ID: 1099240939

View in Genome Browser
Species Human (GRCh38)
Location 12:80137859-80137881
Sequence CATTTTTATCAACGTGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099240939_1099240942 7 Left 1099240939 12:80137859-80137881 CCTGGTTCACGTTGATAAAAATG No data
Right 1099240942 12:80137889-80137911 AACCCGTGTTTCTGTTCTTTGGG No data
1099240939_1099240941 6 Left 1099240939 12:80137859-80137881 CCTGGTTCACGTTGATAAAAATG No data
Right 1099240941 12:80137888-80137910 TAACCCGTGTTTCTGTTCTTTGG No data
1099240939_1099240945 24 Left 1099240939 12:80137859-80137881 CCTGGTTCACGTTGATAAAAATG No data
Right 1099240945 12:80137906-80137928 TTTGGGAAGAAGTATCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099240939 Original CRISPR CATTTTTATCAACGTGAACC AGG (reversed) Intergenic
No off target data available for this crispr