ID: 1099231228

View in Genome Browser
Species Human (GRCh38)
Location 12:80027648-80027670
Sequence CCCCCACAGTAGCAACAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099231228_1099231233 -10 Left 1099231228 12:80027648-80027670 CCAAATTGTTGCTACTGTGGGGG No data
Right 1099231233 12:80027661-80027683 ACTGTGGGGGGATATCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099231228 Original CRISPR CCCCCACAGTAGCAACAATT TGG (reversed) Intergenic
No off target data available for this crispr