ID: 1099256969

View in Genome Browser
Species Human (GRCh38)
Location 12:80326122-80326144
Sequence AGGACTCAAATACTGAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099256966_1099256969 -6 Left 1099256966 12:80326105-80326127 CCTGCAGTACTTGAGGAAGGACT 0: 1
1: 1
2: 3
3: 7
4: 119
Right 1099256969 12:80326122-80326144 AGGACTCAAATACTGAGCTGGGG 0: 1
1: 0
2: 0
3: 14
4: 190
1099256963_1099256969 1 Left 1099256963 12:80326098-80326120 CCTTATACCTGCAGTACTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1099256969 12:80326122-80326144 AGGACTCAAATACTGAGCTGGGG 0: 1
1: 0
2: 0
3: 14
4: 190
1099256962_1099256969 22 Left 1099256962 12:80326077-80326099 CCAAAGTGGCTAATTATTGCTCC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1099256969 12:80326122-80326144 AGGACTCAAATACTGAGCTGGGG 0: 1
1: 0
2: 0
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099256969 Original CRISPR AGGACTCAAATACTGAGCTG GGG Intronic
900892505 1:5459629-5459651 AGGACTCAAATACAGAAGTATGG + Intergenic
905289924 1:36914197-36914219 TGGAGTCAAAAGCTGAGCTGAGG - Intronic
905312639 1:37060804-37060826 TGGTGTCATATACTGAGCTGGGG - Intergenic
908546185 1:65164355-65164377 AGGACTCAAATACTGAAGTATGG + Intronic
910424452 1:87105520-87105542 ATGACTCCATTAGTGAGCTGTGG + Exonic
910628612 1:89335002-89335024 AGAACTCAACCAGTGAGCTGGGG - Intergenic
916261551 1:162847277-162847299 AGGCAGCAAGTACTGAGCTGGGG - Intronic
917578105 1:176345242-176345264 AGGCCTCAAAGACTGTGATGGGG + Intergenic
918684461 1:187397442-187397464 AGAGCTCAAACACTGTGCTGGGG - Intergenic
919812011 1:201414656-201414678 AGGACACACCTGCTGAGCTGGGG + Intronic
919869202 1:201807897-201807919 AGGACTCCACTACTGGGATGGGG - Intronic
920910201 1:210209341-210209363 AGGACTCAAATATAGAGATACGG - Intergenic
921659389 1:217781550-217781572 ATGACACAAATACTTAGCAGAGG - Intronic
922487659 1:225988124-225988146 AAGACTCATGTGCTGAGCTGGGG - Exonic
922527356 1:226315314-226315336 AGGACTCAAATACAGAAGTATGG - Intergenic
922997081 1:229972848-229972870 AGGCCTCAAATTCTGAGTGGAGG - Intergenic
924797633 1:247303641-247303663 GGAACTCGGATACTGAGCTGAGG + Intronic
1063952414 10:11236130-11236152 AGGACTCATAAACTAAGCTATGG + Intronic
1065807108 10:29404254-29404276 AGGACTCAAATATAGAAGTGTGG + Intergenic
1067038323 10:42934764-42934786 AGGACCCCAACACTGACCTGGGG - Intergenic
1067367422 10:45646693-45646715 AGGACTCATACGCTAAGCTGAGG + Intronic
1068131064 10:52895862-52895884 AATACTGAGATACTGAGCTGGGG + Intergenic
1069616177 10:69807590-69807612 AGGACTGAAATGCTGGGATGAGG + Intronic
1069705436 10:70456493-70456515 AGGACAGAAAAACGGAGCTGAGG - Intergenic
1069899327 10:71697921-71697943 AGGTCTCAAATACTACCCTGGGG - Intronic
1070440523 10:76438327-76438349 AGGCCTCAAACACTGGGCTTTGG + Intronic
1073873214 10:107889905-107889927 AGGACTCAAATAGGAAGATGGGG - Intergenic
1074440947 10:113476962-113476984 AGGACTCAAACTAAGAGCTGGGG + Intergenic
1075504858 10:123012757-123012779 TGGACTCAAAGATTGAGCAGCGG + Intronic
1076188054 10:128464203-128464225 ATGACTGAAATACTGAGCCATGG + Intergenic
1079333275 11:19550720-19550742 AGGACTCAACTCCTGAGATGGGG + Intronic
1079494732 11:21029211-21029233 AGGACTCAAATACAGAAGTATGG + Intronic
1081282627 11:41228882-41228904 AGGACTCCAATGTTGAACTGTGG - Intronic
1082827795 11:57593448-57593470 AGGACTCAACTCCCGAGGTGGGG + Intergenic
1083900649 11:65641721-65641743 AGGGCTCAAGAGCTGAGCTGGGG + Intronic
1083923564 11:65793064-65793086 AGGTTTCAAGTACTGAGCTCAGG + Intronic
1086348753 11:85924029-85924051 AGGAATCAAGAATTGAGCTGGGG - Intergenic
1087464557 11:98488555-98488577 AAGAGTTAAATACTGAGCAGGGG - Intergenic
1087607643 11:100395666-100395688 AGGACTCAAATCCTTGGCTTTGG + Intergenic
1087797412 11:102469134-102469156 AGGACTCAAATATAGAGGTATGG + Intronic
1091484752 12:874853-874875 AGTAGTCAAATGGTGAGCTGTGG - Intronic
1092334329 12:7615704-7615726 AGGACTCTAGTACTGGGCTTGGG + Intergenic
1093313528 12:17620442-17620464 AGGACGCAAATATTGAGTTATGG - Intergenic
1095535644 12:43243492-43243514 AGGAATCACATACTAAGCTTTGG - Intergenic
1097483691 12:60165646-60165668 AGAACTAAAATGATGAGCTGGGG + Intergenic
1099256969 12:80326122-80326144 AGGACTCAAATACTGAGCTGGGG + Intronic
1099389092 12:82056568-82056590 AGGACTCAAAAACTGAAATTAGG + Intergenic
1099490026 12:83276749-83276771 AGAGCTCAAACACTGTGCTGGGG + Intergenic
1105970189 13:25422064-25422086 AGGGCTCAAACCCTGAGCTCTGG + Intronic
1107304987 13:39008461-39008483 AGGACTCAAATACAGAAGTACGG - Intergenic
1109013502 13:56979238-56979260 AGGACTCACATACAGAAGTGTGG - Intergenic
1110267853 13:73558670-73558692 AGGCCTCATATTCTGAGCTAAGG - Intergenic
1111788937 13:92827959-92827981 AGGACTGAAATCCTTAGGTGTGG - Intronic
1112943639 13:104897141-104897163 AAGAGTCATATACTGAGCTGGGG + Intergenic
1118085259 14:62407286-62407308 AGGATTGGAATATTGAGCTGTGG - Intergenic
1119624529 14:76160873-76160895 AGGACTCTGCTATTGAGCTGGGG - Intronic
1121156965 14:91694867-91694889 AGGACATAACTACTGGGCTGGGG + Intronic
1126130197 15:45333576-45333598 ACGACTCAAATGCTGAGGGGTGG + Intergenic
1126829943 15:52591547-52591569 AGGTCTCAAATACTGTGATCTGG - Intronic
1127500795 15:59552430-59552452 AGGACTCAAATACAGAAGTACGG + Intergenic
1127595042 15:60472952-60472974 AGGTCTCAAATTTTGAGATGGGG + Intronic
1129172832 15:73818296-73818318 AGGACTCCGATACTGGGCTCAGG + Intergenic
1130160891 15:81398763-81398785 CAGACTCAGATACTGAGCTAAGG - Intergenic
1133327174 16:4948890-4948912 AGGCCTCAGGCACTGAGCTGGGG + Intronic
1133480966 16:6170091-6170113 AGGACTCAAATATAGAAGTGGGG + Intronic
1134750345 16:16619954-16619976 AGGACTCAACTCCAGAGGTGGGG - Intergenic
1134995110 16:18733638-18733660 AGGACTCAACTCCAGAGGTGGGG + Intergenic
1137399070 16:48138588-48138610 AGGACTCAAAGAGAGTGCTGGGG + Intronic
1138345430 16:56317355-56317377 AGGCACCAACTACTGAGCTGGGG + Intronic
1139001927 16:62521259-62521281 AGGACTCAAATACAGAAATACGG - Intergenic
1140906038 16:79409966-79409988 AGGACTCAAATATAGAGGTATGG - Intergenic
1141402345 16:83761165-83761187 AGGACTGAAAACCTGATCTGAGG + Intronic
1144044925 17:11446804-11446826 ATCACTTAAATTCTGAGCTGTGG + Intronic
1145364244 17:22242133-22242155 AGGCCTCAAAGACTGAATTGTGG + Intergenic
1147521387 17:41176882-41176904 AGGACACTAATACTGAGATTAGG + Intergenic
1147904187 17:43812427-43812449 AGGTCTCAGATACTCAGCTAGGG - Intronic
1148368253 17:47072765-47072787 CTGATTCAAATACAGAGCTGTGG - Intergenic
1148634591 17:49138659-49138681 TGGTCTCAAATACTGACCTCAGG - Intronic
1152170880 17:78747362-78747384 GAGACTCAAATACTGCACTGCGG + Intronic
1153673025 18:7430430-7430452 AGTCCTCAAACACTGAGCTGGGG + Intergenic
1155680856 18:28483718-28483740 AGGACTCAACTCCAGAGGTGGGG + Intergenic
1155753744 18:29463302-29463324 AGGATTCAAATACTTAGGTGTGG - Intergenic
1156104955 18:33648704-33648726 AAGACCCAAAGACTGAGCTCAGG + Intronic
1156482772 18:37446447-37446469 AGGACTCAAATATGAACCTGTGG - Intronic
1157167165 18:45368444-45368466 AGGAGTCAGAGACTGAGATGTGG + Intronic
1158230692 18:55251162-55251184 AGGCTTCAAATGCTGAGCTAAGG + Intronic
1158597275 18:58827493-58827515 AGGACTCAAAGAGTGAGCAGCGG + Intergenic
1161988136 19:7669052-7669074 AGGCCTCAAAGAAAGAGCTGCGG + Exonic
1161991845 19:7688821-7688843 AGGACTCACCACCTGAGCTGGGG + Exonic
1163492822 19:17626833-17626855 AGGACACAGATGCTGATCTGTGG + Intronic
1163512525 19:17744190-17744212 AGGACTCAACTCCAGAGGTGGGG - Intergenic
1166954942 19:46457307-46457329 AGGACTCAAAGAAGGAGCTAGGG + Intergenic
924984518 2:257409-257431 AGGACTCAAATATTGAAGTATGG - Intronic
927111715 2:19868755-19868777 GGGACTCCACTACTGGGCTGGGG - Intergenic
928233873 2:29523158-29523180 AGGACACAGATGATGAGCTGTGG - Intronic
929579717 2:43074149-43074171 AGGTCTCAAATTCAGAGCAGGGG + Intergenic
930839537 2:55830183-55830205 TGGACTCATAGAATGAGCTGGGG - Intergenic
936601051 2:113894847-113894869 AGGACTTAAATACAGAACTCAGG - Intronic
938142707 2:128809784-128809806 AGGAATCAAGTGCTGAACTGAGG + Intergenic
941591245 2:167422919-167422941 ACTACTGAAATACAGAGCTGAGG + Intergenic
941633393 2:167908791-167908813 AGGACTCAAATATAGAGGTAGGG - Intergenic
942260477 2:174156458-174156480 AAGGCTCTAACACTGAGCTGAGG + Intronic
945403505 2:209418918-209418940 AATAACCAAATACTGAGCTGAGG - Intergenic
945550464 2:211215336-211215358 AGGACACAAATAGTCAACTGAGG - Intergenic
945661308 2:212688362-212688384 AGAACTCCAATACTGAGAGGTGG - Intergenic
946360562 2:219217056-219217078 AGGATTCAGAAACTGAGGTGGGG + Intronic
1169667667 20:8056411-8056433 AGGACTCAATTCCTGAGAGGAGG + Intergenic
1170278680 20:14621680-14621702 AGGAGAGAAATTCTGAGCTGTGG + Intronic
1172319594 20:33985988-33986010 AGGACTCAACTCCAGAGATGGGG + Intergenic
1173513276 20:43647251-43647273 AAGACTCAAATCCAGAACTGGGG - Exonic
1175162355 20:57018464-57018486 AGGACTAAATTACAGAACTGTGG + Intergenic
1180977407 22:19855817-19855839 AGGCATCAGATCCTGAGCTGGGG - Intergenic
1183543522 22:38443478-38443500 AGGAGTCACAGACTGAGATGGGG - Intronic
1184308273 22:43624053-43624075 AGGACACAGATAATGAGCAGTGG - Intronic
951249717 3:20380779-20380801 AGGACTCAAATACAGAAGTACGG - Intergenic
953207797 3:40847453-40847475 AGGATTCAGCTACTGAGCTAGGG - Intergenic
960010022 3:112823602-112823624 AGCACTCAATTACAGGGCTGTGG + Intronic
964855085 3:161138093-161138115 TGGTCTCAAATACAGAACTGGGG + Intronic
966129449 3:176620864-176620886 AGGATTCAACTACTGAGATCTGG - Intergenic
966531351 3:180984788-180984810 AGGACTCCAATGCTTATCTGAGG + Intronic
967973253 3:195014767-195014789 AGAACTCAAAGACCGACCTGAGG - Intergenic
969940195 4:10724370-10724392 AGGATTCAAATTCTGAGCATAGG - Intergenic
970156041 4:13142606-13142628 AGGACTCACACTCAGAGCTGTGG - Intergenic
970221074 4:13811652-13811674 AGCAGTCATTTACTGAGCTGGGG - Intergenic
970758682 4:19456454-19456476 AGGGCTCAGAAACGGAGCTGTGG - Intergenic
972374134 4:38454915-38454937 AGGACTCAAATATTGACATTTGG + Intergenic
975909982 4:79256070-79256092 AGGACTCAACTCCGGAGGTGGGG - Intronic
978515414 4:109563232-109563254 TGGACTCAAATGCTGTACTGGGG - Intronic
978826163 4:113026636-113026658 AAGGCTCAAATGCTGAACTGTGG + Intronic
979810693 4:125032146-125032168 AGGACAGAAATTCTGAGCTGGGG - Intergenic
981602648 4:146508071-146508093 AGGCCTGAATTACTGGGCTGAGG - Intronic
982179443 4:152736054-152736076 AGCACTCAATTACTCAGCCGAGG + Intronic
983549549 4:169001932-169001954 AAGAATCAAATAATGAACTGGGG - Intronic
985948449 5:3204519-3204541 AAGTTTCAAATTCTGAGCTGGGG + Intergenic
986253491 5:6082403-6082425 AGGACCCAAATTCTAATCTGAGG + Intergenic
987675051 5:21063512-21063534 AGGAGTCAAAAACTGAGGTTTGG + Intergenic
990082097 5:51929542-51929564 AGGACTCAAATACAGAATTGTGG - Intergenic
990236981 5:53779010-53779032 ATGCCACAAATCCTGAGCTGGGG - Intergenic
992343275 5:75848418-75848440 AGGACTCAGAAACTGCCCTGGGG + Intergenic
992389998 5:76321983-76322005 AGAAACCGAATACTGAGCTGGGG - Intronic
993115347 5:83714005-83714027 AGGAAACAAAAACAGAGCTGGGG + Intronic
997528157 5:134566675-134566697 AGGACTCAAACTGTGAGCTCTGG + Intronic
997629564 5:135356587-135356609 AGGGCTCAATTTCTGAGCTCTGG - Intronic
999022542 5:148183958-148183980 AGGACTCATATAATGAGTTTGGG - Intergenic
1000028862 5:157384476-157384498 AGGACTCAAATCCTCAGCGGAGG + Intronic
1002361742 5:178677486-178677508 AGGACTCAAATATAGAGATATGG - Intergenic
1002767207 6:252546-252568 AAAACTCAAATCCTGAGGTGAGG - Intergenic
1005854147 6:29847847-29847869 AGGACTCAAAAAATAAACTGTGG - Intergenic
1005934314 6:30508414-30508436 AAGACTCGAATACTAAGATGGGG - Intergenic
1006348109 6:33499507-33499529 AGGACTCAAAGATGGAGATGGGG - Intergenic
1007086600 6:39151982-39152004 ATGAATGAAATACTGAGCTCAGG + Intergenic
1007141678 6:39581813-39581835 AGGGCCCAAAAACTAAGCTGAGG - Intronic
1014123921 6:117755512-117755534 AGGACTTAAATGCTGACCTGTGG - Intergenic
1014241123 6:119018542-119018564 AGGAATAAAATAATGAGATGGGG + Intronic
1016062494 6:139645203-139645225 AGGACACAAATAGGGTGCTGTGG - Intergenic
1016705322 6:147100267-147100289 AAGACACAAATAGTGAGCTCTGG - Intergenic
1017197360 6:151716345-151716367 AGAGCTCAAATATTGTGCTGGGG + Intronic
1017385540 6:153878572-153878594 AGGACTCAACTGCAGAGGTGGGG - Intergenic
1018143091 6:160859320-160859342 AGGACTCAAATACCGAAGTACGG + Intergenic
1018197305 6:161366537-161366559 AGGACTCAAATACAGAAGTACGG - Intronic
1023029800 7:36082010-36082032 AGGAATCAAATTATTAGCTGAGG - Intronic
1023405153 7:39826147-39826169 AGGACTCAAATACAGAAGTAAGG + Intergenic
1023548452 7:41343748-41343770 AGGACACATATACTGAGATTGGG - Intergenic
1023782692 7:43672161-43672183 TGGACTCAAATAATGAGTTAGGG - Intronic
1023984156 7:45085565-45085587 GGGACTCAGAGGCTGAGCTGCGG - Exonic
1027960598 7:84940812-84940834 AGGACTCAAATACAGAAGTAAGG - Intergenic
1029094298 7:98072901-98072923 AGGACTCAACTCCAGAGGTGGGG - Intergenic
1029419967 7:100467328-100467350 AGGGCTCAAAGACAGAGATGGGG + Intronic
1033670130 7:143484362-143484384 AGGACTCAAAGACTGATTTCTGG + Intergenic
1034554810 7:151843597-151843619 AACACTCAAATACTCAGCTCTGG - Intronic
1036425257 8:8639703-8639725 AGGACTCAAATACAGAAGTATGG - Intergenic
1036440090 8:8774244-8774266 AGGACTCAAATATAGAGGTACGG + Intergenic
1036504845 8:9345882-9345904 ACGAGTCAAATTCTCAGCTGGGG + Intergenic
1038879288 8:31589937-31589959 AGGACAGAAATAATGAGCTATGG + Intergenic
1041869349 8:62615635-62615657 GGCACTCAAATTCTGACCTGTGG + Intronic
1042225135 8:66509308-66509330 AGGATTCAAGTGTTGAGCTGAGG - Intronic
1042485008 8:69338804-69338826 AGGACTCAAATAGTGGCCTCTGG + Intergenic
1046095149 8:109549393-109549415 TGGCCTCAAATAATGAGTTGGGG + Intronic
1046297400 8:112238925-112238947 AGGACTCAAATATAGAACTATGG - Intronic
1046447343 8:114340172-114340194 AGGAGACAAATACTTATCTGAGG + Intergenic
1046898787 8:119501497-119501519 AGGACTCAAATACAGAAGTACGG + Intergenic
1047030224 8:120869095-120869117 AGGACTCAAATACAGAAATACGG + Intergenic
1047131767 8:122028848-122028870 AGGACTCAAATATAGAAGTGAGG + Intergenic
1048081076 8:131127758-131127780 AGGACTCAAATACTGAAGTACGG + Intergenic
1048420821 8:134276745-134276767 AGGGCTGAATTACAGAGCTGTGG + Intergenic
1049678585 8:143904777-143904799 AGGACTCAACTCCGGAGGTGGGG + Intergenic
1049996096 9:1035467-1035489 TAGACTCAAATACTGAGTTTGGG + Intergenic
1053429287 9:38031513-38031535 AGGACTGAAACACTCACCTGGGG - Intronic
1058805487 9:108587146-108587168 AGGATTCAAATACAGATCTGTGG - Intergenic
1060357506 9:122923657-122923679 AGGAGGGAAATACTGATCTGAGG - Intronic
1061813007 9:133173884-133173906 AGGACTCAAATAGAGAGGTAGGG + Intergenic
1062666836 9:137678268-137678290 AGCATTCAAACACTGTGCTGGGG - Intronic
1186144468 X:6611064-6611086 AGGACTCAACTCCAGAGGTGGGG + Intergenic
1186394399 X:9193672-9193694 AGGAATAAAATAATTAGCTGGGG - Intergenic
1186520343 X:10200660-10200682 AGGAGTAAAATACTGAGTTGAGG + Intronic
1188807430 X:34608785-34608807 AGGACTCAAATATAGAGGTATGG + Intergenic
1193179735 X:78440759-78440781 AGGACTCATTTCCTGATCTGAGG + Intergenic
1193223584 X:78955696-78955718 AGGGCTCACAGACTGAGGTGGGG - Intronic
1194693297 X:97013159-97013181 AGGCCTCAACTACTGAGGTATGG + Intronic
1195321534 X:103725355-103725377 AGGACTCAAACCCTAGGCTGAGG + Intronic
1195817495 X:108904298-108904320 AGATCTCAAACACTGTGCTGGGG - Intergenic
1196577263 X:117333941-117333963 AGGACTCAAATATAGAAGTGTGG + Intergenic
1197141793 X:123125370-123125392 TGGCCTCAAAAACTGAGTTGTGG - Intergenic
1200238829 X:154483131-154483153 AGGACTCAGATACTGTCCCGAGG + Intergenic
1201702529 Y:16900036-16900058 AGGACTCAAATACAGAAGTGTGG + Intergenic