ID: 1099231222

View in Genome Browser
Species Human (GRCh38)
Location 12:80027616-80027638
Sequence ATGTTCAAAAGTGCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099231222_1099231232 21 Left 1099231222 12:80027616-80027638 CCCACAAAGGCACTTTTGAACAT No data
Right 1099231232 12:80027660-80027682 TACTGTGGGGGGATATCAGTGGG No data
1099231222_1099231225 6 Left 1099231222 12:80027616-80027638 CCCACAAAGGCACTTTTGAACAT No data
Right 1099231225 12:80027645-80027667 CTGCCAAATTGTTGCTACTGTGG No data
1099231222_1099231226 7 Left 1099231222 12:80027616-80027638 CCCACAAAGGCACTTTTGAACAT No data
Right 1099231226 12:80027646-80027668 TGCCAAATTGTTGCTACTGTGGG No data
1099231222_1099231229 9 Left 1099231222 12:80027616-80027638 CCCACAAAGGCACTTTTGAACAT No data
Right 1099231229 12:80027648-80027670 CCAAATTGTTGCTACTGTGGGGG No data
1099231222_1099231230 10 Left 1099231222 12:80027616-80027638 CCCACAAAGGCACTTTTGAACAT No data
Right 1099231230 12:80027649-80027671 CAAATTGTTGCTACTGTGGGGGG No data
1099231222_1099231227 8 Left 1099231222 12:80027616-80027638 CCCACAAAGGCACTTTTGAACAT No data
Right 1099231227 12:80027647-80027669 GCCAAATTGTTGCTACTGTGGGG No data
1099231222_1099231231 20 Left 1099231222 12:80027616-80027638 CCCACAAAGGCACTTTTGAACAT No data
Right 1099231231 12:80027659-80027681 CTACTGTGGGGGGATATCAGTGG No data
1099231222_1099231233 22 Left 1099231222 12:80027616-80027638 CCCACAAAGGCACTTTTGAACAT No data
Right 1099231233 12:80027661-80027683 ACTGTGGGGGGATATCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099231222 Original CRISPR ATGTTCAAAAGTGCCTTTGT GGG (reversed) Intergenic
No off target data available for this crispr