ID: 1099256968

View in Genome Browser
Species Human (GRCh38)
Location 12:80326121-80326143
Sequence AAGGACTCAAATACTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099256966_1099256968 -7 Left 1099256966 12:80326105-80326127 CCTGCAGTACTTGAGGAAGGACT 0: 1
1: 1
2: 3
3: 7
4: 119
Right 1099256968 12:80326121-80326143 AAGGACTCAAATACTGAGCTGGG 0: 1
1: 0
2: 0
3: 16
4: 196
1099256962_1099256968 21 Left 1099256962 12:80326077-80326099 CCAAAGTGGCTAATTATTGCTCC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1099256968 12:80326121-80326143 AAGGACTCAAATACTGAGCTGGG 0: 1
1: 0
2: 0
3: 16
4: 196
1099256963_1099256968 0 Left 1099256963 12:80326098-80326120 CCTTATACCTGCAGTACTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1099256968 12:80326121-80326143 AAGGACTCAAATACTGAGCTGGG 0: 1
1: 0
2: 0
3: 16
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099256968 Original CRISPR AAGGACTCAAATACTGAGCT GGG Intronic
903840855 1:26238902-26238924 TAGAACTCCAATCCTGAGCTAGG - Intronic
905312640 1:37060805-37060827 ATGGTGTCATATACTGAGCTGGG - Intergenic
907461701 1:54609161-54609183 AAGGACTCACATACAGTGCCTGG + Exonic
907747313 1:57226140-57226162 ATGTACTTAAATATTGAGCTTGG - Intronic
909976222 1:82048609-82048631 AAAGACTCAAATTATCAGCTAGG - Intergenic
910564588 1:88629193-88629215 AAGGGCTCAAGTACTGAGAAAGG + Intergenic
912746094 1:112246876-112246898 AAGTACTCAAAGATAGAGCTGGG - Intergenic
915099662 1:153490206-153490228 AGAGAGTCAAATACTGAGCAAGG + Intergenic
917013631 1:170504107-170504129 AAGGACTCATATGGTTAGCTTGG + Intergenic
918062701 1:181075661-181075683 TATGTCTGAAATACTGAGCTTGG - Intergenic
919832930 1:201554723-201554745 AAGGACTCTAAGACTGAGACAGG - Intergenic
1065442106 10:25763302-25763324 AAGTTCTCAAACATTGAGCTTGG + Intergenic
1065950387 10:30646100-30646122 AAAGAATAAAAAACTGAGCTGGG + Intergenic
1067127577 10:43532973-43532995 CAGAACTCAAACACTGTGCTGGG + Intergenic
1067151564 10:43739156-43739178 AAGGAGTGAGATACTGAGTTTGG + Intergenic
1070626861 10:78057137-78057159 AAAAACACAAATACTGAGGTGGG + Intergenic
1070841983 10:79493761-79493783 AAGGAATGAAGTACTGACCTGGG - Intergenic
1072401830 10:95110775-95110797 CAGAACTCAAACACTGTGCTAGG + Intergenic
1073873215 10:107889906-107889928 AAGGACTCAAATAGGAAGATGGG - Intergenic
1074341172 10:112631582-112631604 AAGGAATGAAGTACTGACCTAGG - Intronic
1079333274 11:19550719-19550741 CAGGACTCAACTCCTGAGATGGG + Intronic
1079617767 11:22516004-22516026 GAGGACTCAAATTGTGTGCTTGG + Intergenic
1081321027 11:41691759-41691781 AAGTACTAAAATTCTGACCTAGG - Intergenic
1085580123 11:77643083-77643105 AAGTACTCATATCCTGAGCCAGG - Intergenic
1086348754 11:85924030-85924052 AAGGAATCAAGAATTGAGCTGGG - Intergenic
1088056687 11:105590022-105590044 AAGGATCCAAAAACTGATCTGGG + Intergenic
1091441534 12:514731-514753 AAGAACACAAATTCTGGGCTGGG + Intronic
1091939718 12:4467738-4467760 AAGGACTCTCATACTTAGATTGG - Intergenic
1092077846 12:5688082-5688104 AAGGTCTTAAAGACTGAACTAGG - Intronic
1092334328 12:7615703-7615725 TAGGACTCTAGTACTGGGCTTGG + Intergenic
1092759578 12:11797506-11797528 AAGGACTGGAAGACAGAGCTGGG + Intronic
1095298623 12:40556444-40556466 AAGCACTCAAATCATGAACTAGG - Intronic
1095338648 12:41061916-41061938 CAACACTCAAATACTAAGCTAGG - Intronic
1095433994 12:42167523-42167545 AAGGACTCAAAAACTAAAATTGG + Intronic
1096368451 12:51048188-51048210 AAGGACTCAAAGACTAAGTGCGG - Intronic
1097483690 12:60165645-60165667 AAGAACTAAAATGATGAGCTGGG + Intergenic
1098403048 12:70094038-70094060 AAGGAAACAAACATTGAGCTGGG + Intergenic
1099256968 12:80326121-80326143 AAGGACTCAAATACTGAGCTGGG + Intronic
1099723923 12:86399824-86399846 AAGGACACAAATAATCAGCCAGG - Intronic
1101405928 12:104428827-104428849 AAGGACTCAAGTGATGAGATTGG - Intergenic
1103243970 12:119439376-119439398 AATGAATCAAATTCTGACCTGGG - Intronic
1107847271 13:44529076-44529098 AAGGCCTCACAGAATGAGCTAGG - Intronic
1108002695 13:45919297-45919319 AAGGACAGAATAACTGAGCTGGG - Intergenic
1109294211 13:60510701-60510723 AAGAAATCAAATAATGTGCTTGG - Exonic
1109939954 13:69348564-69348586 AATGTCTGAAATACTTAGCTTGG + Intergenic
1111750467 13:92324857-92324879 AATGACTCTAAAACTGATCTTGG - Intronic
1112943638 13:104897140-104897162 CAAGAGTCATATACTGAGCTGGG + Intergenic
1113336811 13:109384402-109384424 GAGGACTCAAATATAGAGGTAGG - Intergenic
1113449627 13:110398361-110398383 TAGCAATCAAATAATGAGCTGGG + Intronic
1114587777 14:23830241-23830263 AAGCACTCACAGCCTGAGCTGGG + Intergenic
1118515166 14:66520497-66520519 AGGGACTCAAATAATGTGATCGG + Intronic
1118612191 14:67550084-67550106 AAATACACAAATACGGAGCTGGG - Intronic
1119675874 14:76553447-76553469 AGGTACTCAGAGACTGAGCTGGG + Intergenic
1121156964 14:91694866-91694888 AAGGACATAACTACTGGGCTGGG + Intronic
1121617262 14:95320928-95320950 AAGGGCCCAAGCACTGAGCTGGG - Intergenic
1124181436 15:27479293-27479315 AAGGAATCAAACACTGTCCTTGG - Intronic
1124814027 15:32970029-32970051 ACAGACACAAATACTGATCTTGG - Intronic
1124918081 15:33996334-33996356 CAGAACTCAAACACTGTGCTGGG - Intronic
1126229340 15:46307056-46307078 AAGGATTAAAATACTTAGTTCGG + Intergenic
1126471454 15:49015953-49015975 AAGCCCACAGATACTGAGCTAGG + Intronic
1126847184 15:52771823-52771845 AAGGTCTAAAATACTGTCCTAGG - Intronic
1127595041 15:60472951-60472973 AAGGTCTCAAATTTTGAGATGGG + Intronic
1127622588 15:60748610-60748632 AAGGACTCAGTTACTGAACCAGG - Intronic
1127627904 15:60798393-60798415 CAGGAATCAAGTACTGAACTTGG + Intronic
1128396600 15:67232356-67232378 AAAAAATCAAATACAGAGCTTGG + Intronic
1133480965 16:6170090-6170112 AAGGACTCAAATATAGAAGTGGG + Intronic
1134857761 16:17534985-17535007 AAGGGCTAACATATTGAGCTGGG + Intergenic
1135111600 16:19694702-19694724 TAGTCCTAAAATACTGAGCTTGG + Intronic
1135198948 16:20420091-20420113 AAAGTCTCAAATTCTGAGATGGG - Intronic
1135219742 16:20603581-20603603 AAAGTCTCAAATTCTGAGATGGG + Intergenic
1136689345 16:32017685-32017707 AAAGAATGAAATACTGAGGTAGG + Intergenic
1136789937 16:32961227-32961249 AAAGAATGAAATACTGAGGTAGG + Intergenic
1136879875 16:33892709-33892731 AAAGAATGAAATACTGAGGTAGG - Intergenic
1138292479 16:55859834-55859856 AGGGACTGATATATTGAGCTGGG - Intronic
1138320347 16:56106016-56106038 AAAGACTCAAATCCTCAGCAGGG - Intergenic
1138345429 16:56317354-56317376 AAGGCACCAACTACTGAGCTGGG + Intronic
1138985919 16:62328394-62328416 AAGGAATAAAATACTGTGCTGGG - Intergenic
1140856101 16:78979065-78979087 AAAGACTGAAATTCTGAGCAGGG - Intronic
1203092140 16_KI270728v1_random:1222690-1222712 AAAGAATGAAATACTGAGGTAGG + Intergenic
1147152190 17:38523830-38523852 AAAGAATGAAATACTGAGGTAGG + Intergenic
1147904188 17:43812428-43812450 CAGGTCTCAGATACTCAGCTAGG - Intronic
1148517570 17:48235093-48235115 GAGGAGACAAAGACTGAGCTGGG + Intronic
1149234698 17:54576439-54576461 AAGAGACCAAATACTGAGCTAGG + Intergenic
1149351149 17:55788975-55788997 TAGGACTCAAATTTTGAGCCTGG + Intronic
1149825999 17:59828818-59828840 AAAGATTCATATACTGAGCCAGG + Intronic
1153673024 18:7430429-7430451 GAGTCCTCAAACACTGAGCTGGG + Intergenic
1155231881 18:23782181-23782203 AAAGACTCAAAGATTCAGCTGGG - Intronic
1156166690 18:34429520-34429542 CAGAACTCAAACACTGTGCTGGG + Intergenic
1157023433 18:43814488-43814510 AAGGACTCAAAGCCTGTGGTTGG + Intergenic
1158534911 18:58299315-58299337 AAAGATGCAAAGACTGAGCTTGG + Intronic
1160114345 18:76063696-76063718 AAGGAATCAAACACAGATCTTGG - Intergenic
1164501321 19:28822804-28822826 AGGGACTCAAATACAGAAGTAGG + Intergenic
1165860245 19:38905555-38905577 AAGGACTCAGCTCCTGGGCTAGG + Intronic
1166954941 19:46457306-46457328 GAGGACTCAAAGAAGGAGCTAGG + Intergenic
1167802869 19:51756615-51756637 AATGACTCAAATGCTGAACTAGG - Intronic
925243950 2:2362446-2362468 AAGGACTCAAATACACAGCCTGG + Intergenic
928362837 2:30679554-30679576 AAGGAGACAAATCCTGGGCTAGG + Intergenic
929022643 2:37568714-37568736 AAGCACCCAAATGCTAAGCTTGG - Intergenic
929169771 2:38920107-38920129 ATCGACTTAAATACTGAGGTTGG + Intronic
930296745 2:49563843-49563865 GAGGAGTTTAATACTGAGCTTGG + Intergenic
931951696 2:67370788-67370810 AAAGAATAAAATACTCAGCTGGG - Intergenic
939634048 2:144559664-144559686 AATGACTCATAAACTGAGATGGG + Intergenic
940373594 2:152928757-152928779 AAAGAGTCAATTACTGAGATAGG + Intergenic
941129608 2:161630333-161630355 ATGGCCTCACATACTGAGTTAGG + Intronic
941271383 2:163433342-163433364 AAGGGCTAAAATACTAGGCTGGG - Intergenic
941633394 2:167908792-167908814 AAGGACTCAAATATAGAGGTAGG - Intergenic
946584888 2:221174063-221174085 AATGACTCAAAAACTTGGCTCGG - Intergenic
1170366512 20:15603981-15604003 TAGGAATCAGATACTAAGCTTGG - Intronic
1170830711 20:19838424-19838446 AAGGACTGAATTACTGATATGGG - Intergenic
1172914450 20:38433349-38433371 CAGGACTCAGATACTGAGACAGG + Intergenic
1173315741 20:41941525-41941547 AAGGGCTCAAATGCAGTGCTTGG + Intergenic
1173513277 20:43647252-43647274 AAAGACTCAAATCCAGAACTGGG - Exonic
1177194507 21:17888839-17888861 AAAAACTCAAATACAGAGATGGG - Intergenic
1178097637 21:29233085-29233107 AAGGACTCAAATATAGAAGTAGG - Intronic
1178347116 21:31839619-31839641 AAGGACTCTAATTTTGATCTTGG + Intergenic
1178594198 21:33937920-33937942 AAGGACTCAAATATGGAAGTAGG - Intergenic
1181507077 22:23366555-23366577 AGGGACTGATATATTGAGCTGGG - Intergenic
1183839801 22:40489607-40489629 AAGGACTCAAATTATGGGCTGGG - Intronic
950055373 3:10020045-10020067 AAGGAATGAAATTCTGAGGTCGG + Intergenic
953207798 3:40847454-40847476 CAGGATTCAGCTACTGAGCTAGG - Intergenic
956728179 3:72173859-72173881 AAGGTCTCATATACTCAGCTTGG - Intergenic
958691569 3:97475231-97475253 AAGGCCAAATATACTGAGCTTGG + Intronic
960083825 3:113569522-113569544 TAGGACTCAAATATTTATCTTGG + Intronic
960880318 3:122338065-122338087 AACGACTCAAATCATTAGCTGGG + Intronic
962454157 3:135549780-135549802 AAGGACTGAAATTCTGAGCCGGG - Intergenic
964148203 3:153491970-153491992 AAGGCCTCAAAAACTAGGCTGGG + Intronic
964932438 3:162043402-162043424 AAGAACTCAAATCCTGGGCTGGG - Intergenic
965431346 3:168593154-168593176 AAGTATTCAAAAACTGAGCAGGG - Intergenic
966286849 3:178307422-178307444 AAGGCCTCAGATAATGAGCTAGG + Intergenic
967925594 3:194643870-194643892 AAGGACTGAAATACTGACACAGG + Intronic
967950821 3:194838943-194838965 AAGGACTCAAAGAGAGGGCTAGG + Intergenic
968721736 4:2211701-2211723 CAGGACTCAATTAATTAGCTGGG + Intronic
968802850 4:2755017-2755039 AAGGACACAAATCCTAGGCTGGG - Intronic
970221075 4:13811653-13811675 AAGCAGTCATTTACTGAGCTGGG - Intergenic
975528780 4:75378858-75378880 AAGAGCTCAAACACTGTGCTGGG - Intergenic
976975841 4:91165419-91165441 TAGAGCTCAAACACTGAGCTGGG + Intronic
977413393 4:96696870-96696892 AAGCTCTAAAATACTGAACTTGG + Intergenic
978515415 4:109563233-109563255 ATGGACTCAAATGCTGTACTGGG - Intronic
979757659 4:124361868-124361890 CAGAACTCAAACACTGTGCTGGG - Intergenic
979810694 4:125032147-125032169 CAGGACAGAAATTCTGAGCTGGG - Intergenic
982850053 4:160302679-160302701 AATGGCTCATATAATGAGCTAGG + Intergenic
983136321 4:164086575-164086597 AAGGACTCAAATGTTCAGATTGG + Intronic
983549550 4:169001933-169001955 AAAGAATCAAATAATGAACTGGG - Intronic
985370929 4:189284565-189284587 AAGGACTCAACTGCTGATCATGG - Intergenic
987054623 5:14179595-14179617 AAAAAATCAAAAACTGAGCTGGG - Intronic
992678837 5:79132998-79133020 AAAGCTTTAAATACTGAGCTTGG - Intronic
993115346 5:83714004-83714026 AAGGAAACAAAAACAGAGCTGGG + Intronic
993713396 5:91250299-91250321 AAGGACTCATAGAGTGTGCTTGG + Intergenic
994301733 5:98155881-98155903 AAGGACCCATTTACTGAGGTTGG - Intergenic
995641732 5:114264939-114264961 AAGGACTCATATGCTGAGTTAGG - Intergenic
996896360 5:128488044-128488066 AAGAACACATATACTAAGCTAGG + Intronic
996987445 5:129584409-129584431 AAGAGCTCAAACACTGTGCTGGG + Intronic
999022543 5:148183959-148183981 CAGGACTCATATAATGAGTTTGG - Intergenic
999098497 5:149003118-149003140 AAGAACTCAGATACTGTGGTAGG + Intronic
1000069013 5:157721571-157721593 CAGAACTCAAACACTGTGCTGGG - Intergenic
1000194713 5:158946699-158946721 TAGAACTCCAATACTGTGCTGGG + Intronic
1003636802 6:7839427-7839449 AAGTACCCAAATAGTCAGCTTGG - Intronic
1003781597 6:9433909-9433931 AAGGAATGAAATTCTGGGCTGGG - Intergenic
1004755902 6:18609844-18609866 AATGAGTCAACTACAGAGCTGGG - Intergenic
1005934315 6:30508415-30508437 AAAGACTCGAATACTAAGATGGG - Intergenic
1006348110 6:33499508-33499530 AAGGACTCAAAGATGGAGATGGG - Intergenic
1006710682 6:36067241-36067263 AAGGACTCAAACTCTAAGCTAGG - Intronic
1008855385 6:56079608-56079630 AGACACTCTAATACTGAGCTTGG + Intronic
1010432506 6:75794604-75794626 AAGGACTCAAATACGTACCTAGG + Intronic
1011880842 6:92023991-92024013 AAGAACTCATATAATTAGCTTGG - Intergenic
1012879813 6:104773690-104773712 AAGGAATTAAACACAGAGCTAGG - Intronic
1014888423 6:126811417-126811439 AATGAGTCAAATACTGATCCAGG - Intergenic
1016125867 6:140402511-140402533 TATGAGTCAAATACTGTGCTTGG - Intergenic
1018433497 6:163741928-163741950 AAGCAAACAAATTCTGAGCTAGG - Intergenic
1019794030 7:3036527-3036549 AAGGACCCAAATCTTGATCTGGG + Intronic
1020549647 7:9586385-9586407 AAGGATTCAAATACCAAACTTGG + Intergenic
1021179189 7:17486645-17486667 AAGTACTTAAATTCTGAGCATGG + Intergenic
1023548453 7:41343749-41343771 AAGGACACATATACTGAGATTGG - Intergenic
1023620724 7:42069237-42069259 AATGACTGAAATACTGAATTCGG - Intronic
1023782693 7:43672162-43672184 CTGGACTCAAATAATGAGTTAGG - Intronic
1025736900 7:64157692-64157714 AATGAGTCAAATACTGAATTTGG + Intronic
1027499645 7:78932927-78932949 AAGGACTGAATAACTGTGCTGGG + Intronic
1028805984 7:95026596-95026618 TGGAACTCAAATACTGTGCTGGG + Intronic
1030918828 7:115353503-115353525 AAGGAGTAAAATTCTGGGCTGGG + Intergenic
1031468124 7:122138841-122138863 AAGGACACAGAGACAGAGCTCGG + Intronic
1036504844 8:9345881-9345903 AACGAGTCAAATTCTCAGCTGGG + Intergenic
1038357051 8:26839317-26839339 AAAGACACAAAAAATGAGCTGGG - Intronic
1039342236 8:36663721-36663743 CAGGACTGGAATTCTGAGCTGGG + Intergenic
1040968754 8:53111996-53112018 CAGAACTCAAATGCTGTGCTGGG + Intergenic
1041605110 8:59772898-59772920 AAGGACTCATTCACTAAGCTGGG + Intergenic
1041612141 8:59863446-59863468 AAGCACTCAGATACCAAGCTTGG + Intergenic
1043872450 8:85449151-85449173 AAGGGCTGAAATTCTGAGTTTGG + Intergenic
1046035174 8:108832155-108832177 AAGGACTCAAATATAGAAGTAGG - Intergenic
1047346482 8:124033766-124033788 TAGGATTCAAATATTTAGCTGGG - Intronic
1049996095 9:1035466-1035488 CTAGACTCAAATACTGAGTTTGG + Intergenic
1050072671 9:1832849-1832871 AAGGACTCCAGTACTGAGACAGG + Intergenic
1050994612 9:12200465-12200487 AAGGACTAGAAGTCTGAGCTGGG + Intergenic
1051590783 9:18775440-18775462 AACTAGTGAAATACTGAGCTGGG + Intronic
1052063808 9:23992325-23992347 CAGAACTCAAACACTGTGCTGGG - Intergenic
1053429288 9:38031514-38031536 AAGGACTGAAACACTCACCTGGG - Intronic
1055049704 9:71965928-71965950 AAGGACTCAAATATAGAAATAGG - Intronic
1056040593 9:82661648-82661670 AAAACCTCAAAAACTGAGCTGGG + Intergenic
1056955998 9:91081785-91081807 AAGGAATAAACTACTGAACTTGG + Intergenic
1057672743 9:97108920-97108942 AAGGCCTAAAGTACTGAGTTTGG + Intergenic
1059356698 9:113705346-113705368 AAGGACTCAAAAACAGTGCTGGG - Intergenic
1061813006 9:133173883-133173905 AAGGACTCAAATAGAGAGGTAGG + Intergenic
1062256659 9:135626308-135626330 ATGCACTCAAACACGGAGCTGGG - Intronic
1185484269 X:470346-470368 AAGAAATCAAAAACTTAGCTGGG - Intergenic
1186119731 X:6347361-6347383 AACAACTCAAATACTGAGACTGG - Intergenic
1186830523 X:13385551-13385573 AATGACAGAAACACTGAGCTAGG - Intergenic
1188084183 X:25882965-25882987 CAGAGCTCAAATACTGTGCTGGG - Intergenic
1189571277 X:42300530-42300552 AAGGCATAAAATACTGAGCTTGG - Intergenic
1192225638 X:69226029-69226051 AAGGAATGAAGTACTGATCTAGG + Intergenic
1192817229 X:74606972-74606994 AAAGACACAAAAACTTAGCTGGG + Intronic
1194654304 X:96553488-96553510 AAGAACTCAAATACTAAAGTGGG + Intergenic
1195667459 X:107443853-107443875 AAGGAATGAAATACTGACCAGGG - Intergenic
1197704897 X:129627849-129627871 AAGGACTTATTTACTAAGCTAGG + Intergenic
1201464948 Y:14270202-14270224 CAGTTCTCAAATACTGAACTGGG - Intergenic