ID: 1099256963

View in Genome Browser
Species Human (GRCh38)
Location 12:80326098-80326120
Sequence CCTCAAGTACTGCAGGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099256963_1099256967 -1 Left 1099256963 12:80326098-80326120 CCTTATACCTGCAGTACTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1099256967 12:80326120-80326142 GAAGGACTCAAATACTGAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 127
1099256963_1099256968 0 Left 1099256963 12:80326098-80326120 CCTTATACCTGCAGTACTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1099256968 12:80326121-80326143 AAGGACTCAAATACTGAGCTGGG 0: 1
1: 0
2: 0
3: 16
4: 196
1099256963_1099256969 1 Left 1099256963 12:80326098-80326120 CCTTATACCTGCAGTACTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1099256969 12:80326122-80326144 AGGACTCAAATACTGAGCTGGGG 0: 1
1: 0
2: 0
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099256963 Original CRISPR CCTCAAGTACTGCAGGTATA AGG (reversed) Intronic
900476139 1:2877259-2877281 CCAAAAATACTGCAGGAATAGGG - Intergenic
903043491 1:20549617-20549639 TCTCAAGTATTGCATGTATCTGG - Intergenic
906862489 1:49376506-49376528 CCCCAAATACTGAAGGGATAAGG - Intronic
907746272 1:57216829-57216851 CGTCAAGTAGTGTAGGTCTATGG - Intronic
912449362 1:109759828-109759850 CATCAAGTGCTGCAGGGAGAGGG + Exonic
915016397 1:152737908-152737930 CCTCCAGTACTGCTTGTATGAGG - Intronic
919416271 1:197314136-197314158 CCTCTGGTACTGCAATTATATGG + Intronic
920261727 1:204692912-204692934 CCTCAGGTTCTGCAAGTACAGGG - Intergenic
921521662 1:216163435-216163457 CCTCAAGTAATTCAGATATATGG - Intronic
922462941 1:225826979-225827001 CCTACAGAACTGCAGGAATAAGG + Intronic
1064475560 10:15684630-15684652 CCTCAAGTGCTGGAAATATAGGG + Intronic
1070944428 10:80377271-80377293 CCTCATGGGCTGCAGGCATATGG - Intergenic
1071143930 10:82544943-82544965 CCTCGATTGCTGCAGATATAGGG - Intronic
1075367326 10:121903735-121903757 CTCCAAATACTGCAGGTATTTGG + Intronic
1075544881 10:123347559-123347581 CTTCTAGTGCTGCAGGTATCTGG + Intergenic
1079614782 11:22478805-22478827 CCCCAAATACTGCAAATATAAGG - Intergenic
1086917822 11:92551172-92551194 CCTCAATTACAGCAGGTATCTGG + Intronic
1087202174 11:95356850-95356872 CCTCTAGGAATGCAGGTACATGG - Intergenic
1092975215 12:13738177-13738199 TCTGAAGTACTGCAGATAAAAGG - Intronic
1093079616 12:14794611-14794633 CCTCAAGTCGTGCAGATGTATGG - Exonic
1093213538 12:16335668-16335690 CCTAAAGTACTGTTGGTAAAGGG + Intergenic
1093335042 12:17894630-17894652 CCTCTAGTGATGCAGTTATAAGG - Intergenic
1093369884 12:18354228-18354250 CCTCAAGTCCTGTAGGTAGAAGG + Intronic
1095462496 12:42457311-42457333 CCTGAAGAAATGCAGGTATAAGG - Exonic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1102709627 12:114914743-114914765 CCTCAAGCCCTGCAGATACAAGG - Intergenic
1106347366 13:28892140-28892162 CCTCAAGGAGTCCAGGAATATGG - Intronic
1114751919 14:25214242-25214264 CCTTAAGCACTGCAGGAATCTGG - Intergenic
1124553190 15:30701325-30701347 CCTTAAGTACTGCCTGTATCAGG - Intronic
1124678051 15:31704346-31704368 CCTTAAGTACTGCCTGTATCAGG + Intronic
1125958142 15:43805368-43805390 CCTAAAGTCATGCAGGTATGGGG - Exonic
1126001418 15:44213812-44213834 CCACATCTACTGCAGGTATTTGG - Intergenic
1128354001 15:66911656-66911678 CCTCACTCACTGCAGGTCTAGGG - Intergenic
1130131748 15:81149389-81149411 CATCAAGTACTGCAGGATTTAGG + Intergenic
1131216286 15:90538421-90538443 AATCAAATACAGCAGGTATAAGG + Intronic
1146295207 17:31644492-31644514 CCCAAAGTGCTGCAGTTATAGGG - Intergenic
1148186999 17:45651363-45651385 CCTCAAGAACTCAAGGTCTAGGG - Intergenic
1149614001 17:57982714-57982736 CCACAAACACTGCAAGTATAGGG + Exonic
1156012641 18:32512471-32512493 CCTCAAGTCGTGCAGATGTATGG + Intergenic
1157782884 18:50455943-50455965 CCTCAAGTATTGGAGGGAGATGG + Intergenic
1163839158 19:19595343-19595365 CCCCAAGTACTGCAGGCTGAGGG - Intronic
925019921 2:560365-560387 CCTCAGGTACTGCAAGGAGAAGG - Intergenic
925571181 2:5314242-5314264 CCGCAAGTACTGAAGGTGTTGGG + Intergenic
928673458 2:33626309-33626331 CCTTTAGTGATGCAGGTATAAGG - Intergenic
931621958 2:64219424-64219446 CCTCAAGGATTCCAGGTATCTGG + Intergenic
940620731 2:156109855-156109877 CATCAAATACTGGGGGTATATGG + Intergenic
943114019 2:183643894-183643916 CTTCAAGTTCTGCAGGCATAAGG - Intergenic
943466086 2:188230857-188230879 CCTCTAGTACTGCTGGGTTAGGG - Intergenic
1170539843 20:17376428-17376450 CCTCAAGTACTGTAGGAGGATGG - Intronic
1172752171 20:37258552-37258574 CCTCCAGCTCTGCAGGTACAGGG - Intronic
1175992118 20:62794717-62794739 CCACAATTACTGCAGGCATAGGG - Intergenic
1176205840 20:63887693-63887715 CCTCAATTAATCCAGGAATATGG - Intronic
1182444842 22:30384098-30384120 CCTCATGTTCTGCAGGCATTGGG - Intronic
1185285171 22:49996852-49996874 CCTCCAGCCCTGCAGGCATAAGG + Exonic
1185394540 22:50579966-50579988 ACTCAAGAACAGCAGGTATGTGG - Exonic
949196066 3:1309511-1309533 CCTCAATTACTGTAGCTTTACGG + Intronic
951723789 3:25732375-25732397 CCCCAAGTTCTCCAGGTTTAGGG + Exonic
952190109 3:31014157-31014179 CCTCATGGACTGCAGTTAAATGG - Intergenic
959483901 3:106906415-106906437 CGTCTAGAAGTGCAGGTATAGGG - Intergenic
961434274 3:126905881-126905903 CTTCAAGAACTGCAGGAATCAGG + Intronic
962033056 3:131621598-131621620 CCTCAGATACTGCAGGTTTTAGG + Intronic
963254501 3:143131299-143131321 CCTTAAGTAATGCAGATAAATGG + Intergenic
964957898 3:162383781-162383803 CCTCAATTTCTGCTGGTACAGGG - Intergenic
967754712 3:193156284-193156306 CCACAAACACTGCAAGTATAGGG + Intergenic
976541859 4:86286726-86286748 CCTCAAGTACTTCAGGAATGAGG + Intronic
977715962 4:100184444-100184466 CCTCAAATACCACAGGTAGAGGG + Intergenic
984955843 4:185044816-185044838 CCTCTAGTGCTGCTGGTTTATGG - Intergenic
991590947 5:68250817-68250839 CCTCAAGTAGTGCTGGTTTTAGG - Intronic
993406765 5:87520329-87520351 CCTCTAGCACTGCTGGTTTAGGG + Intergenic
1003207271 6:4024241-4024263 GCTCAAGTGCTGCAGGTACTAGG + Intronic
1006093346 6:31641146-31641168 CCCCAAGCAGTGCAGGTTTAGGG + Exonic
1006610698 6:35292652-35292674 CCGCAGGTGCTGCAGGTGTAGGG - Exonic
1008877088 6:56340956-56340978 CCCCTAGTACTGTAGGCATAAGG - Intronic
1013568135 6:111390660-111390682 CCTCAACTACTGCTGAGATAGGG + Intronic
1019443137 7:1057416-1057438 CCAGAAGTGCTGCAGGTACAGGG - Intronic
1022041513 7:26586291-26586313 CCTCAAGAACTGCGGGTGTTAGG + Intergenic
1023119968 7:36899313-36899335 CCTCAACTAGAGCAGGAATAAGG - Intronic
1023297663 7:38732708-38732730 CCTCACGTAATGCTGGTATTAGG + Intronic
1030245802 7:107383646-107383668 CCTCACGTACCCCAGGTATCTGG + Intronic
1034942938 7:155243701-155243723 CCTCTAGTACTGCTGGGTTAGGG - Intergenic
1048624542 8:136170887-136170909 TCTTAATTACTGCAGCTATATGG + Intergenic
1049452188 8:142668100-142668122 CCTCAAGTACTGCTGGCCTGCGG - Intronic
1051707923 9:19900014-19900036 CCTCAAGTAGTGAAGGTTCAGGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1060817986 9:126645390-126645412 CCTGAAGTACAGCAGGGATTTGG - Intronic
1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG + Intronic
1185909811 X:3971113-3971135 CCTGAAGGACTGTGGGTATAAGG + Intergenic
1185999633 X:4993963-4993985 ACTCAAGTTCTGCAGGAACATGG + Intergenic
1186161166 X:6778567-6778589 CCTCAAGTACTGCATCAAAAGGG - Intergenic
1188523923 X:31070050-31070072 CTTCAAGCACAGCAGGTAAATGG - Intergenic
1191714462 X:64184783-64184805 CCTCAATTTCTGCAAGTATGTGG - Intergenic
1194675050 X:96784431-96784453 CCTAAAGTACTGAAGCTAAAGGG - Intronic
1195675556 X:107504813-107504835 ACTCAAGGACTGCAGGTGTCTGG - Intergenic
1195813872 X:108864062-108864084 CCTCAAGAACAGCAGCTAGATGG - Intergenic
1197962499 X:132022630-132022652 CCACAAGTTCTGCACGTGTAAGG - Intergenic
1198376232 X:136042597-136042619 CCTCGAGGACTGCAGGTAGGAGG - Intronic
1200948073 Y:8865681-8865703 CCTGGAGGACTGTAGGTATAAGG + Intergenic