ID: 1099251186

View in Genome Browser
Species Human (GRCh38)
Location 12:80256955-80256977
Sequence TAGCAAAACCAATTTAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099251186_1099251189 -3 Left 1099251186 12:80256955-80256977 CCAGAACTAAATTGGTTTTGCTA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1099251189 12:80256975-80256997 CTACAGCAGAGAGAGGGTAAAGG 0: 1
1: 0
2: 2
3: 29
4: 287
1099251186_1099251190 8 Left 1099251186 12:80256955-80256977 CCAGAACTAAATTGGTTTTGCTA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1099251190 12:80256986-80257008 AGAGGGTAAAGGAGAATGTCTGG 0: 1
1: 0
2: 0
3: 27
4: 331
1099251186_1099251193 29 Left 1099251186 12:80256955-80256977 CCAGAACTAAATTGGTTTTGCTA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1099251193 12:80257007-80257029 GGATGTAGGTAAGGATGAGAAGG 0: 1
1: 0
2: 1
3: 22
4: 388
1099251186_1099251192 20 Left 1099251186 12:80256955-80256977 CCAGAACTAAATTGGTTTTGCTA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1099251192 12:80256998-80257020 AGAATGTCTGGATGTAGGTAAGG 0: 1
1: 0
2: 1
3: 9
4: 242
1099251186_1099251191 15 Left 1099251186 12:80256955-80256977 CCAGAACTAAATTGGTTTTGCTA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1099251191 12:80256993-80257015 AAAGGAGAATGTCTGGATGTAGG 0: 1
1: 0
2: 2
3: 25
4: 388
1099251186_1099251187 -10 Left 1099251186 12:80256955-80256977 CCAGAACTAAATTGGTTTTGCTA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1099251187 12:80256968-80256990 GGTTTTGCTACAGCAGAGAGAGG 0: 1
1: 0
2: 3
3: 13
4: 163
1099251186_1099251188 -9 Left 1099251186 12:80256955-80256977 CCAGAACTAAATTGGTTTTGCTA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1099251188 12:80256969-80256991 GTTTTGCTACAGCAGAGAGAGGG 0: 1
1: 0
2: 2
3: 26
4: 247
1099251186_1099251194 30 Left 1099251186 12:80256955-80256977 CCAGAACTAAATTGGTTTTGCTA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1099251194 12:80257008-80257030 GATGTAGGTAAGGATGAGAAGGG 0: 1
1: 0
2: 1
3: 26
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099251186 Original CRISPR TAGCAAAACCAATTTAGTTC TGG (reversed) Intronic
901273645 1:7973484-7973506 TAGCAAAATCACTTAAGGTCAGG + Intronic
906131679 1:43462680-43462702 TGGGAAAAGCAAGTTAGTTCTGG - Intergenic
907544787 1:55250277-55250299 CAGCAGAGCCAATTTAGTACAGG - Intergenic
909002353 1:70233968-70233990 AAGGAACACCCATTTAGTTCAGG + Intronic
909285018 1:73805325-73805347 TAGCAAATTCAAATTATTTCAGG + Intergenic
909696163 1:78470260-78470282 TAGCCTAACCATTTTTGTTCTGG - Intronic
910755128 1:90681499-90681521 TAGGAAAAAAACTTTAGTTCTGG + Intergenic
911551849 1:99292196-99292218 TAGGAAAGCAAATTTAGTTGTGG + Intronic
911819644 1:102401012-102401034 TTGCAATACCAATTTTCTTCAGG + Intergenic
913224861 1:116690028-116690050 TGGCAAAATCATTTTACTTCTGG - Intergenic
913297984 1:117340349-117340371 TAGAAAAACAAATTAAGTACTGG - Intergenic
913507872 1:119534715-119534737 TAGCCAAACCAATTGACTCCAGG + Intergenic
916666490 1:166972516-166972538 TAACAAAACCAATATATTACAGG + Intronic
916704909 1:167339261-167339283 TTGCAAATCCAATGAAGTTCAGG - Intronic
919721564 1:200842640-200842662 TAGCAAAACCAATTTTCTCTTGG + Intronic
923809264 1:237294379-237294401 TAGCAAATCAATTTTATTTCAGG - Intronic
1063149978 10:3328007-3328029 GAGCAAAAGCAATTTAGTGGAGG - Intergenic
1064516556 10:16155479-16155501 GCCCAAAACTAATTTAGTTCTGG - Intergenic
1065619816 10:27569490-27569512 TTGCAAAATCGATTTAGTTAAGG - Intergenic
1067982854 10:51106708-51106730 TAGAAAAACAAATTAAGTTGTGG + Intronic
1072259938 10:93660074-93660096 TAGTTAAACCCATTTAATTCTGG - Intronic
1079913096 11:26335002-26335024 TATCAAAACCAATTTTGATCGGG - Intronic
1086197973 11:84164873-84164895 TAGAAAATCAAATTTAGTTTAGG - Intronic
1086873358 11:92066018-92066040 TAGCAAAACCAGTTCAGGTAAGG + Intergenic
1088940665 11:114452418-114452440 AAGCAAAACCAGTCTAGTGCAGG + Intergenic
1093069405 12:14693008-14693030 TAGAAAAATCACTTGAGTTCTGG - Intronic
1093609977 12:21143406-21143428 TAGTAAAACAAATGTAATTCAGG + Intronic
1094407799 12:30137069-30137091 TAGCAATACCAATATAATACAGG + Intergenic
1095213814 12:39525804-39525826 TAGAAAAACTATTTTGGTTCTGG + Intergenic
1096564257 12:52463755-52463777 TAGAAAAACAAATTTAGATACGG + Intergenic
1099072372 12:78061422-78061444 AAGCTGAACCAATTTATTTCAGG - Intronic
1099251186 12:80256955-80256977 TAGCAAAACCAATTTAGTTCTGG - Intronic
1100887097 12:99083766-99083788 TATAAAAACAAATTTGGTTCAGG - Intronic
1103145391 12:118590856-118590878 CAGCAAAAGCAATTTATTCCAGG - Intergenic
1104107639 12:125679341-125679363 TAGCACAAGCAATTGAGATCTGG + Intergenic
1105558149 13:21465250-21465272 TAGCAAGGCCAGTTTGGTTCAGG - Intergenic
1106636370 13:31533028-31533050 TTACAAAACTAATTTAGTTTTGG - Intergenic
1107120428 13:36789594-36789616 TGGGAAAACCTATCTAGTTCTGG + Intergenic
1108430929 13:50352890-50352912 TAGCAAAACAAATTCAGGTCAGG + Intronic
1109791245 13:67250753-67250775 AAGCAAATCAAATCTAGTTCTGG + Intergenic
1111359760 13:87160927-87160949 TTGAAAAACCATTTTTGTTCAGG + Intergenic
1111465427 13:88602483-88602505 TAGCAAACCATATTTAATTCTGG + Intergenic
1113110998 13:106823593-106823615 TGGGAAAATGAATTTAGTTCTGG + Intergenic
1115254676 14:31386757-31386779 TACTATAACCAATTTAGTTCAGG + Intronic
1116304508 14:43233307-43233329 AAGCAAAACCAATTTATATTTGG + Intergenic
1116697328 14:48193578-48193600 TAGAAAAAAAAATTTATTTCAGG + Intergenic
1117210069 14:53487907-53487929 TAGCCAAACCAATATGGTACTGG + Intergenic
1118375164 14:65170585-65170607 TAGAACAACCAGATTAGTTCAGG - Intergenic
1119142295 14:72278265-72278287 TATCAAAACCAAATTGTTTCTGG - Intronic
1119188923 14:72665578-72665600 TAGCAAAAGCCATTCAGTTCAGG - Intronic
1121751378 14:96360614-96360636 TAGAAAAACTAATTGAGATCAGG + Intronic
1122384644 14:101335672-101335694 TAGCAACCCCAAATTAGTTTAGG - Intergenic
1124039112 15:26083755-26083777 TTGCAAAACCAGTATGGTTCTGG + Intergenic
1124898367 15:33798683-33798705 TAACAAACCCCATTTTGTTCAGG - Intronic
1127046816 15:55034693-55034715 TAGCAACACCCAATTTGTTCCGG + Intergenic
1131859897 15:96641368-96641390 TAACAAAGCCAACTTACTTCTGG - Intergenic
1132440218 15:101855710-101855732 AAGCAAAACAAATTTAATACTGG + Intergenic
1133540684 16:6750193-6750215 TAGCAAAACCTATTGAATTGTGG + Intronic
1135511205 16:23085188-23085210 CAGAAAAATCAAGTTAGTTCTGG - Intronic
1143574457 17:7782477-7782499 AAGCAAAAGCAAATTATTTCTGG + Intronic
1149795969 17:59520246-59520268 AAGCCAAACCAATTGAGTTGGGG - Intergenic
1153365197 18:4247989-4248011 AAGCAAAACCATTTTAATTTTGG + Intronic
1154467272 18:14658999-14659021 TGGCAAGACCAATTTAGCTGTGG - Intergenic
1154988220 18:21575132-21575154 TATCAAAAGAAATTTAATTCAGG + Exonic
1155348364 18:24881238-24881260 CAGCAAATCCAATGCAGTTCGGG + Intergenic
1161369447 19:3902356-3902378 AAGCAAAACACATTTAGTTCTGG - Intronic
1162251751 19:9450497-9450519 TAGAAAACTCAATTCAGTTCTGG + Intergenic
926505709 2:13712736-13712758 TTGCAGAAACAGTTTAGTTCAGG + Intergenic
927474739 2:23404122-23404144 AAGCAAAACGCATTTCGTTCTGG - Intronic
930996471 2:57725249-57725271 TAGCAAAACAAATTTTATACAGG - Intergenic
931330869 2:61281973-61281995 AAACAAAACAAAATTAGTTCTGG - Intronic
932536876 2:72606993-72607015 TGACAAAACAAATTTATTTCAGG + Intronic
933264989 2:80172160-80172182 TAGCCAAATCATTTTAGTGCAGG - Intronic
935877090 2:107521177-107521199 TAGCAGGACCAAATTCGTTCTGG - Intergenic
936944949 2:117921733-117921755 TAGCAAAACCAAGGTCGTTGTGG - Intronic
939298932 2:140307261-140307283 TAGCAAAACCTATTGTGTACAGG + Intronic
939771566 2:146326442-146326464 TAGCAAAAGCAAATTAGCTCAGG - Intergenic
944368087 2:198948217-198948239 GATCAAAACCAATATTGTTCAGG - Intergenic
945080547 2:206084276-206084298 TAGCAAAACTACTTTGGTTTTGG - Intronic
945600689 2:211860081-211860103 TGTCAAAATCAATTTAATTCTGG + Intronic
947775653 2:232707066-232707088 TAGCAAAACCAAAATATTTTAGG - Intronic
1170679818 20:18516440-18516462 TAATAAAAACAGTTTAGTTCTGG - Intronic
1171230599 20:23481048-23481070 TAGCAAAACCAATCAATTGCTGG + Intergenic
1173636199 20:44560490-44560512 TACCAAAGCCATTTTTGTTCTGG + Intronic
1175633969 20:60565242-60565264 AAGCAACTCCAATTTAGTCCAGG - Intergenic
1176225264 20:63994451-63994473 TAGAAAAATCAATTTAGGCCGGG - Intronic
1177272524 21:18868100-18868122 TATCAAATCCATTTGAGTTCAGG + Intergenic
1182140920 22:27957347-27957369 GAGCAAAACACATTTACTTCTGG - Intergenic
1183558914 22:38554263-38554285 CAGCAAAAGCAAATTCGTTCTGG + Intronic
1184400619 22:44271721-44271743 CCAAAAAACCAATTTAGTTCAGG - Intronic
954080299 3:48209621-48209643 TGGCAACACCAATCTAGTTCAGG - Intergenic
957721574 3:84008244-84008266 TAGCAAAACCAATTTATATTTGG + Intergenic
958670122 3:97192948-97192970 TAGCAGTACGAATTTATTTCTGG + Intronic
958803916 3:98786599-98786621 TAGAGAAACCAATGTAGTCCAGG + Intronic
961186834 3:124922464-124922486 TAGCACAACCATTTTAATTTTGG + Intronic
962483160 3:135815461-135815483 TAACAGAACCAGTTTTGTTCAGG - Intergenic
967734708 3:192939907-192939929 TAAAAAATCCAATTTAGTTCAGG + Intergenic
971003626 4:22350440-22350462 TAGCAAAAGCATTTAAGTCCTGG + Intronic
971576532 4:28281519-28281541 TAACATAACCATTTTAGGTCAGG - Intergenic
971841656 4:31860387-31860409 TAGCAAAATCAACTTAATGCTGG + Intergenic
974468459 4:62288349-62288371 TAGCAAAATCAGTTTAGCTCAGG - Intergenic
976901909 4:90188493-90188515 TATCAAAACCAATTATTTTCTGG + Intronic
976942833 4:90727431-90727453 TAACAACATCAATTTTGTTCAGG - Intronic
977035699 4:91950225-91950247 TAGGAAAACCAATTGAGCCCAGG + Intergenic
978700083 4:111632442-111632464 GAGCAAAACCAATTTACTCTTGG + Intergenic
981776855 4:148378403-148378425 TATCCAAACCAATTCAGTGCAGG - Intronic
982637757 4:157918543-157918565 TTGCAAAATCTATTTATTTCTGG + Intergenic
982766051 4:159349889-159349911 TATCAAAAGCAATATATTTCTGG + Intronic
983060745 4:163156670-163156692 TAACAATATCAATTTATTTCTGG + Intronic
984493511 4:180467243-180467265 TAGTAATATCAAATTAGTTCTGG - Intergenic
985822483 5:2169766-2169788 TAACAAAACCTATTCATTTCAGG - Intergenic
985973542 5:3395913-3395935 TATCAAAAACAACTTAGATCAGG - Intergenic
986993100 5:13576731-13576753 TAACAAAACCAATTTGTATCTGG - Intergenic
987490485 5:18574942-18574964 TAGCAAAACCAGCTAAATTCAGG - Intergenic
988111232 5:26823441-26823463 GATCAAAACCAATTTATTTTTGG - Intergenic
989616141 5:43338563-43338585 TAGCAATTACAATATAGTTCAGG + Intergenic
991064908 5:62414512-62414534 TGGCAAAACACATTTAGTGCTGG + Intronic
994579721 5:101625620-101625642 TAGCAACACCAATTAAATTAAGG + Intergenic
996551627 5:124736407-124736429 TAGCCAGACCAGTTTACTTCTGG - Intronic
996784571 5:127224525-127224547 TAAGAACACCAATTTTGTTCAGG + Intergenic
996802009 5:127414768-127414790 TGGCAAAACAGATTTAATTCTGG + Intronic
998992293 5:147831291-147831313 GAGGAAAACCATTTTATTTCTGG + Intronic
1001292751 5:170475781-170475803 TAACAGACCCAATTTTGTTCAGG + Intronic
1004269629 6:14182621-14182643 AAGCAAAATCACTTTAGTACAGG + Intergenic
1007171483 6:39867012-39867034 CATTAAAACCCATTTAGTTCAGG - Intronic
1008131348 6:47723357-47723379 AAGCTACACCAATTTACTTCTGG - Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1009771805 6:68153119-68153141 TAGCAAATGCAATTAAGTTAAGG - Intergenic
1009830393 6:68923212-68923234 TAGAAATACCAAAGTAGTTCTGG - Intronic
1015177735 6:130329320-130329342 TAGCAAAACCACATTCATTCTGG + Intronic
1017471919 6:154746760-154746782 TAGCAAAACCACTTTAAGTGGGG - Intronic
1018498401 6:164375191-164375213 CAGCAAAAGCAATTTAGCCCAGG + Intergenic
1022159400 7:27693710-27693732 TAGAAAAACCAGTTTGGCTCTGG - Intergenic
1022885662 7:34640755-34640777 TAGCAAAACCAACTCATCTCAGG + Intergenic
1033855099 7:145551726-145551748 AAGCAATACAACTTTAGTTCTGG - Intergenic
1034137511 7:148784747-148784769 TATCAAAACCAATATAATTTTGG - Intronic
1039131565 8:34270602-34270624 AAACAAAACAAATTTAGTTTTGG + Intergenic
1041024244 8:53667727-53667749 TAGCAAAGTCCATTGAGTTCAGG + Intergenic
1041494963 8:58475952-58475974 TAGCCAAAACAATATAGTACTGG - Intergenic
1042492321 8:69413742-69413764 TAGCAGAACTAATTGAGCTCGGG + Intergenic
1047924965 8:129673876-129673898 TAGCAAAACTGAATTATTTCAGG + Intergenic
1050330665 9:4542113-4542135 TAGAAATACCAATCTAGTGCTGG - Intronic
1052196527 9:25723055-25723077 GAGCACAACCAAATTATTTCAGG - Intergenic
1053052115 9:34970764-34970786 TCCTAAAACCAATTTAGTCCAGG - Intronic
1053589897 9:39501786-39501808 AATCAAAACCAATATATTTCTGG + Intergenic
1054576403 9:66863521-66863543 AATCAAAACCAATATATTTCTGG - Intronic
1055108982 9:72541025-72541047 TGGAAAAAACAATTCAGTTCAGG - Intronic
1058015030 9:100021553-100021575 AAGCAAAAACAATTGAGTTTGGG - Intronic
1059502080 9:114763571-114763593 TAGCTAAAACAATTTAATTCTGG - Intergenic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1188426194 X:30049778-30049800 AAGAAAAACCAATTAACTTCTGG + Intergenic
1188486346 X:30686313-30686335 TAGTAAAACAGATTTAGTTATGG - Intronic
1188793652 X:34436542-34436564 TGGCAAAACCAAATGAGTTTTGG - Intergenic
1189133084 X:38520581-38520603 TGGCAAATACAATTTAGTACAGG - Intronic