ID: 1099256967

View in Genome Browser
Species Human (GRCh38)
Location 12:80326120-80326142
Sequence GAAGGACTCAAATACTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099256963_1099256967 -1 Left 1099256963 12:80326098-80326120 CCTTATACCTGCAGTACTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1099256967 12:80326120-80326142 GAAGGACTCAAATACTGAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 127
1099256962_1099256967 20 Left 1099256962 12:80326077-80326099 CCAAAGTGGCTAATTATTGCTCC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1099256967 12:80326120-80326142 GAAGGACTCAAATACTGAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 127
1099256966_1099256967 -8 Left 1099256966 12:80326105-80326127 CCTGCAGTACTTGAGGAAGGACT 0: 1
1: 1
2: 3
3: 7
4: 119
Right 1099256967 12:80326120-80326142 GAAGGACTCAAATACTGAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099256967 Original CRISPR GAAGGACTCAAATACTGAGC TGG Intronic
901321594 1:8343463-8343485 GAAGAGCTCAAGTGCTGAGCGGG + Intronic
905312641 1:37060806-37060828 GATGGTGTCATATACTGAGCTGG - Intergenic
907230846 1:52996823-52996845 GAATGACTCAAACACTGATGTGG - Intronic
913612763 1:120524307-120524329 GAAGGACACACAAAATGAGCAGG + Intergenic
914578428 1:148997940-148997962 GAAGGACACACAAAATGAGCAGG - Intronic
916473789 1:165149003-165149025 GAAGGACACAAATAATCAGAGGG + Intergenic
916589589 1:166177367-166177389 GAAGGACTGGGATACTAAGCAGG - Intergenic
917271191 1:173276417-173276439 GAAGGACTCAAACACTATGATGG + Intergenic
920543326 1:206795519-206795541 GAAGGAGTCAAATGGTGAGTTGG - Intergenic
924017499 1:239743560-239743582 GAAGAACTGAAATACTCATCTGG - Intronic
1064462229 10:15546240-15546262 GAGGGAATCAGAAACTGAGCAGG - Intronic
1065851855 10:29796985-29797007 GCAGGACCCAAAGACTGGGCAGG - Intergenic
1072365131 10:94701706-94701728 GAAGGACTCAAACACTATGATGG + Intronic
1073599604 10:104833827-104833849 GGAGAAGTCAAACACTGAGCTGG - Intronic
1074121965 10:110499377-110499399 AAAGGACTCAAACACAAAGCAGG - Intronic
1079333273 11:19550718-19550740 GCAGGACTCAACTCCTGAGATGG + Intronic
1080986833 11:37477752-37477774 GAAGGTTTAATATACTGAGCTGG + Intergenic
1086173990 11:83868198-83868220 GAAGGACTCAAAAAGTTTGCAGG - Intronic
1087686400 11:101270510-101270532 GAATAACTCAAATATTGTGCAGG + Intergenic
1088026760 11:105194492-105194514 AAAGGAATCAAATGCTGAGTTGG + Intergenic
1088479231 11:110278753-110278775 GAATGACTTAAAGACTCAGCAGG - Intronic
1091138568 11:133215937-133215959 GAAGGAATCCAATAGTGAGGAGG - Intronic
1091971397 12:4789922-4789944 GAAAGAGTAAAATAATGAGCCGG + Intronic
1092759577 12:11797505-11797527 GAAGGACTGGAAGACAGAGCTGG + Intronic
1092865713 12:12759061-12759083 GGAGGACTCACATCCTGTGCGGG + Intronic
1093789378 12:23229814-23229836 GAAGGACTCAAATTTTAAGAAGG + Intergenic
1097140068 12:56894515-56894537 AAAAGACTCAAATACTGACTTGG + Intergenic
1098403047 12:70094037-70094059 GAAGGAAACAAACATTGAGCTGG + Intergenic
1099256967 12:80326120-80326142 GAAGGACTCAAATACTGAGCTGG + Intronic
1100528949 12:95446764-95446786 GAAGCTCCCAAACACTGAGCTGG - Intergenic
1102466051 12:113131390-113131412 GAGGAACTCAAATGCTGGGCCGG + Intronic
1102574945 12:113850282-113850304 GTAGGCCTCAAATTCTGAGTAGG - Intronic
1105909702 13:24851707-24851729 GAAGGAATCTATTTCTGAGCTGG - Intronic
1107365250 13:39665766-39665788 GATGTACCCAACTACTGAGCAGG - Intronic
1117007307 14:51434420-51434442 GAAGTACTCAAAAACTGATGGGG + Intergenic
1117272834 14:54162713-54162735 GAAGGACTAAAAAGCTGAGAAGG + Intergenic
1117342472 14:54804171-54804193 GAAGGACTCACAGACAGGGCTGG + Intergenic
1120359765 14:83484173-83484195 AAACTACTCAAATACTGAGCTGG + Intergenic
1120708824 14:87772313-87772335 GAAGGACTCACATCCTGGACAGG - Intergenic
1121008464 14:90505428-90505450 GCAGGACTCACATACTTAGATGG - Intergenic
1122409897 14:101520545-101520567 GAAGGACTCAGAAACTGTGAAGG + Intergenic
1124047032 15:26159989-26160011 GCAGGATTCAAAGACTGAGAAGG + Intergenic
1124963558 15:34416494-34416516 GAAGGACTAAAAGACTGACTGGG + Intronic
1124980177 15:34562720-34562742 GAAGGACTAAAAGACTGACTGGG + Intronic
1127830211 15:62743789-62743811 GAAGGACTCCAGAACTGAGAAGG + Intronic
1135889917 16:26347800-26347822 GAAGGTGGCCAATACTGAGCAGG + Intergenic
1138320348 16:56106017-56106039 TAAAGACTCAAATCCTCAGCAGG - Intergenic
1138985920 16:62328395-62328417 AAAGGAATAAAATACTGTGCTGG - Intergenic
1140856102 16:78979066-78979088 AAAAGACTGAAATTCTGAGCAGG - Intronic
1142366263 16:89651583-89651605 GAAGGACTCCAAGGCGGAGCAGG - Exonic
1146426695 17:32746946-32746968 GAATGACGCAAATGCAGAGCTGG - Intronic
1150891126 17:69151282-69151304 GTAGGACTTTAAGACTGAGCAGG - Intronic
1151170618 17:72242635-72242657 GAAGGACACGAATAGTAAGCAGG - Intergenic
1152665975 17:81569745-81569767 GAAGGACTGAAGGACTTAGCTGG - Intronic
1154097166 18:11429430-11429452 GAAGAACTTAAATATTGAGTAGG + Intergenic
1155653264 18:28166388-28166410 GAAGGCCTCAAATAAAGAGAAGG + Intronic
1155790208 18:29957888-29957910 GCATCACTCAAATGCTGAGCTGG - Intergenic
1156388572 18:36628895-36628917 GAAGGACTGACACACAGAGCAGG - Intronic
1164093092 19:21978201-21978223 GCAGAGCTCAAATGCTGAGCTGG - Intronic
927116075 2:19903305-19903327 GAATGACTCAAACACTGATGTGG + Intergenic
927257882 2:21056215-21056237 GAAGCACTCAGACACTGGGCAGG - Intergenic
931951697 2:67370789-67370811 GAAAGAATAAAATACTCAGCTGG - Intergenic
932673549 2:73758479-73758501 GAATGACCCAAATCCTCAGCAGG - Intergenic
940986750 2:160058704-160058726 GAAGGGCTCAGATTCTGATCAGG + Intronic
941594619 2:167460374-167460396 GAAGGAGTCAAAGGCAGAGCAGG - Intergenic
942246830 2:174015746-174015768 GAAGGACCCAAATACTATCCAGG + Intergenic
942688068 2:178555095-178555117 GAAGTTGTCAAATACAGAGCAGG - Exonic
943108767 2:183580208-183580230 GAAGGGCTAGAATACTAAGCAGG - Intergenic
943623745 2:190177821-190177843 ACAGGAAACAAATACTGAGCTGG - Intronic
944953526 2:204780186-204780208 TAAGAACTCAAATCCTTAGCAGG - Intronic
1173132414 20:40407183-40407205 GAAGGACTGAGATACTGATGAGG + Intergenic
1175627946 20:60504595-60504617 GAAGGAATCAGAAACTGGGCAGG + Intergenic
1181459186 22:23076241-23076263 GAATGAATCAAATAGGGAGCAGG - Intronic
1182340702 22:29618372-29618394 GAAGGACTCAATTTCAGAACCGG + Intronic
1183839802 22:40489608-40489630 AAAGGACTCAAATTATGGGCTGG - Intronic
1183972777 22:41490774-41490796 GCAGGATTAAAATACAGAGCAGG - Intronic
1184491651 22:44812995-44813017 GAAGCACTCAAAGAGTGAGGGGG - Intronic
951977527 3:28529516-28529538 GAAGAAGTCAAATCCTGAACAGG - Intronic
954962112 3:54575822-54575844 GAAGGAGTCAACAACTGAGGAGG + Intronic
962454158 3:135549781-135549803 TAAGGACTGAAATTCTGAGCCGG - Intergenic
964894435 3:161578491-161578513 GAAGGACTGAAATCAGGAGCTGG + Intergenic
964932439 3:162043403-162043425 CAAGAACTCAAATCCTGGGCTGG - Intergenic
965431347 3:168593155-168593177 CAAGTATTCAAAAACTGAGCAGG - Intergenic
965608863 3:170524100-170524122 GAAGGCCTCAATTACTGGGCAGG + Intronic
967094270 3:186163827-186163849 CCAGGACTCTAATACTGAGGAGG - Intronic
970714778 4:18908387-18908409 GCAGAACTCAAACACTGTGCTGG - Intergenic
971059249 4:22948840-22948862 AAAGGACTATAATACTAAGCAGG + Intergenic
971383126 4:26118162-26118184 CAAGGTTTCAGATACTGAGCTGG + Intergenic
973772775 4:54221965-54221987 CAAGGACTCTATTACTGAGAAGG + Intronic
977166124 4:93700192-93700214 AAATGACTCTAATACAGAGCAGG + Intronic
977760438 4:100729487-100729509 GAACGACTCACATACTGGACAGG - Intronic
983081813 4:163395107-163395129 GAAGGATTCACTTCCTGAGCAGG + Intergenic
983481323 4:168277925-168277947 GAAGGATTCATGTCCTGAGCAGG - Intronic
983510567 4:168605591-168605613 GAATGACTCACAGACTGGGCAGG + Intronic
985772159 5:1818918-1818940 GAAGAACTCACATTCTGAGCAGG - Intergenic
986207655 5:5640667-5640689 GAAGGACTAAAATCCTGGGAGGG - Intergenic
989738635 5:44740830-44740852 GAAGTAATCTAATACTGAGAGGG + Intergenic
991615552 5:68493623-68493645 GAACCACTCAAATACTGGGTAGG + Intergenic
996160218 5:120152668-120152690 GAATGATTCACATCCTGAGCAGG - Intergenic
996987444 5:129584408-129584430 GAAGAGCTCAAACACTGTGCTGG + Intronic
997849781 5:137321069-137321091 GAAGAACACAAAAACTGAGTTGG + Intronic
999633720 5:153598553-153598575 GAAGGACTCAGATCCTAAGGTGG + Intronic
1001532892 5:172477026-172477048 GAAGGGCTCAAAGACTGATGTGG + Intergenic
1003821488 6:9902420-9902442 GAAGGACTCAAATGTTTAACTGG + Intronic
1006348111 6:33499509-33499531 GAAGGACTCAAAGATGGAGATGG - Intergenic
1016681386 6:146833290-146833312 GAAGGACTCACATTCTAAGCAGG - Intergenic
1016973005 6:149782588-149782610 GAAGTACTCAAAGGCTGAGGAGG + Intronic
1019964929 7:4490907-4490929 GAAAGACCCAAATACTAGGCCGG + Intergenic
1021854718 7:24843126-24843148 GGAGGACTTAAGTCCTGAGCTGG + Intronic
1022601967 7:31769446-31769468 GAAAGACTCAAATTCTTAGATGG - Intronic
1023931183 7:44707623-44707645 GAAGTACCCCAATGCTGAGCTGG + Exonic
1028805983 7:95026595-95026617 GTGGAACTCAAATACTGTGCTGG + Intronic
1030918827 7:115353502-115353524 GAAGGAGTAAAATTCTGGGCTGG + Intergenic
1034517021 7:151589083-151589105 GAGGGACTCAAAGCCAGAGCAGG + Intronic
1036007798 8:4686852-4686874 GAAGGAGGCAAACCCTGAGCAGG + Intronic
1037750429 8:21678706-21678728 GAGGGACCCAAAGACTGAGCTGG + Intergenic
1039099091 8:33921758-33921780 GCAGTCCACAAATACTGAGCTGG - Intergenic
1039342235 8:36663720-36663742 GCAGGACTGGAATTCTGAGCTGG + Intergenic
1041066510 8:54087334-54087356 GAAGGACTTGAAAACTGGGCAGG + Intronic
1045245427 8:100438010-100438032 GAAGGTGTCTAATCCTGAGCAGG + Intergenic
1047050039 8:121100637-121100659 GAAGGACTGATATATTTAGCTGG - Intergenic
1048694376 8:137008714-137008736 GAAGTACTCAATTACGGAGTTGG - Intergenic
1050994611 9:12200464-12200486 GAAGGACTAGAAGTCTGAGCTGG + Intergenic
1055144378 9:72915266-72915288 CAAAGACTCAAAAATTGAGCTGG - Intronic
1056040592 9:82661647-82661669 GAAAACCTCAAAAACTGAGCTGG + Intergenic
1057416997 9:94872673-94872695 GAAGCATTCACAAACTGAGCAGG - Intronic
1059356699 9:113705347-113705369 GAAGGACTCAAAAACAGTGCTGG - Intergenic
1061707460 9:132463847-132463869 GAAGGACACAAACACTCACCTGG + Intronic
1062256660 9:135626309-135626331 GATGCACTCAAACACGGAGCTGG - Intronic
1203653372 Un_KI270752v1:38-60 GAAGGAATCAAATAGTTACCTGG + Intergenic
1192336131 X:70221391-70221413 TAAGGACAAAAATACTGAGAAGG + Intergenic
1193366970 X:80646115-80646137 TAAGGACACAAATATTGAACTGG - Intergenic
1195667460 X:107443854-107443876 AAAGGAATGAAATACTGACCAGG - Intergenic
1195857444 X:109346519-109346541 TAAAGACTCTATTACTGAGCTGG - Intergenic
1201464949 Y:14270203-14270225 GCAGTTCTCAAATACTGAACTGG - Intergenic