ID: 1099237926

View in Genome Browser
Species Human (GRCh38)
Location 12:80104250-80104272
Sequence GAGATTGGGATGTTTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099237926_1099237930 5 Left 1099237926 12:80104250-80104272 CCAGTGAGAAACATCCCAATCTC No data
Right 1099237930 12:80104278-80104300 TCTCCCATATCCAGATTGCTGGG No data
1099237926_1099237929 4 Left 1099237926 12:80104250-80104272 CCAGTGAGAAACATCCCAATCTC No data
Right 1099237929 12:80104277-80104299 CTCTCCCATATCCAGATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099237926 Original CRISPR GAGATTGGGATGTTTCTCAC TGG (reversed) Intergenic
No off target data available for this crispr