ID: 1099243270

View in Genome Browser
Species Human (GRCh38)
Location 12:80163683-80163705
Sequence AAGCCAAATCACCCCAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099243270_1099243276 26 Left 1099243270 12:80163683-80163705 CCTTGGCTGGGGTGATTTGGCTT No data
Right 1099243276 12:80163732-80163754 TTGGGATCAATGGGCCCAGTTGG No data
1099243270_1099243272 7 Left 1099243270 12:80163683-80163705 CCTTGGCTGGGGTGATTTGGCTT No data
Right 1099243272 12:80163713-80163735 CATGTCTTTCATTTTTCTTTTGG No data
1099243270_1099243273 8 Left 1099243270 12:80163683-80163705 CCTTGGCTGGGGTGATTTGGCTT No data
Right 1099243273 12:80163714-80163736 ATGTCTTTCATTTTTCTTTTGGG No data
1099243270_1099243274 16 Left 1099243270 12:80163683-80163705 CCTTGGCTGGGGTGATTTGGCTT No data
Right 1099243274 12:80163722-80163744 CATTTTTCTTTTGGGATCAATGG No data
1099243270_1099243277 27 Left 1099243270 12:80163683-80163705 CCTTGGCTGGGGTGATTTGGCTT No data
Right 1099243277 12:80163733-80163755 TGGGATCAATGGGCCCAGTTGGG No data
1099243270_1099243275 17 Left 1099243270 12:80163683-80163705 CCTTGGCTGGGGTGATTTGGCTT No data
Right 1099243275 12:80163723-80163745 ATTTTTCTTTTGGGATCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099243270 Original CRISPR AAGCCAAATCACCCCAGCCA AGG (reversed) Intergenic
No off target data available for this crispr