ID: 1099230365

View in Genome Browser
Species Human (GRCh38)
Location 12:80016351-80016373
Sequence ATTCGGTGTGTGGCAAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099230357_1099230365 -2 Left 1099230357 12:80016330-80016352 CCCTACTTACCCACAAAGAATAT No data
Right 1099230365 12:80016351-80016373 ATTCGGTGTGTGGCAAAAAGGGG No data
1099230354_1099230365 27 Left 1099230354 12:80016301-80016323 CCAGAGGGAGGGTAACATAGAGC No data
Right 1099230365 12:80016351-80016373 ATTCGGTGTGTGGCAAAAAGGGG No data
1099230356_1099230365 -1 Left 1099230356 12:80016329-80016351 CCCCTACTTACCCACAAAGAATA No data
Right 1099230365 12:80016351-80016373 ATTCGGTGTGTGGCAAAAAGGGG No data
1099230355_1099230365 0 Left 1099230355 12:80016328-80016350 CCCCCTACTTACCCACAAAGAAT No data
Right 1099230365 12:80016351-80016373 ATTCGGTGTGTGGCAAAAAGGGG No data
1099230358_1099230365 -3 Left 1099230358 12:80016331-80016353 CCTACTTACCCACAAAGAATATT No data
Right 1099230365 12:80016351-80016373 ATTCGGTGTGTGGCAAAAAGGGG No data
1099230353_1099230365 28 Left 1099230353 12:80016300-80016322 CCCAGAGGGAGGGTAACATAGAG No data
Right 1099230365 12:80016351-80016373 ATTCGGTGTGTGGCAAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099230365 Original CRISPR ATTCGGTGTGTGGCAAAAAG GGG Intergenic
No off target data available for this crispr