + Intronic
943957533 2:194211637-194211659 AAGTTTTGAAAAAGGGATCTGGG - Intergenic
944014440 2:195017755-195017777 AAGTATTTAAAAATACATTTTGG - Intergenic
944102466 2:196043108-196043130 AGTATTCTAAAACTGGATTTTGG + Intronic
944346119 2:198667879-198667901 AGGCTTTTAAAATTAGATTCAGG - Intergenic
944381098 2:199111796-199111818 AGGTTTCAACATATGGATTTTGG - Intergenic
944568553 2:201017901-201017923 AGTTTTTTTAAAATGGAATGTGG - Intronic
944693647 2:202181268-202181290 ATGTTCTTAAAAATGATTTTAGG - Intronic
944832956 2:203551054-203551076 AGTCTTTTTAAAATGGATTAAGG + Intergenic
945493740 2:210484926-210484948 CAGTTTTTAAAAATAGATCTTGG + Intronic
945837556 2:214850507-214850529 ATGATTTTCAAAATGGCTTTGGG + Intergenic
946100820 2:217319993-217320015 AAGTTTTTAAAAAATCATTTAGG - Intronic
946421159 2:219565604-219565626 GGGTTTTTAAAAATAGGCTTAGG + Intronic
946881179 2:224178675-224178697 TGGTGGTTAAAAATGGATTCTGG + Intergenic
947063765 2:226196711-226196733 AAGTTTTAAAATATGCATTTGGG + Intergenic
947165366 2:227256177-227256199 AGCTTTTAAAAACTGCATTTGGG + Intronic
947170169 2:227302954-227302976 AGTTTTTTAAAAATGCAAATAGG - Intronic
947737301 2:232462551-232462573 GGTTTTTTAAAAAAGGATTCTGG - Intergenic
948072574 2:235139778-235139800 AGGTCTTTAAAAATGATTTGAGG + Intergenic
948154292 2:235768922-235768944 GGGTTTTTCAAACTGTATTTCGG - Intronic
948412820 2:237777719-237777741 GTCTTTTTAAAAATTGATTTTGG + Intronic
1168730603 20:76405-76427 ATCTTTTTAAAAAAGGTTTTAGG + Intergenic
1169384033 20:5132818-5132840 CATTTTTTAAAAATAGATTTTGG - Intronic
1169857218 20:10115964-10115986 AGATTTTTCAAAAGGTATTTAGG - Intergenic
1169910110 20:10641244-10641266 GGGTTTTTAAAAATCGTTTTAGG - Exonic
1169939678 20:10923743-10923765 AACTTTTTAAAAATAGATTTAGG - Intergenic
1169956463 20:11108466-11108488 AGGTATTTAGAAATGCCTTTTGG - Intergenic
1170493164 20:16898836-16898858 ATGTTTATATAAATGGAGTTGGG - Intergenic
1170728054 20:18947607-18947629 AGATTTTTAAAAATTGCTCTGGG - Intergenic
1170835848 20:19883943-19883965 AGTATTTTAAAAATGTAATTAGG - Intergenic
1170852748 20:20019143-20019165 TTGTTTTTAAAAGTGGATCTAGG + Intronic
1170923878 20:20704919-20704941 AGGTTTTGAATAATGGATAAAGG - Intronic
1171546487 20:26005911-26005933 TGGTTTTTAAAAATAGAGATGGG - Intergenic
1173048077 20:39531850-39531872 TGATATTTAAAAAGGGATTTTGG + Intergenic
1173092584 20:39987537-39987559 AGATTTTTAAAAATAAAATTTGG - Intergenic
1173205879 20:40992742-40992764 AAGTTTTTAAGAAGGGATTCTGG - Intergenic
1173713186 20:45178266-45178288 ACCATATTAAAAATGGATTTTGG - Intergenic
1173993585 20:47321118-47321140 AGGTATTTATTAATGGCTTTGGG + Intronic
1174101677 20:48131448-48131470 TTGTTTTTAAAAATAGAATTGGG + Intergenic
1174668164 20:52280297-52280319 AGTTTTTTAAAAATTCACTTTGG - Intergenic
1175957768 20:62620477-62620499 AAGTTTTTAATAATGGAAATGGG + Intergenic
1176153700 20:63607268-63607290 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153726 20:63607404-63607426 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153775 20:63607642-63607664 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153797 20:63607745-63607767 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153804 20:63607779-63607801 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153851 20:63608019-63608041 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153858 20:63608053-63608075 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153870 20:63608119-63608141 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153877 20:63608153-63608175 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153909 20:63608324-63608346 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153916 20:63608358-63608380 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153928 20:63608424-63608446 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153934 20:63608458-63608480 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153948 20:63608526-63608548 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153962 20:63608594-63608616 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153982 20:63608696-63608718 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153996 20:63608764-63608786 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154018 20:63608867-63608889 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154127 20:63609450-63609472 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154133 20:63609484-63609506 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154161 20:63609619-63609641 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176191744 20:63814395-63814417 AAGTTTTTAAAAATATAATTAGG + Intronic
1176448754 21:6843631-6843653 AGGTGTTTAAATGTTGATTTTGG + Intergenic
1176826924 21:13708654-13708676 AGGTGTTTAAATGTTGATTTTGG + Intergenic
1176994237 21:15535763-15535785 AGGTTTTTAAAACCTGGTTTTGG + Intergenic
1177481023 21:21688825-21688847 AGGTTTGTAAGAGTGGACTTAGG + Intergenic
1177749012 21:25256754-25256776 AGGTTTCAACAAATGAATTTGGG + Intergenic
1179324052 21:40322333-40322355 TGTTTTTTAAAAATGTATTCAGG - Intronic
1179421445 21:41239838-41239860 AGCATTTTGAAAATGTATTTAGG - Intronic
1179955869 21:44737938-44737960 AGGTTTTGAAGAAGGGGTTTTGG + Intergenic
1180578671 22:16807527-16807549 AGTTTTTTAAAAATGCAAATGGG - Intronic
1181183983 22:21088391-21088413 ATGTTTTTAAAAATAAAGTTTGG - Intergenic
1181750872 22:24988438-24988460 AGTTCTTCAAAAATGGGTTTGGG + Intronic
1182222649 22:28771178-28771200 AGGTTTTAAAAAACAGCTTTTGG - Intergenic
1182534798 22:30992903-30992925 AGGTCATTAAAAATGGAATCTGG - Intergenic
1182561371 22:31162090-31162112 AGGTGTTGAAAAAGTGATTTAGG - Intronic
1182563555 22:31180689-31180711 AGGTATTAGAAAATGGCTTTAGG - Intronic
1183266638 22:36830633-36830655 ATTTTTTAAAAAATGGATTGGGG - Intergenic
1184194917 22:42921057-42921079 TCATTTTTAAAAATGTATTTGGG + Intronic
1185033350 22:48457521-48457543 AGGTTTTTAAAATTGTAGTGAGG - Intergenic
949133081 3:529698-529720 AGATTTTTAAAGAAAGATTTTGG + Intergenic
949353467 3:3151193-3151215 ATGTTTTTAGAAATGTTTTTAGG - Intronic
949572916 3:5310815-5310837 AGGCTTTTAAAAATGCACATTGG - Intergenic
950652801 3:14417911-14417933 ATGTTTTTAAAAAGGGTTTAAGG + Intronic
950874909 3:16263040-16263062 AGTTTTTTAAAAAATGATTCTGG - Intronic
950946198 3:16949447-16949469 AAATATTTAAAAATGGATATAGG - Intronic
951028654 3:17857713-17857735 AGTGTTTTAAAAATTCATTTAGG + Intronic
951275451 3:20679599-20679621 AGGTTTTTAAAATTTATTTTTGG + Intergenic
951430467 3:22601199-22601221 AGGTTTCAATATATGGATTTTGG - Intergenic
951487084 3:23225163-23225185 AGTTTTTTCAAAATACATTTTGG + Intronic
952260367 3:31734269-31734291 AGGATTCGAAAAATGGTTTTTGG - Intronic
953218302 3:40943168-40943190 AAATTTTTCAAAATTGATTTAGG + Intergenic
953379867 3:42461320-42461342 TGGACTTTAGAAATGGATTTTGG + Intergenic
953426760 3:42801757-42801779 TAGTTTTTAAAAGTGGATTATGG - Intronic
954014540 3:47675645-47675667 ATGTTTTTAAAAATTTGTTTGGG + Intronic
954319290 3:49820462-49820484 GGGTTTTTAAAAACTCATTTGGG + Intergenic
955040134 3:55308377-55308399 AGGTTTTCACAAATGAATTAGGG + Intergenic
955242897 3:57195208-57195230 AGATTTTTAAAAAAGATTTTAGG + Intergenic
955324019 3:57995809-57995831 TAGTTTTTCAAAATGTATTTAGG + Intergenic
956116108 3:65920616-65920638 AAGTTGTTAAAAATGTTTTTGGG - Intronic
956269669 3:67437682-67437704 AGTTTATAAAATATGGATTTAGG + Intronic
956722901 3:72133966-72133988 GGGTTTGTAAAACTGGAATTAGG - Intergenic
957269181 3:78006920-78006942 AGGTTTTTCATAATGACTTTGGG - Intergenic
957466179 3:80595989-80596011 TAGTTTTTAAAAATTCATTTGGG - Intergenic
957649571 3:82982364-82982386 AGGGTTTTGAAAATGTAATTTGG - Intergenic
957752654 3:84441891-84441913 TCATTTTTAAAAATGAATTTTGG + Intergenic
957762493 3:84575987-84576009 ATATTTTAAAAAATCGATTTGGG - Intergenic
957853516 3:85843135-85843157 ATCTTTTGAAAAATGCATTTTGG + Intronic
957943302 3:87032359-87032381 AGTTTTTTAAACCTGGATTTAGG + Intergenic
958060814 3:88477446-88477468 AGGTTTTGACATATGCATTTTGG + Intergenic
958418039 3:93899953-93899975 ACCTTTTAAAAAATAGATTTAGG - Intronic
958484795 3:94690939-94690961 AGGTTTCAAAACATGAATTTTGG + Intergenic
958690117 3:97454696-97454718 AGGTTTTTAAAAAAGAGTTTAGG - Intronic
958779779 3:98526383-98526405 ACATTTTTAAAAATGGTTTTTGG - Intronic
959126852 3:102300234-102300256 AGGTTTTAACACATGAATTTTGG + Intronic
959214552 3:103434623-103434645 AGGTGCTTTAAGATGGATTTTGG + Intergenic
959329170 3:104980736-104980758 AGTTTTTTAAAAATATATTCTGG - Intergenic
959601077 3:108186353-108186375 AGGTTTCAAAATATGGATTTTGG + Intronic
959839917 3:110963658-110963680 AGTTTTTTAAAAATGAGGTTAGG + Intergenic
959865063 3:111257381-111257403 AGGTTTCAATAAATGAATTTGGG + Intronic
960402834 3:117224877-117224899 TGGTTTAAGAAAATGGATTTTGG - Intergenic
960629783 3:119717988-119718010 AGGGTTCTAAGAATGAATTTAGG + Intronic
962057958 3:131892967-131892989 AGGTTGTTAATAATGGATAAAGG - Intronic
962525268 3:136232502-136232524 AAAGTTTTAAAAAGGGATTTAGG + Intergenic
962914414 3:139886514-139886536 ATGTTTGAAATAATGGATTTAGG + Intergenic
963499581 3:146108481-146108503 TAGTTTTTAAAAATAGTTTTTGG - Intronic
963929523 3:150989090-150989112 ATTTTTTTAAAAATTGTTTTAGG + Intergenic
964048796 3:152365609-152365631 TGGCTTCTAAAAATGGAATTGGG + Intronic
964084768 3:152803141-152803163 AGGTCTGTCATAATGGATTTAGG - Intergenic
964165114 3:153694961-153694983 AGGTTGTAAGAAATGAATTTTGG - Intergenic
964251432 3:154722555-154722577 AGTTCTTTTAAAAGGGATTTTGG - Intergenic
964323788 3:155525252-155525274 AGGTTCTAATACATGGATTTTGG - Intronic
964341221 3:155710301-155710323 AGTTTTAAAAAAATGTATTTTGG + Intronic
964365251 3:155943475-155943497 AGGTTGTTAACAATGGTCTTAGG - Exonic
964435667 3:156650135-156650157 GGGTTTTTAAAAATATATTCTGG - Intergenic
964459653 3:156909789-156909811 AGATTTTTAAAAATATATTTTGG + Intronic
964761652 3:160140302-160140324 ATATATTTAAAAATGCATTTTGG + Intergenic
965238401 3:166158432-166158454 AGAATTTTAAAAATAGAATTAGG - Intergenic
965660528 3:171037076-171037098 AGGCTTTTAAAAGTGGATCAAGG - Intergenic
966030301 3:175338339-175338361 AGGCTTTTAAAAAAAGGTTTGGG - Intronic
966106935 3:176347250-176347272 TGGTTTTTAAAAATCACTTTAGG + Intergenic
966166482 3:177024369-177024391 AGATTTTTAATACTGGAGTTTGG + Exonic
966610890 3:181867160-181867182 AGTGTTTTAAAAATTTATTTGGG + Intergenic
966722468 3:183078367-183078389 AGCTTTTCAAAAATTGTTTTAGG + Intronic
967000507 3:185329813-185329835 GGTTTTTTAAAAATGCATTGTGG - Intronic
967086645 3:186100909-186100931 AGTTTTTTAAATATACATTTTGG - Intronic
967489840 3:190077748-190077770 ATGTTTTTAGACATGTATTTAGG + Intronic
967584463 3:191195248-191195270 ATGTTTTTAAATATTGAGTTGGG - Intergenic
967592736 3:191297821-191297843 AGGTTTTTAAAAAATTAATTTGG - Intronic
968710878 4:2116564-2116586 ATGTTCTGAAACATGGATTTGGG - Intronic
969390045 4:6885952-6885974 AGGACTTTAAAAATGGTGTTGGG - Intergenic
970027094 4:11635189-11635211 AGGCTTTAAAATATGAATTTGGG + Intergenic
970212216 4:13721545-13721567 AGATTTTTTAAATGGGATTTTGG - Intergenic
970384914 4:15546241-15546263 AGGGTTTTAAAAATGAAATTTGG + Intronic
970614312 4:17753596-17753618 AGGGCTTTAAAAATGGACTAGGG + Intronic
970631582 4:17952713-17952735 AAGTTTTAAAAAATTGTTTTTGG - Intronic
970778826 4:19710643-19710665 AGGTTTCAACATATGGATTTGGG - Intergenic
970844893 4:20524710-20524732 ATATTTTTAAAAATAGCTTTTGG - Intronic
971871397 4:32244742-32244764 ATATTTTTAAAAGTTGATTTGGG - Intergenic
972046484 4:34671421-34671443 ATATTTTTAAAAATGGAGATAGG + Intergenic
972105723 4:35483510-35483532 AAATTTTTAAAAGTGGATTTTGG + Intergenic
972134647 4:35876905-35876927 ATGTTTTTAAAAAAGCAATTTGG - Intergenic
972181354 4:36470666-36470688 AAGTTTTAACAAATGAATTTAGG - Intergenic
972397669 4:38671847-38671869 AGGTTTTTGAAAAGGGATCAAGG - Intronic
972507986 4:39739332-39739354 AGATTTTTAAAAAGTGTTTTGGG - Intronic
972957584 4:44411645-44411667 AGGGTTGTAGAAATGGAATTGGG + Intronic
972968184 4:44538444-44538466 AAGTTTTTAAAAATATATTATGG - Intergenic
973031818 4:45352806-45352828 TGAATTTTAAAAATAGATTTGGG - Intergenic
973126693 4:46594704-46594726 AGATTTTTAAATGTTGATTTTGG - Intergenic
973169620 4:47124208-47124230 AGAATTTTAAAATTGGATATTGG + Intronic
973224927 4:47773111-47773133 ATGTTTTTAAAAAAAGAATTTGG + Intronic
973563323 4:52158824-52158846 AGGATTTTAAAAATAACTTTTGG - Intergenic
973752319 4:54033711-54033733 AGGATTTTAAAAATATATATAGG + Intronic
974457810 4:62150337-62150359 AGATTTTTTAAAATGAATTAAGG + Intergenic
974472046 4:62331279-62331301 ATGTGTTTAGAAGTGGATTTTGG - Intergenic
975456773 4:74600182-74600204 GGTTTTTTAAAAATAGTTTTAGG - Intergenic
975659236 4:76671827-76671849 AGATTTTTAAAAATTTTTTTTGG + Intronic
975832309 4:78382465-78382487 AGTTTTTTAAAAATGATTTTTGG - Intronic
975909701 4:79252323-79252345 GGGTTTAAAAAAATAGATTTAGG - Intronic
975945221 4:79697343-79697365 AAGTTTTTAAAAATAAAATTTGG + Intergenic
976001693 4:80381710-80381732 AGAATTTTAAAAATGTATATGGG - Intronic
976171881 4:82312767-82312789 AAATTTTTAAAAATGGAAGTTGG + Intergenic
976205258 4:82618141-82618163 GGTTTTGTAAAAATAGATTTGGG + Intergenic
976290966 4:83417014-83417036 GAATTTTTAAAAATGCATTTGGG + Intronic
976364670 4:84220145-84220167 AGGATTTATATAATGGATTTTGG + Intergenic
976625371 4:87175174-87175196 ACATTTTTAAAAATTTATTTTGG - Intronic
977404794 4:96583080-96583102 AGGTATCTAAAATTAGATTTTGG + Intergenic
977426916 4:96877789-96877811 AGTTTTCTAAAATTGGCTTTAGG - Intergenic
977573000 4:98649079-98649101 ATTTTTTTAAAAATGTACTTTGG + Intronic
977686112 4:99849221-99849243 AGGTTTTCAAAATAGAATTTGGG + Intronic
977708208 4:100094838-100094860 ATGTTTTTAAAAATGTTTATAGG + Intergenic
978134920 4:105245679-105245701 AAATTTTTAAAAATGTATGTAGG + Intronic
978305556 4:107323948-107323970 ACCTTTTAAAAAATTGATTTGGG - Intergenic
978349384 4:107805554-107805576 GCGTTTTTAAAAATTGATTGAGG - Intergenic
978388027 4:108195924-108195946 ATGTTTTTAAAAATCTATTTTGG - Intergenic
978474123 4:109106746-109106768 AATTTTTTTAAAATGGATATTGG - Intronic
978514414 4:109556256-109556278 ATGTTTTTTAAACTAGATTTAGG - Intergenic
978682051 4:111393333-111393355 TGGGTTTTAGAAATGAATTTAGG + Intergenic
978753357 4:112276736-112276758 AGCCTTTTAAAAATGCTTTTGGG - Exonic
979135159 4:117102236-117102258 AGGTTTTAACATATGAATTTTGG + Intergenic
979168681 4:117571056-117571078 AGTTTTTTAAATAAGGATTAAGG - Intergenic
979358405 4:119732629-119732651 AGCAGTTTAAAAATGGATCTGGG + Intergenic
979699793 4:123654979-123655001 AGGCTCTTAAAAATGAATTAAGG + Intergenic
979701512 4:123673466-123673488 AGGTTTTTAAAAGGTAATTTTGG + Intergenic
979812922 4:125062907-125062929 AGGGGGTTAAAAATGGCTTTGGG - Intergenic
979834815 4:125352072-125352094 CTTTTTTTAAAAAGGGATTTAGG + Intronic
980097635 4:128509293-128509315 AAGTTTTTGAAAATGCTTTTAGG - Intergenic
980232377 4:130061338-130061360 AGGCTTTATAAAATGGATTGAGG - Intergenic
980488282 4:133489753-133489775 AGGTTTTTGAAAATGTTTGTAGG - Intergenic
981016182 4:139976952-139976974 AGGTTTTAACATATGAATTTTGG - Intronic
981172319 4:141638677-141638699 AGGTTTATCGAAATAGATTTTGG + Intronic
981339033 4:143599148-143599170 TGATTTTTAAAAAAGAATTTTGG + Intronic
981397483 4:144270867-144270889 AATTTTTTAAAAAAGGATTTGGG + Intergenic
981427425 4:144619813-144619835 ATCTTTTTAAAAATTGATCTTGG + Intergenic
982294674 4:153814887-153814909 AGGTTTTTAAAAAAGCCTGTTGG + Intergenic
982476215 4:155854602-155854624 TAGTTGTTAAAAATGCATTTAGG + Intronic
982595034 4:157371476-157371498 ACCTTTTTAAAAAAGGTTTTAGG - Intergenic
982623655 4:157736677-157736699 AAGTTTTTAAAAATATATTCTGG - Intergenic
982659909 4:158194117-158194139 ATGTTATTAAAAATGGACGTTGG + Intergenic
982710381 4:158752426-158752448 TGATTTTTAAAAATATATTTTGG + Intergenic
983041885 4:162938782-162938804 AGGTTTTTAAAATTTAATGTGGG - Intergenic
983057088 4:163110867-163110889 TATTTTTTAAAAATGGATTAAGG + Intronic
983063317 4:163182474-163182496 AGGTTTTTATAAATGAGTTTTGG - Intergenic
983254367 4:165380442-165380464 AGGTATTTAAAAATGTTCTTGGG + Intronic
983410543 4:167391246-167391268 AGTATTCTAAAAATGGATTATGG + Intergenic
983618888 4:169738517-169738539 AGGCCTTTAAAATTGGAGTTTGG - Intronic
983682670 4:170371648-170371670 AGGAGTTTGAAAATGTATTTGGG + Intergenic
983792742 4:171818340-171818362 GGGTTTTTAAAAATGTATTTAGG - Intronic
984200907 4:176720288-176720310 GGGTCTTTAAATATAGATTTGGG - Intronic
984345669 4:178521581-178521603 AGATTTTTAAAAATTGAGGTTGG + Intergenic
984556731 4:181223123-181223145 AGGTTTTCAACAATGGCTTAGGG - Intergenic
984974593 4:185219256-185219278 ATGTTTTTAAAAAATGTTTTTGG + Intronic
985247745 4:187994725-187994747 AGGTTTTTAAATATCGATCTGGG + Intergenic
985826501 5:2195514-2195536 CTGTTTTTGAAAATGGATTTTGG + Intergenic
985984372 5:3502527-3502549 TGCTTTTTAAAAATAAATTTTGG - Intergenic
986508442 5:8477082-8477104 ACTTTTTTAAAAATTCATTTTGG + Intergenic
987113234 5:14706399-14706421 AGGTTTTTCAAAAATGATTTAGG + Exonic
987126102 5:14814298-14814320 AGGTATTTAAAAATGTAAATAGG + Intronic
987332777 5:16871810-16871832 AGATTTTTAAAATTGGATTCAGG - Intronic
987774310 5:22344046-22344068 AGGGCTTGAAAAATGGATTATGG + Intronic
987778080 5:22395445-22395467 AAGTTTTTAATAATGTGTTTGGG + Intronic
988043186 5:25913201-25913223 GGGTTTTTAAAAATTGTTTTTGG + Intergenic
988268347 5:28981781-28981803 GGGGTTTTAAAAATGAAATTTGG + Intergenic
988323736 5:29735151-29735173 GGCTTTTTTAAAATGGATTCTGG - Intergenic
988351152 5:30108693-30108715 ACATTTTTAAAAATGTCTTTAGG + Intergenic
988970331 5:36460574-36460596 AGATTTTTAAACAGGGTTTTGGG + Intergenic
989030109 5:37110050-37110072 AGGGTTTTAACAATGGAGATGGG - Intronic
989597893 5:43173922-43173944 ATGTTTCTCAAAATGTATTTAGG + Intronic
989764662 5:45067557-45067579 TGGCTTTTAAAAAAAGATTTTGG - Intergenic
990043008 5:51395371-51395393 AGATTTTTGAAATTGGACTTGGG - Intergenic
990076315 5:51850005-51850027 TGGTATTTAAAACTAGATTTAGG + Intergenic
990448801 5:55917033-55917055 AATTTTTCAAATATGGATTTGGG - Exonic
990669991 5:58117492-58117514 AGATTTTTAAAAATGCTTTTAGG + Intergenic
990810938 5:59722567-59722589 ATGTCTTTAAAAATTGTTTTAGG + Intronic
990911243 5:60854614-60854636 AGGTTTCAACATATGGATTTAGG + Intergenic
990923189 5:60991176-60991198 ATGTTTTTAAAAATGTTTGTGGG + Intronic
991494470 5:67213874-67213896 AGGGTTTAAAAAATATATTTAGG - Intergenic
991561796 5:67961516-67961538 GGGTTTTTAAAAATGGGCTTTGG + Intergenic
992044385 5:72870700-72870722 AAGTTTCTAAAAATGGTTTGGGG + Intronic
992411886 5:76513283-76513305 GGGTTCTTAAAAATGTATTTTGG - Intronic
992826769 5:80556576-80556598 AGCATTTTAAAAATGTTTTTTGG - Intergenic
992948239 5:81830591-81830613 AGATTTCTAAAAATTGCTTTGGG + Intergenic
993011111 5:82483959-82483981 AGGTTTTCAAGAAAGGATATTGG + Intergenic
993129233 5:83874599-83874621 AGGTTTTTACTAATATATTTAGG - Intergenic
993298692 5:86179042-86179064 TTGTGTTTAAAAATGTATTTTGG - Intergenic
993377400 5:87165440-87165462 AGGTTTTTAAAAACTAAATTTGG + Intergenic
993434899 5:87880558-87880580 AGGTTTTAACATATGAATTTGGG + Intergenic
993470122 5:88297256-88297278 ATATTTTTAAAAATACATTTGGG + Intergenic
993726797 5:91378442-91378464 AGGTTTTTAAAATAGGAATAGGG - Intronic
993935121 5:93989775-93989797 TGGTTTTGAAACATGGATGTTGG - Intronic
994014905 5:94954543-94954565 TGGTTTTAAAAAATAGATTTAGG - Intronic
994293383 5:98058183-98058205 ATATTTTTAAAAATTGATTAGGG - Intergenic
994307060 5:98218828-98218850 AAGTCTTTAATCATGGATTTTGG - Intergenic
994458533 5:100046608-100046630 TGGTTTTTTAAAATTTATTTAGG + Intergenic
994513884 5:100744925-100744947 ATGTCTTTAAACATGGAATTAGG + Intergenic
994783432 5:104122380-104122402 GGGATTTTAAGAATGGACTTAGG - Intergenic
994856655 5:105130307-105130329 GGGTTTTAAGATATGGATTTTGG + Intergenic
995212245 5:109553339-109553361 AATTTATTAAAAATAGATTTTGG - Intergenic
995627458 5:114094698-114094720 AGGTTTTTATAAACCGGTTTTGG - Intergenic
995857915 5:116613301-116613323 AGGTTTTTAAAAATTTTGTTTGG - Intergenic
995931049 5:117445127-117445149 TGATTTTTAAAATTAGATTTAGG + Intergenic
997043314 5:130282912-130282934 AGAATTTTAAAAATAAATTTTGG + Intergenic
997319673 5:132967204-132967226 AAGATTTTAACAAAGGATTTAGG + Intergenic
997906756 5:137824746-137824768 AGCTTTTTTAAAATCCATTTTGG - Intergenic
997991513 5:138548067-138548089 AGGTTTTTATAAATTGACCTAGG + Intergenic
998313874 5:141161618-141161640 ACTTTTTTAAAAATTGAGTTTGG + Intergenic
998346858 5:141471934-141471956 AGTTTTCTAAAACTGGATTGTGG + Intronic
998464956 5:142336478-142336500 ATCTTTTTAAAAATTGATCTGGG + Intergenic
998671036 5:144354379-144354401 GGATTTTTGAAAATGGTTTTGGG - Intronic
999801512 5:155042418-155042440 AGTTTTTTATTAATGCATTTTGG + Intergenic
1000099652 5:158003043-158003065 ACTTTTTTAAAAAAGGATGTGGG - Intergenic
1000127133 5:158256671-158256693 AGATTATTAAACATGGAGTTTGG + Intergenic
1000740601 5:164965056-164965078 TTATTTTTAAAAATAGATTTTGG - Intergenic
1000962100 5:167611895-167611917 AGGTTTTAACATATGAATTTTGG + Intronic
1001478612 5:172069924-172069946 CAGTTTTTAAAAATGTATTATGG - Intronic
1001698348 5:173689357-173689379 AGGTTTTGAAAACTGGTTATTGG - Intergenic
1002650271 5:180686559-180686581 AGATTTTCAAAAATGATTTTTGG + Intergenic
1003280617 6:4688066-4688088 AGGTTTTAAAATTTGGAATTTGG - Intergenic
1003527491 6:6910170-6910192 AGGTCTTTAAAGATGGCTATGGG - Intergenic
1004710648 6:18167055-18167077 AGCTTTTTAAAAATTAATTTGGG + Intronic
1005404422 6:25470875-25470897 AGGTTTTTAACTGTGAATTTTGG + Intronic
1005467559 6:26130269-26130291 GGGTTTTAATAAATGAATTTTGG + Intronic
1005584310 6:27260788-27260810 AGATTTTTAAAAATTGTTTTTGG + Intergenic
1006864564 6:37198850-37198872 ATTTTTTAAAAAATGGATTTAGG - Intergenic
1007233964 6:40377452-40377474 AATTTTTTAAAAAGGGATATGGG + Intergenic
1008065054 6:47038739-47038761 AGAATTTTAAAAATATATTTAGG - Intronic
1008232389 6:48998247-48998269 ATGTTTTTAAAATAGCATTTTGG - Intergenic
1008416189 6:51243559-51243581 AAATTTTAAAAAATGGATGTTGG + Intergenic
1008568997 6:52796839-52796861 AGCTTTTTAAAAATGTTGTTTGG - Intronic
1008813760 6:55538106-55538128 AGATTTTTAAAAACTGATTTAGG - Intronic
1008910997 6:56733125-56733147 AGATTTTTAAAGGTTGATTTGGG - Intronic
1009521877 6:64693279-64693301 ATGTTTTTAAAAATAGAAATTGG + Intronic
1009615302 6:65997791-65997813 AGATTTTTAAAAATTGATCTGGG + Intergenic
1009653221 6:66504177-66504199 ATATTTTTAAAACTTGATTTGGG - Intergenic
1009699434 6:67157155-67157177 AGGTTTGGAAAAATGGTTTAGGG - Intergenic
1009768860 6:68119308-68119330 AGGTTTTCAAAAATGGAGGGCGG + Intergenic
1010115854 6:72309446-72309468 AGGCCTATAACAATGGATTTGGG + Intronic
1010202182 6:73291905-73291927 AAATTTTTAAAAATAGATTCAGG - Intronic
1010369103 6:75087201-75087223 ATGTATTTAAAAATTGTTTTGGG - Intronic
1010418677 6:75645670-75645692 AAGGTTTTAAAACTGAATTTTGG + Intronic
1010442878 6:75918816-75918838 GTTTTTTTAAAAATAGATTTAGG + Intronic
1010510451 6:76712344-76712366 ACGTTCTTAAAAATGGGTCTGGG + Intergenic
1010544425 6:77132818-77132840 AAGATTTTAAAAATCAATTTTGG + Intergenic
1010738822 6:79474617-79474639 AGCTTTTTAAAAAAACATTTTGG - Intergenic
1010809550 6:80284689-80284711 ATGTTTTTAAAAATGCCTTAAGG + Intronic
1010954241 6:82071958-82071980 AAGATTTAAAAAAAGGATTTAGG - Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011023420 6:82839562-82839584 AAATTTTTAAAAAAGCATTTAGG + Intergenic
1011104250 6:83761507-83761529 GAGTTTTTAAAAATGTATTTTGG - Intergenic
1011183987 6:84653774-84653796 AGGTTTTAACACATGGATTTTGG + Intergenic
1011239180 6:85252654-85252676 AAGTTTTTGAAAATCAATTTAGG + Intergenic
1011292438 6:85790743-85790765 AGGTTTTAACATATGAATTTTGG + Intergenic
1011456332 6:87554077-87554099 AGATTTTTAAAAATTGATATGGG - Intronic
1011910854 6:92435485-92435507 AGGTTTTTAAATATGATTCTTGG + Intergenic
1011946948 6:92916916-92916938 AGTTTTTAAAAAATGTATTGAGG - Intergenic
1012035469 6:94132556-94132578 AAGTTTTTAAAAATTGTTTATGG + Intergenic
1012293754 6:97493959-97493981 AGATTTTTAAATATTGATTTTGG + Intergenic
1012480393 6:99660846-99660868 AGGTACTTAAAAATGAATATTGG + Intergenic
1013143212 6:107361075-107361097 AGGTTTTCCAAATAGGATTTGGG - Intronic
1013173695 6:107659861-107659883 CGCTTTTTAAAAATGAAATTTGG + Exonic
1013590072 6:111612457-111612479 AGGGTTTTCAACATGGATTTTGG - Intergenic
1013626904 6:111947499-111947521 AGATTTTTTAAAAAGAATTTAGG + Intergenic
1013759404 6:113499315-113499337 AGGTTTCAATAAATGAATTTTGG + Intergenic
1014035246 6:116759696-116759718 AGGTTTTTAAAAATACATTGGGG - Intronic
1014042292 6:116842742-116842764 AGGATTTTTAAAGTGGAGTTAGG - Intergenic
1014049661 6:116937402-116937424 AGATTTTTAAAGAGAGATTTGGG - Intergenic
1014766516 6:125412675-125412697 AGGTTTTTAAACTTTTATTTCGG + Intergenic
1014875354 6:126652355-126652377 AGTTTTTTTAAAATTTATTTTGG - Intergenic
1014879169 6:126701069-126701091 AGGTTTTAGCAAATGAATTTTGG + Intergenic
1015059160 6:128941399-128941421 GGCTTTTGAAAAATGGATCTGGG + Intronic
1015617696 6:135094832-135094854 GGGTTTTAAAAAATTGTTTTTGG - Intronic
1016478416 6:144453986-144454008 TGGTTTTCAAAAATGTTTTTAGG + Intronic
1017020521 6:150136427-150136449 AGGTTTCTACAGATGAATTTTGG + Intergenic
1017029348 6:150207170-150207192 ATGTTTTTAAAAAGGGCTTTGGG + Intronic
1017955300 6:159172266-159172288 TGGTTTTTTAAAATGGAATGTGG + Intronic
1018154010 6:160968831-160968853 AGGTTTTAACATATGAATTTGGG - Intergenic
1018174338 6:161165948-161165970 AGTTTTTAAAAAATGGAGTGTGG + Intronic
1018328037 6:162695562-162695584 AGTTTTTTAAAAATGAATGATGG - Intronic
1018355414 6:163010289-163010311 ATTTTTTTAAAAATGGATTTTGG - Intronic
1018363368 6:163095251-163095273 TGCTTTTTATAAGTGGATTTGGG - Intronic
1018885992 6:167937886-167937908 AGGTTTTTAAAATAGGAAATTGG + Intronic
1019125343 6:169836517-169836539 AGGATTTAAAAAATAGATATAGG + Intergenic
1019221039 6:170473002-170473024 AGGATTTTTAAAATTGATTTTGG - Intergenic
1019304955 7:329306-329328 GGGTTTTTTTAAATGTATTTGGG - Intergenic
1020114123 7:5466120-5466142 TGTTTTTTAAAAATAGATTCAGG - Intronic
1020235787 7:6354357-6354379 TGGTTTTTAGAATTGGACTTTGG + Intergenic
1020345452 7:7157467-7157489 ATGCTTTTAGGAATGGATTTGGG + Intronic
1020557276 7:9686143-9686165 TGATTTTTAAAAATAGATTTAGG + Intergenic
1020683140 7:11261433-11261455 TGATTTTTAAGAATGCATTTGGG - Intergenic
1020688988 7:11331146-11331168 AGGTATTTGAAATTGGTTTTTGG + Intergenic
1020735895 7:11949318-11949340 AGGTATTTAAAAATGTCCTTTGG + Intergenic
1021144520 7:17068493-17068515 AGATTATTAAAAATAAATTTTGG + Intergenic
1021495213 7:21266931-21266953 AGTTTCTTAGAAATGAATTTGGG + Intergenic
1021759698 7:23891582-23891604 AGGATTATAAAAATGGAACTGGG + Intergenic
1021796223 7:24257118-24257140 AGGTTTTTATAAATGTATTTGGG - Intergenic
1021896691 7:25243223-25243245 AGGTTTTTTAAAATGAATGAAGG - Intergenic
1022015910 7:26348078-26348100 AGGTATATAAAAATCCATTTAGG - Intronic
1022059818 7:26782480-26782502 AGGTTTTAATATATGAATTTGGG - Intronic
1022074341 7:26952843-26952865 GGGTTTTAAAATATGAATTTTGG - Intronic
1022147000 7:27554284-27554306 TGGCTTTTAAAAATGACTTTTGG - Intronic
1022281624 7:28916550-28916572 ATCTTTTTAAAAAGGGATTTTGG - Intergenic
1022296317 7:29057368-29057390 GGGTTTTTAAAAATATATTTTGG + Intronic
1022298548 7:29080831-29080853 AGCTATTTAAAAATGAATTAGGG - Intronic
1023327071 7:39071768-39071790 TGGATTTTAAAAATGTATTCAGG + Intronic
1024033147 7:45482261-45482283 ATGTTTTTAAAATGTGATTTGGG + Intergenic
1024195083 7:47051576-47051598 GGGTTTTTAAAAATAAATTATGG + Intergenic
1024390831 7:48810601-48810623 AGTTTTTCAGAAATGGATGTTGG - Intergenic
1024772832 7:52744699-52744721 AGGTTTTTAAAACTTGAGCTTGG - Intergenic
1024979909 7:55148651-55148673 AGGGTTTTTAAAAAGGAATTAGG + Intronic
1025784225 7:64629690-64629712 AGCTTTTTAAAAATGTTTGTTGG - Intergenic
1027398095 7:77777723-77777745 AGATGCTAAAAAATGGATTTTGG - Intronic
1027478035 7:78658282-78658304 TGGTTTTTAAAAAACGACTTTGG + Intronic
1027591458 7:80124377-80124399 AAGATTTTAAAAATGGCTGTTGG + Intergenic
1028960646 7:96746166-96746188 AGATTTTTAAAAATTGTGTTAGG + Intergenic
1029450496 7:100639422-100639444 AGCTTTTTAAAATTGAATTAAGG - Intronic
1029572894 7:101382690-101382712 AGGTTTATAAAAATGCTGTTGGG + Intronic
1029882012 7:103823871-103823893 AATTTTTTAAAAATGCAGTTTGG - Intronic
1030129705 7:106188601-106188623 ATGTTTTTAAAAGTGGTTTTAGG + Intergenic
1030165485 7:106550695-106550717 GGGTTTTTAAAAAAGAATTTGGG + Intergenic
1030299159 7:107957870-107957892 AGATTTTTAACAATAGGTTTGGG - Intronic
1030821901 7:114103402-114103424 AGGTTTTAAAAAATGTATTCTGG + Intronic
1030951361 7:115794014-115794036 AGGCTTTAAAAAGTAGATTTGGG - Intergenic
1030965279 7:115985230-115985252 ATATTTTGAAAAAGGGATTTTGG - Intronic
1031130700 7:117830070-117830092 TGATTTTTAAAAATCAATTTAGG + Intronic
1031419606 7:121535125-121535147 AGAGTTTTAAAAATGGAATTTGG + Intergenic
1031509663 7:122634203-122634225 AGATTTTTAAAAATAGTTTCAGG + Intronic
1031667323 7:124500559-124500581 AAGTCTTTAAAAATGAATTGGGG - Intergenic
1031824945 7:126552534-126552556 AAGTATATAGAAATGGATTTTGG - Intronic
1031897118 7:127363366-127363388 AGGTCTTCAAATATGGATTAAGG - Intronic
1032596268 7:133244191-133244213 AGTTTTTTAAAAATGTATAAAGG + Intergenic
1032736671 7:134698640-134698662 AGATATTTAAAAAGGGATTTAGG - Intergenic
1032944890 7:136838240-136838262 TGAGTTTTATAAATGGATTTTGG - Intergenic
1033205075 7:139412902-139412924 AATTTTTTAAAAATCAATTTGGG + Intronic
1033670771 7:143490635-143490657 AAATTTTTAAAAATGGATTTTGG + Intergenic
1033725523 7:144112297-144112319 TGGTTTTTTACAATGGCTTTTGG + Intergenic
1033817537 7:145092597-145092619 ACATTTTTAAAAATGGATGATGG - Intergenic
1034332968 7:150299280-150299302 TGTTTTTTAAAAATAGTTTTTGG - Intronic
1034584925 7:152081722-152081744 AGCTTTTTTAAAATGGTTTATGG + Intronic
1034665072 7:152810600-152810622 TGTTTTTTAAAAATAGTTTTTGG + Intronic
1036090700 8:5661908-5661930 CTGTTTTTAAAAATGAATCTTGG + Intergenic
1036523370 8:9512858-9512880 AGGTATTAAAAGATGGTTTTAGG - Intergenic
1036724077 8:11203108-11203130 TGGTTTCTAAAAGTTGATTTTGG - Intergenic
1036764485 8:11539001-11539023 AGTATTTTCTAAATGGATTTTGG - Intronic
1037193946 8:16164334-16164356 AGGTTTTTAAAAACATATTATGG + Intronic
1037209175 8:16364082-16364104 AAACTTTTAAAAATTGATTTTGG + Intronic
1037302384 8:17466124-17466146 AGGTTTTCAAAAATAAATGTAGG - Intergenic
1037677391 8:21063481-21063503 AGATTTTTTAAATGGGATTTTGG + Intergenic
1037954554 8:23044079-23044101 ATCTTTTTAAAAATGGTCTTGGG + Intronic
1038348111 8:26750607-26750629 ATGTTTTAACATATGGATTTTGG + Intronic
1038381293 8:27096755-27096777 AGGTTTTTACATAGGAATTTGGG + Intergenic
1039139592 8:34371298-34371320 ATTTCTTTTAAAATGGATTTAGG - Intergenic
1039160054 8:34608168-34608190 ATGCTTTTAAAAATACATTTTGG + Intergenic
1039186236 8:34919586-34919608 AACAATTTAAAAATGGATTTTGG - Intergenic
1039492388 8:37957766-37957788 AAATTTTTAAAAATGTATCTGGG - Intergenic
1039517182 8:38143956-38143978 AGCATTTTAAAGATGGTTTTAGG + Exonic
1039705753 8:40005816-40005838 AGGTTTTAACATATGAATTTTGG - Intronic
1039996106 8:42534659-42534681 ACGTTTTTAAAAATAATTTTTGG - Intronic
1040418343 8:47216484-47216506 GGGGTTTTAAATGTGGATTTAGG - Intergenic
1040952456 8:52951128-52951150 AAGATTTAAAAAATGGGTTTAGG - Intergenic
1041214954 8:55591243-55591265 AGTGATTTAAAAATGGATTCCGG + Intergenic
1041322218 8:56625035-56625057 AGGTTTTTAAAGATAGTTTGGGG + Intergenic
1041326245 8:56668820-56668842 AGGTGTTTATAAATCGATTCAGG + Intergenic
1041342591 8:56861822-56861844 ATGTTTTAAAAACTGGATTATGG + Intergenic
1041506552 8:58605045-58605067 TTATCTTTAAAAATGGATTTTGG - Intronic
1041540531 8:58980008-58980030 AATGTTCTAAAAATGGATTTGGG + Intronic
1041557835 8:59178234-59178256 AGGTTTTAAAAAATATATTTTGG + Intergenic
1041742791 8:61175170-61175192 AGGTTTTAACATATGAATTTTGG - Intronic
1041837541 8:62233290-62233312 AGGTTTTAACATATGAATTTTGG + Intergenic
1041850650 8:62388227-62388249 TAGTTTTTAGAAATGTATTTGGG + Intronic
1041854220 8:62431698-62431720 GGATTTTTAAAAATGTTTTTAGG + Intronic
1042164052 8:65928099-65928121 AAATTTTTAAAAATAAATTTAGG - Intergenic
1042394021 8:68270208-68270230 AATTTTTTAAAATTGGACTTGGG + Intergenic
1042623227 8:70728815-70728837 AGGCTTTTTAAAATTGATTTTGG + Intronic
1043826148 8:84930887-84930909 AGGCATTTAAAAATTGATTTAGG - Intergenic
1043912574 8:85880150-85880172 AGGTTGATACAAATGAATTTGGG - Intergenic
1044027124 8:87186768-87186790 AATTTTTTAAAAATGGTTTGAGG + Intronic
1044064229 8:87680109-87680131 AGGTTTTTTAAAATTATTTTTGG + Intergenic
1044252150 8:90016334-90016356 AGTTTTTTAAAAATTAAATTTGG + Intronic
1044381338 8:91537582-91537604 AGCTTTTTAAAAATGTTTCTTGG - Intergenic
1044646810 8:94452235-94452257 AGGTTTCTACATATGAATTTTGG + Intronic
1044823771 8:96177489-96177511 AGATTTTTCTAAATGGAGTTGGG + Intergenic
1044868785 8:96598261-96598283 AGGTTTTAACACATGGATTTTGG + Intronic
1045412473 8:101932386-101932408 AGATTTTTAATAATGAATTTGGG - Intronic
1045575234 8:103413435-103413457 AAGTTTGTAAAGATGGATCTGGG - Intronic
1045983881 8:108224944-108224966 AAGTTTTTAAAAATTAATTTGGG - Intronic
1046795541 8:118367427-118367449 AGGTTTTCAACAATTGATATTGG - Intronic
1046948806 8:120000773-120000795 AAGTTTTTAAAAATGAATTGAGG + Intronic
1047053259 8:121137175-121137197 AGGTTGTTACAAATGCATTAAGG + Intergenic
1047102991 8:121700679-121700701 AGGCATTTAACAATTGATTTTGG + Intergenic
1047112332 8:121804245-121804267 GGGTTTTTAAAATTGTTTTTTGG + Intergenic
1047513362 8:125532276-125532298 AGGTTTAGCAAAATGGAGTTGGG + Intergenic
1047569645 8:126084036-126084058 AGCATTTTAGAAATGCATTTAGG + Intergenic
1048045406 8:130768024-130768046 TTGGTTTTAAAAATGGATCTAGG + Intergenic
1048390655 8:133960751-133960773 ACATTTTTAAAAAAGGATCTGGG + Intergenic
1048533438 8:135271550-135271572 TGGTTTGTAAAAATGGAGTTGGG + Intergenic
1049890902 9:70151-70173 ACTTTTTTAAAAATTTATTTTGG - Intergenic
1050145908 9:2567351-2567373 AGGTCTTCAAACATGAATTTTGG - Intergenic
1050216286 9:3328666-3328688 AGTTTTTTAAAAATAAATTAGGG + Intronic
1050640637 9:7663771-7663793 TGATTTTTTAAAATGTATTTTGG + Intergenic
1051099922 9:13509234-13509256 AGGTTTTTAATTATGGTCTTTGG - Intergenic
1051275977 9:15398865-15398887 AATTTTTCAAAAATGGATGTTGG + Intergenic
1051283194 9:15464664-15464686 ATGTTGTTAAAAATGTCTTTAGG - Exonic
1051372936 9:16373661-16373683 AGATTTTTAAAAGAGGCTTTAGG - Intergenic
1051806707 9:21002036-21002058 GCATTTTTAAAAATTGATTTTGG + Exonic
1051910885 9:22153891-22153913 AGTTTTTAAAAACTGAATTTTGG - Intergenic
1052158068 9:25219645-25219667 TGTTTTTTTAAAATGGATGTGGG - Intergenic
1052306982 9:27021486-27021508 AAATTTTTAAAAATAGATGTTGG - Intronic
1052425412 9:28298362-28298384 ATTCTTTTAAAAATGAATTTGGG + Intronic
1052433648 9:28398576-28398598 AGGTTTTTGAATATGCAGTTGGG + Intronic
1052603421 9:30670017-30670039 AGCTTTTTAAAAATATGTTTAGG + Intergenic
1053116972 9:35513147-35513169 AGGTTTTCAACCATGGATTTTGG + Intronic
1053241205 9:36497070-36497092 AGGTATTTCAAAATTGCTTTGGG - Intergenic
1053407954 9:37894026-37894048 AGGTATGTAACAATGCATTTTGG + Intronic
1053486781 9:38463729-38463751 AGAGTTTTAAAAATATATTTTGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053798318 9:41746234-41746256 TGGTTTTTAAAAATAGAGATGGG + Intergenic
1054085933 9:60743502-60743524 AGATTTTTAACAATAAATTTAGG + Intergenic
1054146878 9:61568719-61568741 TGGTTTTTAAAAATAGAGATGGG - Intergenic
1054186733 9:61958285-61958307 TGGTTTTTAAAAATAGAGATGGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054466616 9:65499774-65499796 TGGTTTTTAAAAATAGAGATGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054651772 9:67630235-67630257 TGGTTTTTAAAAATAGAGATGGG - Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054696086 9:68360381-68360403 ACTTTTTTAAAAATTTATTTTGG + Intronic
1055618611 9:78099614-78099636 AGGCTTTAACATATGGATTTTGG - Intergenic
1055876585 9:80950395-80950417 AAGTCATGAAAAATGGATTTGGG - Intergenic
1055965930 9:81864814-81864836 TTGTTTTTAAAAATCTATTTTGG - Intergenic
1057356607 9:94337069-94337091 ATTTTTTTTAAAATGGTTTTGGG + Intergenic
1057404622 9:94757589-94757611 AGATTTTTAGAAGTGAATTTAGG + Intronic
1057651145 9:96920564-96920586 ATTTTTTTAAAAATGGTTTTGGG - Intronic
1057961244 9:99459379-99459401 AGGTTTTTAGAAAGGCTTTTTGG + Intergenic
1058131632 9:101260204-101260226 AGGCTTTGAAATATGAATTTGGG + Intronic
1058624094 9:106916166-106916188 AAGTTGTTAAAAATGGTTTCTGG + Intronic
1058782924 9:108356800-108356822 AGTTTTGCAGAAATGGATTTTGG - Intergenic
1059109829 9:111545511-111545533 ATGTTCTAAAAAATGGATTATGG - Intronic
1059185626 9:112268013-112268035 ATGTTTTTAAAAATAGGTATGGG - Intronic
1060107149 9:120879815-120879837 AATTTTTTAAATATGGATTAAGG + Intronic
1060313212 9:122483455-122483477 AGATATTTAAAAATTAATTTAGG + Intergenic
1060369931 9:123059244-123059266 AGGTTTTAACATATGAATTTTGG - Intronic
1060447307 9:123702101-123702123 ATGTTTTTAAAAATTATTTTAGG - Intronic
1060764019 9:126280469-126280491 AGGTGGTTAAGAATGGATTCAGG + Intergenic
1060961488 9:127683770-127683792 GGGTTTTTCAAGATGGATCTGGG + Intronic
1061877797 9:133553675-133553697 AGGATTTTAAAATAGGATGTCGG - Intronic
1203520435 Un_GL000213v1:40886-40908 AGGTGTTTAAATGTTGATTTTGG - Intergenic
1203732934 Un_GL000216v2:107341-107363 CTGTTTTTAAAAATGACTTTTGG + Intergenic
1186071970 X:5831341-5831363 AGGTTTTTAAGCATAGATTCTGG + Intergenic
1186131488 X:6470769-6470791 AAGTATTTAAAAATCGAGTTGGG + Intergenic
1186537721 X:10367162-10367184 AATCTTGTAAAAATGGATTTTGG + Intergenic
1186714601 X:12237835-12237857 CCATTTTTAAAAATGTATTTAGG - Intronic
1186878842 X:13844315-13844337 AGTTCTTTCAAAATGGAATTTGG - Intronic
1187421368 X:19136795-19136817 ATATTTTAAAAAATTGATTTAGG + Intergenic
1187701995 X:21971659-21971681 AGGTTTTCAAAACTGGTTCTTGG - Intronic
1187998539 X:24955883-24955905 AAGCTTTAAAAAATGGTTTTAGG - Intronic
1188138380 X:26518069-26518091 AGGTTTCAAAATATGAATTTGGG + Intergenic
1188757405 X:33979682-33979704 AGTCCTTTAAAAATGGATATAGG - Intergenic
1188763851 X:34066114-34066136 ATGTGTTTAAAATTTGATTTTGG + Intergenic
1189060738 X:37750737-37750759 ATGTTCTTGAAAATGCATTTTGG - Intronic
1189161005 X:38808522-38808544 AGGTTTTTAAGCATGAATTGAGG - Intergenic
1189746942 X:44178643-44178665 AAGTTTTGTAAAATGGAATTTGG - Intronic
1189880632 X:45487807-45487829 AGGTTTTAACATATGAATTTTGG - Intergenic
1190163984 X:48056308-48056330 AGGTTTCAAAATATGAATTTTGG + Intronic
1190428835 X:50358385-50358407 AGTTTTTTAAAAATATATTCTGG + Intergenic
1190487155 X:50939207-50939229 AGATTTTTAAAAATGGGGCTGGG + Intergenic
1190801748 X:53795462-53795484 AGACTTTTAAAAAAGGACTTAGG - Intergenic
1190933384 X:54970208-54970230 AGGTTTTTAAAAATAGATTTTGG - Intronic
1190946989 X:55104868-55104890 CTGTTTTTAAAAATTCATTTAGG - Intronic
1191010826 X:55756743-55756765 ATGATTTTAAACATGGATCTAGG + Intronic
1191780116 X:64855719-64855741 AGGTTTTAAAATATGAAATTCGG + Intergenic
1191801523 X:65086494-65086516 AGGTTTCAACATATGGATTTCGG - Intergenic
1191870602 X:65741850-65741872 GGTTTTTTAAAAATTGTTTTTGG + Exonic
1192128045 X:68520769-68520791 AGATATTTAAAAATGGAAATAGG - Intronic
1192420875 X:71029129-71029151 AGCTTTTTTAAAATGTCTTTAGG + Intergenic
1192673896 X:73174923-73174945 TGATTTTTAAAAATTTATTTAGG + Intergenic
1193596639 X:83453890-83453912 GGGTTTTTAAAGATGAATTTTGG - Intergenic
1193882481 X:86940510-86940532 AGATTTTTAAAAATGTCATTGGG + Intergenic
1193920876 X:87424714-87424736 AGTTTTTTAAATATGGAATTAGG + Intergenic
1193928353 X:87519746-87519768 AGTTTTTTAAAAATTGTTCTTGG - Intronic
1194238369 X:91412844-91412866 AGGTTTTTTAAAAATAATTTTGG - Intergenic
1194575411 X:95608317-95608339 AAGTTTTTAAAAATAAATTCAGG + Intergenic
1194750214 X:97675966-97675988 AGTTTTTTAAAAATATATTCTGG + Intergenic
1195273995 X:103261275-103261297 AGGATTTTAAAAAATTATTTAGG + Intergenic
1195509731 X:105701051-105701073 AGGATCTTAAAAATGAATTGAGG + Intronic
1195605151 X:106798099-106798121 AGTGTTTTAAAACTGGATTGTGG - Intergenic
1195895722 X:109744302-109744324 AGCCTCTTAAAAATGGAATTTGG - Intergenic
1195981041 X:110578669-110578691 AATTGTTTAAAAATGGATTATGG - Intergenic
1196230263 X:113212687-113212709 AGTTTTTTAAAAATCCTTTTTGG + Intergenic
1196696546 X:118619169-118619191 AGGTTTTTAAAAATACCATTTGG + Intronic
1196929943 X:120671534-120671556 ACGCTTTTAAAAATGCATATGGG + Intergenic
1197232974 X:124026568-124026590 TTGTTTTTCAAAATGAATTTTGG + Intronic
1198099300 X:133410513-133410535 ATGTTTTTAAAAATGTATTTTGG - Intronic
1198252292 X:134891453-134891475 AGGGTTTTAAAGATGCATTTGGG - Intronic
1198551796 X:137752792-137752814 AGTTTTCTAAAAAGGGCTTTTGG - Intergenic
1199026428 X:142943925-142943947 AGGCTTGTTAAAGTGGATTTAGG - Intergenic
1199422830 X:147665210-147665232 AGGTTATTAAAAATGGTTTAAGG - Intergenic
1200942886 Y:8804054-8804076 AAATTTTCAAAAAGGGATTTAGG + Intergenic
1201168273 Y:11231981-11232003 ATATTTTTTAAGATGGATTTTGG + Intergenic
1201318807 Y:12674740-12674762 ATGTCTTTAAAAATTGTTTTCGG - Intergenic
1201608329 Y:15812465-15812487 ACATTTTTAAAATTTGATTTGGG - Intergenic
1201709494 Y:16974477-16974499 AGGTTTTTGAAGATGTATGTCGG + Intergenic
1201712500 Y:17008020-17008042 AGGTTTTCACAAATGAATTTTGG - Intergenic
1201910142 Y:19125496-19125518 AGGTTTAAACAAATGAATTTTGG - Intergenic
1202263753 Y:22996641-22996663 AGGTTCTTAACAATGGCCTTTGG - Intronic
1202416743 Y:24630382-24630404 AGGTTCTTAACAATGGCCTTTGG - Intronic
1202454044 Y:25039704-25039726 AGGTTCTTAACAATGGCCTTTGG + Intronic
1202591325 Y:26486831-26486853 ATGTATTTAAAAGTGTATTTGGG + Intergenic
1202628012 Y:56880328-56880350 CTGTTTTTAAAAATGACTTTTGG - Intergenic