ID: 1099231219

View in Genome Browser
Species Human (GRCh38)
Location 12:80027596-80027618
Sequence GGGAGCTTTGGAACAAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099231219_1099231230 30 Left 1099231219 12:80027596-80027618 CCTACTTTTGTTCCAAAGCTCCC No data
Right 1099231230 12:80027649-80027671 CAAATTGTTGCTACTGTGGGGGG No data
1099231219_1099231227 28 Left 1099231219 12:80027596-80027618 CCTACTTTTGTTCCAAAGCTCCC No data
Right 1099231227 12:80027647-80027669 GCCAAATTGTTGCTACTGTGGGG No data
1099231219_1099231225 26 Left 1099231219 12:80027596-80027618 CCTACTTTTGTTCCAAAGCTCCC No data
Right 1099231225 12:80027645-80027667 CTGCCAAATTGTTGCTACTGTGG No data
1099231219_1099231224 3 Left 1099231219 12:80027596-80027618 CCTACTTTTGTTCCAAAGCTCCC No data
Right 1099231224 12:80027622-80027644 AAGGCACTTTTGAACATGAATGG No data
1099231219_1099231229 29 Left 1099231219 12:80027596-80027618 CCTACTTTTGTTCCAAAGCTCCC No data
Right 1099231229 12:80027648-80027670 CCAAATTGTTGCTACTGTGGGGG No data
1099231219_1099231226 27 Left 1099231219 12:80027596-80027618 CCTACTTTTGTTCCAAAGCTCCC No data
Right 1099231226 12:80027646-80027668 TGCCAAATTGTTGCTACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099231219 Original CRISPR GGGAGCTTTGGAACAAAAGT AGG (reversed) Intergenic
No off target data available for this crispr