ID: 1099239015

View in Genome Browser
Species Human (GRCh38)
Location 12:80116345-80116367
Sequence GAGGGCAAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099239015_1099239023 24 Left 1099239015 12:80116345-80116367 CCATCCTGCTTCTGCTTGCCCTC No data
Right 1099239023 12:80116392-80116414 AAGTCCCAGTGAGATGAACTGGG No data
1099239015_1099239022 23 Left 1099239015 12:80116345-80116367 CCATCCTGCTTCTGCTTGCCCTC No data
Right 1099239022 12:80116391-80116413 CAAGTCCCAGTGAGATGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099239015 Original CRISPR GAGGGCAAGCAGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr