ID: 1099250014

View in Genome Browser
Species Human (GRCh38)
Location 12:80242932-80242954
Sequence TCTTAGAAGCAGAAACAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 435}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099250014_1099250016 -2 Left 1099250014 12:80242932-80242954 CCGTCCTGTTTCTGCTTCTAAGA 0: 1
1: 0
2: 3
3: 40
4: 435
Right 1099250016 12:80242953-80242975 GAATGCCAAACCCAGCAGCAAGG 0: 1
1: 0
2: 2
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099250014 Original CRISPR TCTTAGAAGCAGAAACAGGA CGG (reversed) Intronic
902322685 1:15679676-15679698 TGGTAGAAGAAGAAACAGCATGG + Intergenic
902432543 1:16374521-16374543 TCATAGAAGTAAAAACAAGAAGG - Intronic
904946978 1:34206557-34206579 ACATAGAAACAGAAACAGGCAGG + Intronic
905779651 1:40696773-40696795 TCTGAGAACAAGAAACAGAATGG - Intronic
906357920 1:45123653-45123675 TCCCAGAAGCAGAAAAAAGAGGG + Intronic
906559226 1:46742897-46742919 TATTAGAAGCTGAAAAGGGAGGG + Intergenic
906751972 1:48272374-48272396 TCATAGAAGTAGAAGTAGGATGG - Intergenic
906955267 1:50368887-50368909 TCATAGTTGAAGAAACAGGATGG + Intergenic
907626384 1:56034453-56034475 TCTGAGAACCAGAAATAGGAAGG + Intergenic
907689188 1:56645391-56645413 GCTGAGAAGCAGAAGCACGACGG + Exonic
907707010 1:56841071-56841093 TCTTAGAAACAGAAACCATATGG - Intergenic
908074191 1:60496179-60496201 CCTTCTAAGGAGAAACAGGAAGG - Intergenic
908125359 1:61024962-61024984 TCATAGAAGCAGAAGAATGATGG + Intronic
909514617 1:76492983-76493005 GCCTAGAAGGAGAAAGAGGAAGG + Intronic
910680561 1:89859843-89859865 TCTTGGAAGCACAAAATGGAAGG - Intronic
910736474 1:90463728-90463750 TCTTAGAAGGGAAAAAAGGAAGG + Intergenic
912760302 1:112360328-112360350 ACTTAGAAAGAGGAACAGGATGG + Intergenic
913073752 1:115323887-115323909 TCTTGGAAACAGTGACAGGATGG + Intronic
913086997 1:115448353-115448375 TCTTATTAGAAGAAACAGCATGG + Intergenic
913182724 1:116337712-116337734 CCCTAGAAGCAGAAAAGGGAAGG - Intergenic
915750081 1:158199061-158199083 GCTAAAAAGCAGAAACAGGCCGG + Intergenic
916546908 1:165814260-165814282 TCTCAGAAGAAGAGACAGAAAGG + Intronic
916704805 1:167338175-167338197 GCTGAGAAGGAGGAACAGGAGGG - Intronic
916828672 1:168468576-168468598 TCTTTCAGGCAGAAAGAGGAGGG + Intergenic
918747381 1:188222210-188222232 ACCTCGAAGCAGTAACAGGATGG - Intergenic
919559814 1:199102510-199102532 TCATAGAAGCAGAAAGTAGAAGG - Intergenic
921396030 1:214670473-214670495 CCTTGGAAGCATAAACAGGTGGG + Intergenic
923153696 1:231257317-231257339 TCTGAGAAGCAGGAAAAGTAGGG - Intronic
924202845 1:241678037-241678059 TTTCAGAAGGAGAAACAGGGAGG + Intronic
924537131 1:244945308-244945330 TCATAGAAACAGAAAGTGGAAGG + Intergenic
1064570725 10:16690185-16690207 TCTTTGAAGCAGAATTATGATGG - Intronic
1064861079 10:19826431-19826453 TGTTTGGAGCAGAAACAGGAGGG + Intronic
1065825517 10:29567124-29567146 TCTTAGAAGCAGAGGAAGGGGGG - Intronic
1066256731 10:33686775-33686797 TCATAGAAAAAGAAAAAGGATGG - Intergenic
1066336157 10:34480533-34480555 TGTTAAAAGTAGAAACAGGTTGG - Intronic
1067932225 10:50574068-50574090 TCTTAGAAGAAAACACAGGGGGG + Intronic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1070074512 10:73122153-73122175 TCTAAGAAACAGAAAGGGGAAGG - Exonic
1071080445 10:81803909-81803931 GCTGAGAAGAATAAACAGGATGG - Intergenic
1071978688 10:90981331-90981353 TCTTTGGGGCAGTAACAGGATGG - Intergenic
1072217442 10:93299359-93299381 TCTTAGAGGCAGCAAGAGCATGG - Intergenic
1072217964 10:93303866-93303888 TCTTAGAAGCAGACAAATTAGGG - Intergenic
1073024676 10:100478984-100479006 TCTTGGAAGCAGAAACAAGTTGG + Intronic
1073765954 10:106683367-106683389 TCATGGAAGCAGAGACAGAATGG - Intronic
1074089457 10:110235050-110235072 TCTAAGAAGCAGAAATTGGATGG - Intronic
1074736355 10:116438250-116438272 TCTCAGAAGCAGAGAAACGAGGG + Intronic
1074761743 10:116671748-116671770 TCTTGGAAGCAGAATCATCAAGG - Exonic
1074949686 10:118319894-118319916 TGTAAGTAGCTGAAACAGGATGG - Intronic
1076064435 10:127438188-127438210 TTCTAGGACCAGAAACAGGATGG + Intronic
1076664699 10:132079772-132079794 TCATAGAAACAGAAAATGGAAGG - Intergenic
1076801960 10:132835069-132835091 TCCCTGAAGCACAAACAGGAGGG - Intronic
1077499808 11:2904213-2904235 TCCCAGAAGCAAACACAGGAAGG - Intronic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1078026219 11:7698122-7698144 TCTTTGAAGCTGCAACTGGAAGG - Intronic
1078415690 11:11162807-11162829 TAGTAGAAGCAGCAACAAGAGGG - Intergenic
1079692548 11:23437962-23437984 TTTTGGAGGCCGAAACAGGAGGG - Intergenic
1080810827 11:35702423-35702445 CCTTAATCGCAGAAACAGGAGGG - Intronic
1081182304 11:39998505-39998527 TCATAGCAGCAGAAAAAGAAAGG + Intergenic
1081556412 11:44166396-44166418 TCTAAGAAGCAGTAGCAGGGAGG + Intronic
1082077441 11:47985145-47985167 TCTTAAAAACAAAAACAGGCCGG - Intronic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1082657384 11:55870762-55870784 CCATGGCAGCAGAAACAGGAAGG + Intergenic
1082960433 11:58914181-58914203 TGTTAAAAGCAGAAACAGCATGG - Intronic
1082980373 11:59115338-59115360 TGTTAAAAGCAGAAACAGCATGG - Intronic
1083258859 11:61512489-61512511 TCTTAGACACAGAAGCAGCAGGG + Intergenic
1085473917 11:76776886-76776908 TCTTAGAAGAAGAGAAAGAAAGG - Intergenic
1085968503 11:81558050-81558072 TCTTGGAAGCAGAAACAGGTAGG - Intergenic
1086237404 11:84648252-84648274 TCATAGAAGAAGAAACAGGCTGG + Intronic
1086457647 11:86975307-86975329 TCTTAAAAGTAGAAACCGGCCGG + Intergenic
1087205074 11:95386014-95386036 TCTTACAAGCAGATACAACAAGG - Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1089034132 11:115367764-115367786 TCTTAGAAAAAAAAACAGTAAGG + Intronic
1089562638 11:119352309-119352331 TGTCAGAAGCAGAGACAGGATGG - Intergenic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090484243 11:127098418-127098440 TCTTTGAAGCTGCAAAAGGAAGG - Intergenic
1090527331 11:127551520-127551542 TCTTAGAAGAAGAAAAACAATGG - Intergenic
1090560923 11:127931072-127931094 ACATAGAAACAGAAACAGAATGG + Intergenic
1090697506 11:129263134-129263156 TCTTAGAAGAAAACATAGGAGGG + Intronic
1093176968 12:15923316-15923338 TTTTAAAAGCAAAAACAGGCCGG - Intronic
1093563536 12:20573969-20573991 GCTTAGAAGCAGAAAATGCAGGG - Intronic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1094077921 12:26498335-26498357 TCTTAAAAAAAGAAACAGTAAGG - Intronic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1096196882 12:49654319-49654341 CCAGAGAAGCAGCAACAGGAAGG + Intronic
1096890123 12:54761314-54761336 TCTTACAATCAGAAATAGGCCGG + Intergenic
1098925634 12:76347282-76347304 TCCTGGAATCTGAAACAGGAAGG + Exonic
1099160160 12:79231155-79231177 ATTTAGAAGCAGAAACCAGAGGG + Intronic
1099250014 12:80242932-80242954 TCTTAGAAGCAGAAACAGGACGG - Intronic
1100095555 12:91030480-91030502 TTTTACAAGCAGAAAAAAGATGG + Intergenic
1100483772 12:95004895-95004917 TCTTAGAAACAGAAGTAGAATGG - Intergenic
1100760230 12:97798963-97798985 AATTAGGAGGAGAAACAGGAAGG + Intergenic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1102596945 12:114000137-114000159 GTTGGGAAGCAGAAACAGGAGGG - Intergenic
1103913529 12:124364524-124364546 TCTCAGTAGCAGACAGAGGAAGG - Intronic
1104312620 12:127667573-127667595 GCCTAGAAGCAGAAAAAGGCTGG - Intergenic
1104639865 12:130460687-130460709 TATTAGCAGCAGCAACAGCAGGG + Intronic
1105212816 13:18267292-18267314 TCCTAGAAGGAGAAGCAGGTAGG + Intergenic
1105529917 13:21209801-21209823 TCTTGGAAGCAGTGACTGGATGG + Intergenic
1105550100 13:21385839-21385861 TCTTAAAAGTAGCTACAGGAGGG + Intronic
1105650974 13:22377711-22377733 TCTTAAACGAAGATACAGGAGGG + Intergenic
1105941765 13:25153951-25153973 TCTTAGATGCAGACAAGGGAAGG + Intergenic
1107035498 13:35898111-35898133 TCTTGGAAGCAGTAATGGGAGGG - Intronic
1107421917 13:40255159-40255181 TCCTGGAAGCAACAACAGGATGG + Intergenic
1107654833 13:42581104-42581126 TCTGAGGAGGAGAAACAGTAAGG - Exonic
1107658498 13:42615579-42615601 TATAAGAAGCAAAAACAGGCTGG - Intergenic
1108480890 13:50870287-50870309 TCTTAAAAGCAGAGACCGAAGGG + Intergenic
1108533666 13:51349682-51349704 TCCTAAAAGCAGAATCAGGACGG - Intronic
1108724153 13:53162545-53162567 TCTCAGAGGAAGAGACAGGAGGG + Intergenic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1111484450 13:88878322-88878344 TCTTAGAAGCTGAAAAAGGCAGG - Intergenic
1112125797 13:96466462-96466484 TCGTAGAAGCAGAAAATTGAAGG - Intronic
1112458697 13:99584246-99584268 TCGTAGAAGCAGGACCAGTAAGG + Intergenic
1112662937 13:101534355-101534377 TTTTAGAAGAAGAAATAGGTAGG + Intronic
1113076022 13:106468687-106468709 TCTAAGATGGAGACACAGGATGG - Intergenic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113590319 13:111494347-111494369 ATTTAGATGCAGAAACAGGGAGG - Intergenic
1114254401 14:20989316-20989338 ACGTAGCAGCAGACACAGGAGGG + Intergenic
1114832182 14:26157724-26157746 TCTTAAGAGCAGAGAGAGGATGG - Intergenic
1115627338 14:35207009-35207031 TCTTAAAAGCAGAAAAATGTAGG - Intronic
1117661564 14:58011201-58011223 ACTGAGAAGCAGAAATAGTAAGG + Intronic
1117696508 14:58370079-58370101 TCCTAGAAATAGGAACAGGATGG + Intronic
1117852147 14:59985261-59985283 TCATAGAAGCAGAAGTAGAATGG + Intronic
1118463586 14:66010562-66010584 ACTAAGCAGCTGAAACAGGATGG - Intergenic
1118840266 14:69504620-69504642 TTTTAGAAGAAGAAAAATGAGGG - Intronic
1118955175 14:70475013-70475035 TCTAAGTAGAAGAAACAAGAAGG + Intergenic
1119258606 14:73222106-73222128 ACTGAGAACCAAAAACAGGAAGG - Exonic
1119351469 14:73969242-73969264 TATTAGCAGCAGAGACAGGCAGG + Intronic
1119977071 14:79037085-79037107 TCTGAGAAGAGGAAAGAGGAAGG + Intronic
1120470542 14:84918295-84918317 TCTTAGATGGAGTAAGAGGAAGG - Intergenic
1121489078 14:94345018-94345040 TGTTAGAAGCAGGAGCAGGAAGG + Intergenic
1121831733 14:97058313-97058335 TCATAAAAGCAGCAACATGATGG - Intergenic
1122728164 14:103774189-103774211 TCTTAGAAGAAAACACAGGAGGG + Intronic
1123816097 15:23980967-23980989 TCCTTGAAGCAGCAATAGGAAGG + Intergenic
1125731220 15:41893734-41893756 TCTGAGAAGAAGAATCTGGAAGG - Intronic
1126362422 15:47860112-47860134 CCTGAGAAGCAGAAACAGCGAGG - Intergenic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1127985831 15:64069674-64069696 TCTCAAAAGCAAAAACAAGAAGG + Intronic
1127988919 15:64096545-64096567 TCTTAGAAGCAGTAAGACGGGGG - Intronic
1128654432 15:69450181-69450203 TTTGAGAGGCTGAAACAGGATGG + Intergenic
1129009147 15:72398978-72399000 TCTTGGAGGAAGAAACATGAAGG - Intronic
1129027397 15:72590267-72590289 ACTGAGAAGCAGATACAGCATGG - Exonic
1129758829 15:78115642-78115664 GCTTAGGAGCAGAAACAAAAGGG + Intronic
1130293718 15:82627350-82627372 TCTAGGAAGAAGAAGCAGGAAGG - Intronic
1133733630 16:8597109-8597131 TCTAAGAAGCAGACACAGACAGG + Intergenic
1134768631 16:16784598-16784620 TCTTAGGAGAAAAAAAAGGAAGG - Intergenic
1136126602 16:28187233-28187255 TCTCAGAAGCAAATGCAGGATGG - Intronic
1137405891 16:48189076-48189098 TTTTAGAGGCAGAAAAAGCAAGG - Intronic
1138248800 16:55486933-55486955 TAGTAAAAGCATAAACAGGAAGG - Intronic
1138272878 16:55708750-55708772 TCATAGAGTCAGAAACAGAAAGG - Intergenic
1138677938 16:58665528-58665550 TCTAAGAAGCAGAAGCTGGTTGG - Exonic
1138791221 16:59906312-59906334 TCTTAGAAGCAAAATAAGCAAGG + Intergenic
1138896701 16:61214626-61214648 TCTTACATGCAGAAACATGCAGG + Intergenic
1139852161 16:69957828-69957850 TCTTAGAATCAGCAACAGCTTGG - Intronic
1139881132 16:70180732-70180754 TCTTAGAATCAGCAACAGCTTGG - Intronic
1140371373 16:74414786-74414808 TCTTAGAATCAGCAACAGCTTGG + Intronic
1140403184 16:74688411-74688433 TCTTAGAAGAAAACACAGGAGGG + Intronic
1140851961 16:78943436-78943458 TCCTAGAGGGAGAAACAGGGAGG + Intronic
1143707315 17:8707921-8707943 GGTTAGATGCAGAAACATGAAGG + Intergenic
1144016360 17:11200118-11200140 TCTTGGAGTCAGAAAGAGGATGG + Intergenic
1145004428 17:19329312-19329334 TGTTAGAAGCAGTAGCAGGTGGG + Intronic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1147328358 17:39681176-39681198 TCTTATAAGCAGAAACACAAGGG + Intronic
1147914898 17:43880324-43880346 TCTTAGTGGCAGAAACAGCGGGG - Intronic
1148429670 17:47632247-47632269 TATTAGCAGAAGAAACAGCATGG + Intergenic
1148961685 17:51398421-51398443 TGTTAGAAGCTGAAAAAGCAGGG + Intergenic
1150963814 17:69944749-69944771 TTCTAGAAGAAGAAACAGGAAGG + Intergenic
1151022300 17:70631454-70631476 TCTTAGAAGTAGGAAAGGGAGGG + Intergenic
1152424766 17:80212892-80212914 TATAAGAAGCGGAAACAGGCCGG + Intronic
1152931182 17:83110840-83110862 TCATAGAGGCAGAAACAGAACGG - Intergenic
1153398900 18:4659785-4659807 TCTAAGAAGAAGAGACAGAAGGG + Intergenic
1155354712 18:24941134-24941156 TCTGGGAACCAGAAATAGGAGGG - Intergenic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1156046087 18:32878859-32878881 TCTTAGAAGTGGAACCAGAATGG - Intergenic
1156055778 18:33000570-33000592 TCTTAAAAGCAGCAAGAGAAAGG + Intronic
1159121715 18:64178577-64178599 TCTTAGGAGCAGTTTCAGGAGGG - Intergenic
1159207979 18:65278841-65278863 TCTTAGATCCAGGAACAGGCTGG + Intergenic
1159251448 18:65883038-65883060 TTTTAAAAGCAGAAAAAGCAGGG - Exonic
1159695930 18:71556495-71556517 TTTTAGAAGTAGAAACCAGATGG - Intergenic
1160220039 18:76968718-76968740 TCTTATAACCAGAAACATGAAGG - Exonic
1162284922 19:9730948-9730970 TCATAGAAGGAGAGACAGAATGG - Intergenic
1162847222 19:13402276-13402298 TCTTTGATACAGAAACAAGAAGG + Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163269007 19:16238615-16238637 TCTGAAAGGCAAAAACAGGAAGG + Intronic
1163648320 19:18502787-18502809 TCTCAGAAGCAAAAACAGGAAGG - Intronic
1164770347 19:30803600-30803622 TCTTAGAAGCAGTACAAGAAGGG + Intergenic
1164801332 19:31079281-31079303 TCTTAGCAGGAGAAAGAGGAAGG + Intergenic
1164837982 19:31370506-31370528 TCTTCTAACCTGAAACAGGACGG + Intergenic
1165910132 19:39220697-39220719 TCTCAAAAACAGAAACAGGCTGG - Intergenic
1166491835 19:43267081-43267103 CCCCAGAAGCAGAAACAGAAGGG - Intronic
1167030229 19:46954031-46954053 CCTTAGAAGAAGAGACAGGAGGG + Intronic
1167568527 19:50272257-50272279 ACTTAGAATCAGAAACAGAAGGG + Intronic
1167660924 19:50795584-50795606 CTGTAGAAGCTGAAACAGGAGGG - Intergenic
1168063902 19:53908784-53908806 TCTGAGAAGGAGAGACAGCAGGG - Intergenic
925488348 2:4362544-4362566 TCTTAGAAGCAGAGAGTAGATGG - Intergenic
925656867 2:6158480-6158502 CCTTAGCAGCAGAAAAAGGCAGG - Intergenic
925826192 2:7850444-7850466 GCTTTGAAGAAGAAACAGGAAGG - Intergenic
926119111 2:10231884-10231906 TTTTTGAAGCACAAACATGAGGG - Intergenic
926449200 2:12981751-12981773 TCATATAAGCATACACAGGATGG - Intergenic
926881095 2:17543952-17543974 TTTTTGGAGAAGAAACAGGAAGG - Intronic
927202090 2:20584187-20584209 TTCTAGAAGCAGCACCAGGAAGG - Intronic
929205817 2:39291587-39291609 TTTTAGAAACAGAAAGAGGCTGG + Intronic
930416116 2:51093160-51093182 TCTTAGCAGCAGGAATAGGCTGG + Intergenic
930474848 2:51868723-51868745 ACTTGGAATCAGAAACAGCAGGG + Intergenic
931328156 2:61249783-61249805 TGGTAGAAACAGAAACAGGCTGG - Intronic
932134039 2:69213047-69213069 TCTGAGAAGCTGAGGCAGGAGGG - Intronic
932458924 2:71869689-71869711 TCTTAGAAGCAGAAAGACTGGGG + Intergenic
933269423 2:80217126-80217148 TCTAAGAAGTAGAAATAGGCTGG - Intronic
934653412 2:96104846-96104868 TCTCAGCTGCAGAAACAGGATGG - Intergenic
935470404 2:103452743-103452765 TCTGAGATGTAGAAACAAGATGG + Intergenic
935517451 2:104058851-104058873 TCTTAAAAGCAATAACAGCAAGG + Intergenic
936995070 2:118404781-118404803 TCTGAGGAGCAGAGAAAGGATGG + Intergenic
937118953 2:119428968-119428990 TGTTAAAAGCAGAAACAGCATGG - Intergenic
938162958 2:129002917-129002939 TCTCACAAGCGGAAAGAGGATGG - Intergenic
938870706 2:135473185-135473207 TCATAGAAACAGAAAATGGAAGG - Intronic
939664062 2:144928719-144928741 TCTTAGAAACAGAAAGAAAAAGG - Intergenic
939732983 2:145808365-145808387 TCCTAGCAGCAGAAACAGCAGGG - Intergenic
939751890 2:146058299-146058321 AATTAGAATGAGAAACAGGAGGG - Intergenic
940251192 2:151678761-151678783 ACTGAGAAGCAGAGACATGAGGG + Intronic
940361686 2:152802958-152802980 TCTTTGAAATAGTAACAGGAAGG - Intergenic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
940690329 2:156909886-156909908 TCTTAGAAGTAGAAGACGGAAGG + Intergenic
942270249 2:174267364-174267386 TCTCAGAACAAGAAACAGGACGG - Intergenic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
943245359 2:185442051-185442073 GCTCAGATGCAGAAATAGGATGG + Intergenic
944057970 2:195543460-195543482 CCTTATAAGAAGAAACATGAGGG - Intergenic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
944271771 2:197791903-197791925 TCATAGAAACAGAAAAAGGGAGG - Intergenic
945459369 2:210087317-210087339 TCTTAAAAGCAACAAGAGGATGG - Intronic
945480141 2:210336029-210336051 TCTTAAAAGCAGTAAAAGAAAGG - Intergenic
945767058 2:213994006-213994028 TGTTAGAATCATAAACAGAATGG - Intronic
946073223 2:217052233-217052255 GCATAGAAGCAGTGACAGGAGGG - Intergenic
947871792 2:233442898-233442920 TTTTAAAAGCAGTAACAGGCCGG - Intronic
948410611 2:237757004-237757026 TCTTAGAAGCTGAAAAAGGCAGG + Intronic
1169552827 20:6718766-6718788 TCTTCGGAGGAGAACCAGGAAGG - Intergenic
1169925215 20:10776642-10776664 TCATAGAAGCAGAAGTAGAATGG + Intergenic
1170837026 20:19893465-19893487 GCTTAGAAACACAAACTGGATGG - Intronic
1170975988 20:21165276-21165298 GCTTTGAAGGAGAAAGAGGAGGG + Intronic
1171333205 20:24359451-24359473 TCCTGGAAGGAGACACAGGAGGG + Intergenic
1173334846 20:42104165-42104187 TCTTATAAGAAGAAACATGTAGG + Intronic
1173779058 20:45738230-45738252 TCATAGAAGCAGAATTAGAATGG + Intergenic
1173966065 20:47113783-47113805 TCTGAAAAGCAGAAACATTATGG - Intronic
1174064345 20:47853719-47853741 TCTCAGAAGCAGGAACTGGGGGG + Intergenic
1174732937 20:52935883-52935905 TTCTAGGTGCAGAAACAGGAAGG - Intergenic
1175086990 20:56468256-56468278 CCTTAATCGCAGAAACAGGAGGG + Intergenic
1176031125 20:63012574-63012596 TTTAAGAAGGAAAAACAGGATGG - Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1177657238 21:24034123-24034145 TCTGAAAAACAAAAACAGGATGG + Intergenic
1177857739 21:26418797-26418819 TCTTATAAGAAGAAACATAAGGG + Intergenic
1178366764 21:31994909-31994931 TTTGGGAAGCAGAGACAGGAGGG + Intronic
1181699932 22:24615020-24615042 TCCTAGAAGGAGAAGCAGGTAGG - Exonic
1181849096 22:25737020-25737042 TGTCAGAAGAAGCAACAGGAAGG - Intergenic
1182051895 22:27318819-27318841 TCTGAGAAACAGCAAGAGGAAGG + Intergenic
1182126125 22:27817036-27817058 TTTGAGCAGCTGAAACAGGACGG + Intergenic
1183867462 22:40715155-40715177 TCATAGAAACAGAAAGGGGAAGG + Intergenic
1184259095 22:43304480-43304502 TGTGAGAAGCAGGAACAGGCAGG + Intronic
1184509412 22:44924522-44924544 TCTTATAAGAAGAGACACGAGGG + Intronic
949655697 3:6216295-6216317 TATTAGAAGTACAAACAGTAGGG + Intergenic
950021347 3:9789848-9789870 CCCAAGAAGCAGAAACTGGAAGG - Exonic
950900159 3:16490381-16490403 TCAGAGAAGCAGAGAAAGGAGGG + Intronic
951187784 3:19734519-19734541 GCTTAGAACCATACACAGGAGGG - Intergenic
951192225 3:19784272-19784294 TCTTAGAATCAGAAAGAAGTGGG - Intergenic
951620388 3:24595058-24595080 TGTATTAAGCAGAAACAGGATGG - Intergenic
951621996 3:24612675-24612697 TCTTAGAAGCAGAATACGGTTGG + Intergenic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
952181253 3:30918707-30918729 TCTTAGTGGCATAAACAGTAAGG - Intergenic
952752777 3:36838835-36838857 TCTGAGAAGGAGGAGCAGGAAGG + Intronic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
952773531 3:37023025-37023047 TCTAAGAAGCAGAAAGATGGTGG - Intronic
954667341 3:52263509-52263531 TCCAGGAAGCTGAAACAGGATGG + Intronic
955771480 3:62389172-62389194 TCCTAGCAACAGACACAGGATGG - Intergenic
956225379 3:66951668-66951690 TCTTAGAAACAGCAAATGGAAGG + Intergenic
956324606 3:68037466-68037488 TTTTAAAAGCAGCAACAAGAAGG - Intronic
957561556 3:81828471-81828493 TCTAAGAGGCAGAAAAACGAAGG - Intergenic
958472678 3:94541264-94541286 TCTTAAAAGAAGGAACAGTAGGG + Intergenic
960436772 3:117635757-117635779 TTTTAGAAGCAGTAACAGATGGG - Intergenic
960715232 3:120568675-120568697 TGTTAGAGGAAGAAACAGGCTGG + Intergenic
960757120 3:121027509-121027531 CTTTAGAAGCTGAAAAAGGAAGG - Intronic
961185913 3:124914974-124914996 TCTTAGAAGGAGCAAAAAGAAGG + Intronic
961417950 3:126775016-126775038 TCTAAAAAGCAGATACAAGACGG - Intronic
961464029 3:127070710-127070732 TTATAGGAGCAGAACCAGGACGG - Intergenic
961742852 3:129045067-129045089 TCATATAAGAAGAAACAGGCTGG + Intergenic
962128437 3:132647538-132647560 CCTTAGAAGCATAAACAGACAGG + Intronic
963738417 3:149048873-149048895 ACTTAGAATCAGAAAGAAGATGG - Exonic
964614690 3:158650115-158650137 TCTTGTAAGCAGGAAAAGGATGG + Intronic
964806355 3:160613887-160613909 GCTTGGAAGTAGAAACAGCAGGG - Intergenic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
965704181 3:171489454-171489476 TCTCAGAGGAAGAAAAAGGAAGG + Intergenic
966236019 3:177702435-177702457 TTTGAGAAGCAGAAACACCAAGG + Intergenic
966467597 3:180248482-180248504 ACTTAGAAGTAGAAACATGTAGG + Intergenic
966747116 3:183287806-183287828 TCTTGGAGGCAGAAACAGAGTGG - Intronic
968527116 4:1065874-1065896 TCTTAAAAACAAAAACAGGCCGG - Intronic
969240654 4:5894774-5894796 TCTTGGAAGAGGAAACAGGAGGG + Intergenic
969727189 4:8927306-8927328 TAGTAAAAGGAGAAACAGGAGGG - Intergenic
970110722 4:12635182-12635204 TTTCAGAAGAAGAAACATGAGGG - Intergenic
970289941 4:14561178-14561200 TTTTAGCAGCAGAAAAAGGCAGG + Intergenic
970406897 4:15772741-15772763 TCATTGAAGCTGAAACATGAAGG + Intergenic
970704764 4:18786728-18786750 TCTTAGAAGCAAAAACAGGTTGG - Intergenic
971465820 4:26959482-26959504 TCTTAGAAGGTGATACACGATGG - Intronic
971583832 4:28378972-28378994 GCTTAGAAACAGAAACTGAATGG + Intronic
972156050 4:36163301-36163323 TCTTGGAAGCTGAGAGAGGATGG + Intronic
972760194 4:42095831-42095853 TCTTAGAAGAAGGAAGATGATGG + Intergenic
973091880 4:46147386-46147408 ACTTGGGAGCAGAATCAGGAGGG + Intergenic
973108201 4:46367024-46367046 TCTGAAAAGCAGTAACAGCAGGG + Intronic
973875838 4:55217555-55217577 ACTCAGAAGCAAAAACAGGAAGG - Intergenic
974046668 4:56904452-56904474 TGTTAGAGACAGAAACAGCAGGG + Intergenic
974064773 4:57067502-57067524 TTATAGAAGCAGACACAGAATGG + Intronic
974138161 4:57847083-57847105 TCTTAAAAGCAGCTACAGGAGGG - Intergenic
975859194 4:78658240-78658262 TCTGAGTGACAGAAACAGGAAGG - Intergenic
976694105 4:87899888-87899910 TCTGACAAGAAGAAACAGAATGG + Intergenic
976907076 4:90251453-90251475 TTATAGATGCAGAAACAGCATGG - Intronic
976911305 4:90309514-90309536 TCTTTGAATCTGAAATAGGATGG - Exonic
978815057 4:112894759-112894781 TTATAGGAGCAGAAACAAGAGGG + Intronic
978976214 4:114877650-114877672 ACTTAGAAGGAGAAATAGGCCGG + Intronic
979675095 4:123401238-123401260 TATTAGATTCACAAACAGGAAGG + Intronic
980044794 4:127975337-127975359 TCATAGAAGCAGAAAGTAGAAGG - Intronic
980918903 4:139062465-139062487 TTTTAAAAGTAGAAACAGGCCGG - Intronic
980939076 4:139255518-139255540 TCTTTGAGGCACAAACAGGATGG + Intergenic
982644202 4:158002475-158002497 TCTTAGAAGCAGAAGTAGAATGG + Intergenic
982718559 4:158835939-158835961 TCCTAAAAGCAGTAACAGAAAGG - Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984214510 4:176892933-176892955 TTTTAAAATCAGAAACAGCATGG - Intergenic
984949436 4:184995950-184995972 TCTTAGGAGCAGAAACTAAATGG + Intergenic
985747031 5:1653516-1653538 GCTCAGATGCAGAAACAGGCTGG - Intergenic
986078284 5:4361052-4361074 TTTTAGAAGTTTAAACAGGAAGG + Intergenic
986266173 5:6193326-6193348 GCTGAGAGGCCGAAACAGGAGGG - Intergenic
987244842 5:16038147-16038169 TCTTAGTGGGAGAAAGAGGAGGG + Intergenic
987474400 5:18373091-18373113 CTTTGGAAGCAGAATCAGGAGGG + Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
988892140 5:35629451-35629473 TCTTAAAAGAAGGAACAGGCCGG - Intronic
989074167 5:37545237-37545259 TATTAGAAGCAGAAAACTGAAGG - Intronic
989272559 5:39550131-39550153 TAATAAAAGCAGAAACATGAAGG - Intergenic
989379329 5:40798131-40798153 GCCGAGAAGCAGAAACACGACGG - Exonic
990396505 5:55385408-55385430 ACTTAGCAGCAGCAACAGGTAGG + Intronic
990845652 5:60135534-60135556 TACCAGAAGCAGTAACAGGAAGG + Intronic
992158950 5:73981974-73981996 TCTCATCAGCAGAAACAAGAAGG - Intergenic
992345386 5:75870754-75870776 TCTTAAAAGCATAAAGAGAACGG + Intergenic
993390646 5:87316644-87316666 TATTAAAAACAGATACAGGAAGG - Intronic
993868656 5:93224303-93224325 TCTTAGAAGCATGTACAGAAAGG + Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994376507 5:99020927-99020949 TCTCTGAAGCAGTCACAGGAAGG + Intergenic
994797683 5:104325936-104325958 TTTTAGAAGCTGGAAAAGGATGG - Intergenic
994815826 5:104586734-104586756 TTTTAGAAGAAGAGACATGAAGG + Intergenic
995806450 5:116057731-116057753 TCTTAGGAAAAGGAACAGGATGG + Intronic
996398404 5:123035637-123035659 TCTTCGAAGCTGAAGCTGGAGGG - Intronic
996903719 5:128574237-128574259 TCTTGGAAGCAGAGAAATGAAGG + Intronic
997036032 5:130193004-130193026 TCTTAGAAGCATAAACTGATAGG - Intergenic
997506554 5:134422113-134422135 TCTTAGAAGGAGGAAGAAGAGGG - Intergenic
997736695 5:136217601-136217623 TCTGAGAAGGAGCAGCAGGAAGG - Intronic
997978912 5:138457103-138457125 TCCTAAAAGCAGGCACAGGAAGG - Intergenic
998933583 5:147208997-147209019 CCTTAGAAGCAAAAACAGGCAGG + Intergenic
998981526 5:147708471-147708493 ACGTAGAAGGAGAAACAGGTTGG + Intronic
999035189 5:148341236-148341258 ACTTATAAGCAGAAACCTGAAGG + Intergenic
999071873 5:148752027-148752049 TCTTAGAAGCAGACAATGAATGG - Intergenic
999531171 5:152465004-152465026 TCATAGATGGAGAAACATGAAGG - Intergenic
1001308947 5:170596875-170596897 TCTGGGAAGCAGACACAGCAAGG + Intronic
1001851101 5:174966503-174966525 TCTGAGAACCAGAAAAAGCAAGG - Intergenic
1002692603 5:181060596-181060618 TTTAAAAAGGAGAAACAGGAAGG + Exonic
1005020368 6:21412025-21412047 TATTAAAATCAGAAACAAGATGG - Intergenic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1006401163 6:33818312-33818334 TCTTAGTACCAGATACAGGGAGG + Intergenic
1006520627 6:34568997-34569019 TAGTGGAAGCAGGAACAGGACGG + Intergenic
1007162538 6:39803595-39803617 TGTTAGAAGCAGAAACTGTCAGG + Intronic
1007293648 6:40805193-40805215 TCTTAGGAGCAGCCACAAGATGG - Intergenic
1007624790 6:43238841-43238863 TTTAAGAAGCAAAAACAGGCCGG - Intergenic
1008326296 6:50185943-50185965 TCTAAGAAGGAGAAATGGGATGG - Intergenic
1008704182 6:54137750-54137772 TCTTTGAAGAGTAAACAGGATGG + Exonic
1009040472 6:58170207-58170229 TCTTAGAAGCAGTAACTGAGGGG - Intergenic
1009216329 6:60924744-60924766 TCTTAGAAGCAGTAACTGAGGGG - Intergenic
1009715218 6:67384203-67384225 TTTTAAAAGCAGAAACAAAAAGG + Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1010684831 6:78841286-78841308 TCTTAGCACCATGAACAGGATGG - Intergenic
1011075433 6:83432784-83432806 TCTCAGAAACAGGAACAGGTAGG - Intergenic
1011335226 6:86252578-86252600 TGTTTGAAGCAGTAACATGAGGG - Intergenic
1012576169 6:100802701-100802723 TATTAAAAGCAGAATCAGGCTGG + Intronic
1013017493 6:106173710-106173732 TCTGAGAAGAAGGGACAGGATGG + Intergenic
1013403480 6:109820993-109821015 TCATTGAAGCTGAAACAGAAGGG + Intronic
1013705048 6:112823045-112823067 TCTGTGAAGCAGAATCAGAATGG - Intergenic
1013765574 6:113571067-113571089 TCTTAGAAGAAGAAAAACTAAGG - Intergenic
1014092670 6:117422018-117422040 TCTAAGAAACAAAAACAGAAAGG - Intronic
1014588585 6:123232513-123232535 TCTGAGAAGCAGAAAGGGCAAGG + Intronic
1015129186 6:129790929-129790951 TCATAGAAGCAGAGACTGGGTGG + Intergenic
1017159036 6:151348394-151348416 TTTGAGAAGCTGAGACAGGAGGG + Intronic
1017655364 6:156622592-156622614 TCTTAGAAGCAGAAAATGACTGG + Intergenic
1017690523 6:156959577-156959599 TCTTAAAAGGAGGATCAGGAGGG + Intronic
1018238897 6:161753483-161753505 TCTTAGAAGCAGTACGAAGAAGG + Intronic
1018563924 6:165131326-165131348 TCTTAGAACTAGAAACCAGAAGG - Intergenic
1019963834 7:4483234-4483256 TTTTAGAAACAGAGACAGGGAGG - Intergenic
1020745382 7:12072786-12072808 TCTCAACAGCAGAAAAAGGATGG + Intergenic
1021301687 7:18981118-18981140 TATTAAAAGAAGAAACAGGCCGG - Intronic
1022260484 7:28699704-28699726 TTTTAGAAACAGAAATAGTAGGG + Intronic
1022571289 7:31456593-31456615 TCATAGAAGAAGAACCAGAATGG + Intergenic
1022841365 7:34167111-34167133 TCTTAGATATAGAAAAAGGACGG - Intergenic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1023365784 7:39461785-39461807 TCTTATAAGAAAAAACAGTAGGG - Intronic
1027364962 7:77447780-77447802 TCTTAGGGACAGAAACAGGATGG + Intergenic
1029528243 7:101108612-101108634 TCTCAGAAACAGCAACAGGTGGG + Intergenic
1031624379 7:123975240-123975262 TTTTAGAATCAGAATCAGAAAGG - Intergenic
1032219773 7:129985472-129985494 TTTTAAAAACAGAGACAGGAAGG - Intergenic
1032306824 7:130741871-130741893 TCTTATAAGCAGAAATAAGAAGG - Intergenic
1032812393 7:135433660-135433682 TCTATGAAACAAAAACAGGATGG - Intronic
1032976330 7:137228048-137228070 TCTAAGAAGAAGAAAAAGGAAGG - Exonic
1033419065 7:141189809-141189831 TCTGAGTACCAGAAACTGGATGG + Intronic
1033647120 7:143313996-143314018 TCATAGAAGCAGAAAGTAGAGGG - Intergenic
1034975127 7:155444176-155444198 TCATAGAAGCAGAAAGTAGAAGG + Intergenic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035579988 8:733403-733425 TGGTAGAAGCAGAAACTTGATGG + Intronic
1036222493 8:6932254-6932276 TCTTACAAGCAGAACCAGAATGG - Intergenic
1037010508 8:13836794-13836816 TATTAGTATAAGAAACAGGAAGG - Intergenic
1037434564 8:18848891-18848913 TCTTAAAAGCTTAAACATGAGGG - Intronic
1039360321 8:36869825-36869847 TCTAAGAACCAGAGACATGACGG - Intronic
1039825477 8:41170225-41170247 TCCCAGAAGGAGAAAGAGGAAGG + Intergenic
1040350558 8:46562594-46562616 TTTTAGAAGCAGTGACATGAAGG - Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040992794 8:53369936-53369958 TGTTAGAAGGAAAAACAGAAAGG + Intergenic
1041094375 8:54334419-54334441 TCTTAAAACAATAAACAGGAAGG - Intergenic
1041387411 8:57319114-57319136 TCTTAGAGGCAGTTCCAGGATGG + Intergenic
1041526021 8:58806916-58806938 TATTAGATGCAGAAACAGATTGG - Exonic
1042363678 8:67911663-67911685 TTTTAGAAGCTGAGAGAGGATGG - Intergenic
1042661920 8:71163973-71163995 GCATAGAAGCAGTCACAGGATGG + Intergenic
1045043579 8:98251467-98251489 TCTTCGGAGTAGTAACAGGATGG + Intronic
1045108763 8:98919799-98919821 TCTTAGGAGCAGCAGCAGGTAGG + Intronic
1047223416 8:122937222-122937244 TCATGGAAGCAGAGTCAGGAAGG + Intronic
1049555793 8:143281343-143281365 TCTCAGAAGCAAAAACTGCAGGG + Intergenic
1049969056 9:805590-805612 TCTTAAAAAAAGAAAAAGGAAGG + Intergenic
1050241995 9:3646409-3646431 GCTCAGCAGCAGAAGCAGGAAGG - Intergenic
1051242336 9:15072367-15072389 TCTGGGAAGGAGAAATAGGATGG + Intergenic
1052066863 9:24032782-24032804 TCTTGGAAACAGAATAAGGAGGG + Intergenic
1053095537 9:35324655-35324677 TCTTAGATGTCAAAACAGGAGGG - Intronic
1053164996 9:35837961-35837983 TCTTAGACACAGGAAGAGGAAGG - Intronic
1055114209 9:72589661-72589683 TCTCAAAATCAGAAAAAGGATGG - Intronic
1055284903 9:74718309-74718331 TCTAAGTAGCAAAAAAAGGAGGG + Intergenic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055377449 9:75665166-75665188 TTCTAGGAGCAGAACCAGGAAGG - Intergenic
1055691968 9:78842215-78842237 TGTTAGAAGCAGAAAAAACATGG - Intergenic
1056622344 9:88224810-88224832 TCAAACAGGCAGAAACAGGATGG + Intergenic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1057446985 9:95123341-95123363 TTTAAAAAGCAGAAACAGGCTGG + Intronic
1057885690 9:98828000-98828022 TCTATGATGCAGAAACAGAAAGG - Intronic
1058575011 9:106391646-106391668 TGTTTGAAGCAGAAAGAGGTGGG + Intergenic
1058806902 9:108601598-108601620 TGTTACAAGCAGAAAAATGAAGG + Intergenic
1059421149 9:114193207-114193229 TCTTAGAAGGTGACACAGGGTGG + Intronic
1060431171 9:123552463-123552485 TGTTGGAAACAGAAACATGAGGG - Intronic
1061308787 9:129748920-129748942 TCATAAAAGCAGAGACAGGGGGG - Intronic
1061532307 9:131224312-131224334 TCTCAGAGACAGAAACAGGGTGG - Intronic
1062375460 9:136259952-136259974 GCTGAGATGCAGAAACAGGGAGG + Intergenic
1203734437 Un_GL000216v2:122423-122445 TATTATAGGCAGAAACAAGAAGG - Intergenic
1185802990 X:3030161-3030183 GCTTGGAAGCAGAGGCAGGAAGG + Intronic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186209815 X:7238428-7238450 AGTTAGCAGCAGCAACAGGATGG + Intronic
1186318590 X:8398964-8398986 TATAAGAAGCAAAAAGAGGACGG - Intergenic
1187439475 X:19305162-19305184 TCCTAGAAGCAGAAACCGGTCGG - Intergenic
1187961010 X:24566108-24566130 TCTTACCAGCAGTAACATGAAGG - Intronic
1188434498 X:30145525-30145547 TCACATAACCAGAAACAGGATGG + Intergenic
1188602610 X:31987481-31987503 TCATAGAAGCAGTAAATGGACGG - Intronic
1189105674 X:38232914-38232936 TCAAAGAAGCAGAATCAGTAGGG - Intronic
1189224338 X:39399982-39400004 ACATAGTAGCAGAAACAGGTTGG - Intergenic
1189254046 X:39623691-39623713 TCCTAAAGGGAGAAACAGGAAGG + Intergenic
1189670644 X:43404788-43404810 TAATAGAAGAACAAACAGGAAGG - Intergenic
1192206879 X:69102188-69102210 TCTTAGAGGCAGAAAGTGAAAGG - Intergenic
1193956490 X:87870414-87870436 TCAAATATGCAGAAACAGGAGGG + Intergenic
1194112327 X:89850162-89850184 TCTTATGGTCAGAAACAGGATGG - Intergenic
1194715173 X:97279616-97279638 TTTTAGAAACAGAGACTGGATGG - Intronic
1195614020 X:106898637-106898659 ACTTACAAACAGAAACAGAATGG + Intronic
1197228723 X:123980045-123980067 TTTGAGAAGCAGAAACAAAAAGG - Intronic
1197258454 X:124289858-124289880 TGTTTGAAGTATAAACAGGAAGG + Intronic
1197794958 X:130288652-130288674 TCTTAGAAAAAAAAAGAGGAAGG - Intergenic
1198000218 X:132426619-132426641 TCTTTGAAGAAGGAATAGGAAGG - Intronic
1198956637 X:142138856-142138878 TCACAGAAACAAAAACAGGATGG + Intergenic
1199098844 X:143774376-143774398 AATTTGAAGCAGGAACAGGAAGG + Intergenic
1199399312 X:147377978-147378000 GCTTACAAGCAGAAATAAGATGG - Intergenic
1200464983 Y:3504966-3504988 TCTTATGGTCAGAAACAGGATGG - Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic
1201534181 Y:15027644-15027666 TCTTAGGAGCAGATTAAGGAGGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic