ID: 1099231225

View in Genome Browser
Species Human (GRCh38)
Location 12:80027645-80027667
Sequence CTGCCAAATTGTTGCTACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099231219_1099231225 26 Left 1099231219 12:80027596-80027618 CCTACTTTTGTTCCAAAGCTCCC No data
Right 1099231225 12:80027645-80027667 CTGCCAAATTGTTGCTACTGTGG No data
1099231223_1099231225 5 Left 1099231223 12:80027617-80027639 CCACAAAGGCACTTTTGAACATG No data
Right 1099231225 12:80027645-80027667 CTGCCAAATTGTTGCTACTGTGG No data
1099231221_1099231225 14 Left 1099231221 12:80027608-80027630 CCAAAGCTCCCACAAAGGCACTT No data
Right 1099231225 12:80027645-80027667 CTGCCAAATTGTTGCTACTGTGG No data
1099231222_1099231225 6 Left 1099231222 12:80027616-80027638 CCCACAAAGGCACTTTTGAACAT No data
Right 1099231225 12:80027645-80027667 CTGCCAAATTGTTGCTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099231225 Original CRISPR CTGCCAAATTGTTGCTACTG TGG Intergenic
No off target data available for this crispr