ID: 1099228857

View in Genome Browser
Species Human (GRCh38)
Location 12:80000328-80000350
Sequence TAGTGGTACTTGATGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099228857_1099228863 2 Left 1099228857 12:80000328-80000350 CCCTTTTCCATCAAGTACCACTA No data
Right 1099228863 12:80000353-80000375 GGCCACACACTGCATGTACATGG No data
1099228857_1099228865 12 Left 1099228857 12:80000328-80000350 CCCTTTTCCATCAAGTACCACTA No data
Right 1099228865 12:80000363-80000385 TGCATGTACATGGACACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099228857 Original CRISPR TAGTGGTACTTGATGGAAAA GGG (reversed) Intergenic
No off target data available for this crispr