ID: 1099260955

View in Genome Browser
Species Human (GRCh38)
Location 12:80382309-80382331
Sequence CTGCATGAGCAGAAGTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 348}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099260955_1099260958 15 Left 1099260955 12:80382309-80382331 CCACTCCACTTCTGCTCATGCAG 0: 1
1: 0
2: 5
3: 37
4: 348
Right 1099260958 12:80382347-80382369 CATGCTCATAGTTCTGCAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 182
1099260955_1099260959 18 Left 1099260955 12:80382309-80382331 CCACTCCACTTCTGCTCATGCAG 0: 1
1: 0
2: 5
3: 37
4: 348
Right 1099260959 12:80382350-80382372 GCTCATAGTTCTGCAGCTGGTGG 0: 1
1: 0
2: 1
3: 20
4: 198
1099260955_1099260960 24 Left 1099260955 12:80382309-80382331 CCACTCCACTTCTGCTCATGCAG 0: 1
1: 0
2: 5
3: 37
4: 348
Right 1099260960 12:80382356-80382378 AGTTCTGCAGCTGGTGGTGCTGG 0: 1
1: 0
2: 5
3: 40
4: 360
1099260955_1099260957 -10 Left 1099260955 12:80382309-80382331 CCACTCCACTTCTGCTCATGCAG 0: 1
1: 0
2: 5
3: 37
4: 348
Right 1099260957 12:80382322-80382344 GCTCATGCAGAGATTCGCTTAGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099260955 Original CRISPR CTGCATGAGCAGAAGTGGAG TGG (reversed) Intergenic
900987169 1:6079947-6079969 CTTCATGAGCAGGTGTGGATTGG + Intronic
901333947 1:8432316-8432338 TTGAATAAGCAGAAGTGAAGAGG - Intronic
901403585 1:9031543-9031565 GTTCCTGAGCAGAAGTGGACAGG - Intergenic
901409885 1:9075408-9075430 CGGTATCAGCAGAAGAGGAGCGG - Intronic
901724628 1:11231169-11231191 CTACATGAACAAAATTGGAGAGG + Intronic
902268785 1:15288343-15288365 GTGGATGAGCAAACGTGGAGTGG - Intronic
902397444 1:16140062-16140084 CTGTGTGAGCAGAGGTGCAGAGG + Intronic
902933173 1:19745501-19745523 CAGGAGGACCAGAAGTGGAGGGG - Intronic
904110666 1:28123604-28123626 CAACAGGAGCAGCAGTGGAGGGG + Intergenic
904606534 1:31700959-31700981 CTGACTGAGCAGAAGTGTTGGGG + Intronic
905922446 1:41728512-41728534 CAGCATGAGCAAATGTGCAGGGG + Intronic
908164398 1:61443776-61443798 CTTCATGGGCAGAAATGGAAAGG - Intronic
909327524 1:74369569-74369591 CTTCATGAGCAGAAGAGGTATGG + Exonic
909609740 1:77539630-77539652 CTGCAGGAGAAGCAGGGGAGGGG + Intronic
909806150 1:79875925-79875947 CTGCAGCTGCAGTAGTGGAGAGG - Intergenic
910034263 1:82771789-82771811 TTGGGTGAGCAGAAGTTGAGGGG + Intergenic
913216870 1:116628096-116628118 GTGTGTGGGCAGAAGTGGAGAGG + Intronic
916302280 1:163289259-163289281 CTGCAGGAGCAAAGGTGTAGGGG - Intronic
917065036 1:171083547-171083569 CGGCCTGAGCTGAAGAGGAGAGG + Intergenic
917775901 1:178334179-178334201 CTGCATGTGCAGAAATTTAGAGG + Intronic
917848043 1:179038902-179038924 CTTCATGAACAGAAAAGGAGTGG + Intronic
918047405 1:180949654-180949676 GGGCATGTGCAGAAGAGGAGAGG + Exonic
919911507 1:202113692-202113714 CTTCAGGAGCAGAATTTGAGTGG - Intergenic
920131221 1:203733357-203733379 CAGCAGGAACAGAAGTGGTGGGG - Intronic
920389552 1:205590667-205590689 CTGCATGCCCAGAAGTGGAGGGG + Intronic
921094205 1:211873185-211873207 CTGCGTGAGGAGAAGTGGCTGGG - Intergenic
921520905 1:216152907-216152929 CTCCATGAGCAGAAGAGCAGAGG + Intronic
921709293 1:218357253-218357275 CTGGATGAGATGAAGGGGAGGGG + Intronic
922219838 1:223550189-223550211 CTGCAGGAGCAAGAGTGGTGTGG + Intronic
922359558 1:224809153-224809175 TTGAATGAGCAGAAGTGCAATGG - Intergenic
922556612 1:226537354-226537376 CTGTAATAGCAAAAGTGGAGGGG + Intergenic
922689317 1:227675231-227675253 CAGGATGGGCAGGAGTGGAGGGG - Intronic
923774245 1:236964265-236964287 CTCCATCAGCAGAAGTGAAGAGG + Intergenic
924299960 1:242627103-242627125 CTGCAAGAGGAGGAGTGAAGAGG + Intergenic
1065171338 10:23033567-23033589 GTGCATGAGGAAAAGAGGAGGGG + Intronic
1065304376 10:24354761-24354783 CTCCATGAGCAGAAGAGCAGAGG - Intronic
1065756959 10:28939602-28939624 CTGCAGGAGCGGAGGTGAAGGGG - Intergenic
1065917265 10:30364524-30364546 CTGCATGAGCTGCTGTGCAGTGG + Intronic
1066066573 10:31765376-31765398 CTCCAGGAGCAGATGGGGAGGGG - Intergenic
1066259322 10:33713710-33713732 CTGCATGAACAGAAAGGGAGAGG + Intergenic
1066573726 10:36802502-36802524 CTGCATGAGGCGAGGTGAAGAGG + Intergenic
1067706358 10:48609331-48609353 ATACATGAGCAGAAGTGATGTGG + Intronic
1069412482 10:68167917-68167939 CTGCAGGAGAAGAACTAGAGAGG + Intronic
1069774185 10:70917321-70917343 CTGCAAGAGGACAAGAGGAGGGG - Intergenic
1070831938 10:79423077-79423099 CTGCCTGAGCTTTAGTGGAGTGG + Intronic
1071490105 10:86130471-86130493 CTCCATAAGCAGAAGGGCAGAGG + Intronic
1071708221 10:88022404-88022426 CTGCATGAAGAGAAGTGTATTGG + Intergenic
1072289024 10:93945525-93945547 ATCCATGTGCAGAAATGGAGAGG + Intronic
1073510369 10:104039023-104039045 CTTCACCAGAAGAAGTGGAGAGG + Intronic
1073696783 10:105878254-105878276 CTGAATAAGCAAAAATGGAGAGG + Intergenic
1074846961 10:117406899-117406921 CTACATGAGGAGGAATGGAGGGG + Intergenic
1075514885 10:123100832-123100854 CTGCAGGAGAATGAGTGGAGAGG - Intergenic
1075594275 10:123716701-123716723 CTGGATGAGCTGAACTGCAGGGG + Intronic
1075750737 10:124768806-124768828 CAGCATGAGTGGAAATGGAGGGG + Intronic
1076561125 10:131364940-131364962 AACCATGGGCAGAAGTGGAGAGG - Intergenic
1077117588 11:892233-892255 CTGCAGGAGCAGAACTGCCGAGG + Intronic
1077210418 11:1368569-1368591 CTGCAGGAGGAGAGATGGAGAGG - Intergenic
1077392387 11:2306162-2306184 ACGCATGAGCACAAGTGAAGGGG + Intronic
1078598181 11:12707272-12707294 CAGCATGAGGAGGAGTGGAAGGG - Intronic
1079436566 11:20459398-20459420 ATAAATGAGCAGAAATGGAGGGG - Intronic
1081488717 11:43550416-43550438 CTGCATGAGCAAAGGCAGAGAGG + Intergenic
1082802673 11:57426167-57426189 CGCCATGAGCAGAAGTGGAGTGG + Exonic
1083254831 11:61489666-61489688 CAGCATGAGCAAAGGTGGGGAGG + Intronic
1083696127 11:64443887-64443909 CTGTAGGAGCAGAAGTCCAGTGG + Intergenic
1084873914 11:72116840-72116862 CAGCATGTGCAGAAGTGCAGAGG + Intronic
1084896712 11:72276832-72276854 TTGCATGAGCTGGAGTGCAGTGG + Intergenic
1084961452 11:72718825-72718847 CAGCTTGTGCAGAAGTTGAGAGG + Intronic
1085068188 11:73517387-73517409 CTGCATGAGGGGAAGGGGGGTGG - Intronic
1085226886 11:74929617-74929639 CTGCTGGAGCAGATGTGGAATGG - Intronic
1085301774 11:75462890-75462912 CTGGAAGAGCAGAGGAGGAGGGG + Intronic
1085314320 11:75535173-75535195 CTCCAGGAGCAGCAGGGGAGGGG + Intergenic
1085316464 11:75548125-75548147 CTGCTTGAGGAGGAGTGCAGAGG + Intergenic
1087683841 11:101241632-101241654 CTGCTTGCGCAGAAGTGTGGAGG - Intergenic
1089291465 11:117439960-117439982 GTGCAGGGGTAGAAGTGGAGTGG - Intronic
1090053362 11:123400607-123400629 CCTCATGTGCAGAAGTGGTGAGG + Intergenic
1090234340 11:125136196-125136218 GAGCAGAAGCAGAAGTGGAGAGG - Intergenic
1090554144 11:127855758-127855780 CTCCATGAGCAGAAGAGCAGAGG - Intergenic
1090590441 11:128261525-128261547 CTCCATGAGCAGAAGAGCAGAGG - Intergenic
1091320645 11:134646900-134646922 CTCCAGGTGCAGAAGGGGAGGGG + Intergenic
1092956054 12:13551242-13551264 CATCATGAGCAGAGGTGGAGAGG - Exonic
1092960737 12:13594716-13594738 GTGGAAGGGCAGAAGTGGAGTGG + Intronic
1093155996 12:15686124-15686146 CTGAGGGAGAAGAAGTGGAGGGG - Intronic
1093749259 12:22779717-22779739 CTCCATGAGCAGAAGAGCAGAGG - Intergenic
1094038243 12:26093798-26093820 CTGCATGTGCAGAGGTGGGCAGG + Intergenic
1095049311 12:37542627-37542649 CTCCACGAGCATAAGGGGAGGGG - Intergenic
1095628387 12:44344794-44344816 CAGCATGAGTAGAAAAGGAGAGG - Intronic
1095696635 12:45151203-45151225 TTGCATGACCTGAAGTGCAGTGG - Intergenic
1096255320 12:50058671-50058693 CTGGATGGGCACATGTGGAGGGG + Intronic
1096436323 12:51592906-51592928 GTGCATTAGAAGATGTGGAGGGG + Intronic
1098062195 12:66574733-66574755 CTGCAAGAGGACAAGTAGAGTGG - Intronic
1098554606 12:71804279-71804301 CTCCATGAGCAGAAGAACAGAGG + Intergenic
1099260955 12:80382309-80382331 CTGCATGAGCAGAAGTGGAGTGG - Intergenic
1101342714 12:103857527-103857549 CTGCCTGGGCAGAAGTGTGGAGG + Intergenic
1102137597 12:110588145-110588167 CTGCCTAAGCTGAAGTGCAGTGG - Intergenic
1102190018 12:110980685-110980707 CTGCATATGTGGAAGTGGAGGGG + Intergenic
1102205000 12:111084192-111084214 CTGAATCAGCAGGAGTGGAGTGG + Intronic
1102564059 12:113783116-113783138 CTGCAGGAGGAGAAGTGGAGAGG - Intergenic
1102892213 12:116568697-116568719 CTTTATGAGCAGAGGAGGAGAGG + Intergenic
1103726036 12:122997799-122997821 CTGCAGGAGGAGGAGTGGACAGG - Intronic
1104121682 12:125805937-125805959 CTGCATTGGCAGAAGGTGAGGGG + Intergenic
1106004188 13:25753195-25753217 CTGTATGAGCAAAAGTGGCAGGG + Intronic
1106205261 13:27587291-27587313 CAGCAGGAGCAGAAGGGAAGGGG - Intronic
1106641394 13:31587858-31587880 CTGCATCCTCAGAAGGGGAGGGG - Intergenic
1107012309 13:35680957-35680979 CTTCATGATCTGAAGTGGGGCGG + Intergenic
1107157117 13:37181370-37181392 CTGCATGGGTGGAAGAGGAGTGG + Intergenic
1107161003 13:37227624-37227646 ATATATGAGCAGAAGTGAAGGGG + Intergenic
1107574462 13:41702825-41702847 CAGCAGGAACAGAAGTTGAGGGG - Intronic
1110049289 13:70874090-70874112 ATCCAGGAGCAGCAGTGGAGTGG - Intergenic
1110470035 13:75849151-75849173 CATCAGGAGCAGAATTGGAGAGG + Exonic
1110895697 13:80749586-80749608 CAGCATGAGCAGAACTAGAGTGG + Intergenic
1111929950 13:94502816-94502838 CTGCATGAGCAGATGTGGTCTGG - Intergenic
1112469500 13:99674693-99674715 ATGCGTAAGAAGAAGTGGAGGGG + Intronic
1112551260 13:100423216-100423238 CTGAAGGGGCAGATGTGGAGTGG - Intronic
1112634284 13:101197913-101197935 CTGCATGAACAGAATTTAAGTGG + Intronic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1115664227 14:35530185-35530207 CTGAATGAGGAAAAGAGGAGTGG + Intergenic
1117167367 14:53050223-53050245 CAGCATGAGCAAAACTGCAGAGG + Intronic
1118901131 14:69986888-69986910 CTGTAGGAGCAGAAGTGGTCGGG - Intronic
1120137195 14:80884503-80884525 GTGGATGAGCAGAAGTAGGGTGG + Intronic
1121281836 14:92704759-92704781 CTGCAATTGCAAAAGTGGAGTGG - Intronic
1121914181 14:97820914-97820936 GTGCATCAGGAGAAGTGCAGGGG + Intergenic
1122197126 14:100096716-100096738 CTGAAAGAGCAGAAGTTTAGAGG + Intronic
1122489101 14:102101493-102101515 CAGCATAAGCAAAAGTGGGGAGG - Intronic
1122847505 14:104507937-104507959 CTGCCTGGGCAGAAGCTGAGAGG + Intronic
1123948924 15:25252157-25252179 CTCCATGAGAAGAAGTGGGAAGG - Intergenic
1124183390 15:27499801-27499823 CTCCATAAGCAGATGTGGATGGG + Intronic
1125555186 15:40578857-40578879 CTGCCTGAGCAGAAGTCAAAGGG - Intergenic
1127330222 15:57931768-57931790 CAACATGAGGGGAAGTGGAGGGG - Intergenic
1127977282 15:64006981-64007003 CTGCATGGGCTGCAGGGGAGAGG + Intronic
1128655144 15:69455265-69455287 CTGGAGCAGCAGCAGTGGAGGGG - Exonic
1129462518 15:75706701-75706723 CAGCTTGAGTAGAAGTGGAAAGG + Intronic
1129722345 15:77884713-77884735 CAGCTTGAGCAGAAGTGGAAGGG - Intergenic
1130408369 15:83623489-83623511 CTGCAGGAGCACAGGTGGAAAGG + Intergenic
1130622259 15:85475921-85475943 TGGCATGAGCAGTAGTGGTGTGG + Intronic
1131457118 15:92590235-92590257 CTGGATGAGCAGGAGTCCAGGGG - Intergenic
1131935653 15:97501452-97501474 CTGCAGAAGCAGAAGTCAAGTGG - Intergenic
1133436748 16:5786360-5786382 CTACATGAGCAGCAGAGGAATGG - Intergenic
1134112617 16:11524638-11524660 GGGCATGAGCAGATGTGGTGAGG + Intergenic
1134509488 16:14834597-14834619 CTCCATTTTCAGAAGTGGAGGGG - Intronic
1134582481 16:15382278-15382300 CTCCCTCAGCAGAAGTGGTGAGG - Intergenic
1134697193 16:16233412-16233434 CTCCATTTTCAGAAGTGGAGGGG - Intronic
1134974653 16:18561273-18561295 CTCCATTTTCAGAAGTGGAGGGG + Intronic
1135612872 16:23883647-23883669 CTGCACGGGCAGCAGTGCAGAGG + Intronic
1139392628 16:66614538-66614560 CTGGGTGTGCAGGAGTGGAGAGG + Intergenic
1140123521 16:72102765-72102787 CAGAGTGAGCAGAAGAGGAGTGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143037209 17:4006246-4006268 GTGCATGAGCAGACGTACAGGGG + Exonic
1143375372 17:6464035-6464057 CTGCATGGACAGAGGTGGATGGG - Intronic
1143585514 17:7848511-7848533 CAGCAGGAGCAGTAGTGGTGGGG - Exonic
1144467634 17:15509068-15509090 ATGCATGAGCAAATGTGGAAGGG + Intronic
1144531654 17:16044861-16044883 CTGGAGCAGCAGCAGTGGAGTGG - Intronic
1146931662 17:36782370-36782392 CTGCAGGAGAGGAAGAGGAGAGG - Intergenic
1147108519 17:38242147-38242169 CTGCATGTGCATATGTGGGGGGG - Intergenic
1148804640 17:50257986-50258008 CTGCCTCAGCTGAAGTGGAGGGG + Intergenic
1151401556 17:73858988-73859010 CTCCACGAGCAGGAGGGGAGGGG - Intergenic
1151496335 17:74460376-74460398 CTGCATGTCTAGAAGTGGAGAGG - Intergenic
1152290626 17:79437869-79437891 CTTCATGAGCAGACCTGGAGAGG + Intronic
1152928581 17:83099022-83099044 CTGCCTGCACAGAAGGGGAGCGG - Intergenic
1153465335 18:5381931-5381953 CTCCATTAGCAGAAGTGGTTGGG - Intergenic
1153681479 18:7504981-7505003 CTCCATGAGCAGAAGAGCAGAGG - Intergenic
1153752296 18:8245168-8245190 CTGGAAGAGGAGGAGTGGAGGGG - Intronic
1153964256 18:10166161-10166183 CCGCATGAGCCGAGGTGCAGAGG + Intergenic
1154957174 18:21270308-21270330 TTGCATGAGCAGAGATGTAGAGG + Intronic
1155576018 18:27247843-27247865 CTGCATGAGCCGGCGTGAAGAGG - Intergenic
1156657122 18:39301770-39301792 CTACATGAGTACAATTGGAGTGG - Intergenic
1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG + Intergenic
1157105522 18:44771150-44771172 CTGCATCAGTAGATCTGGAGTGG - Intronic
1158329663 18:56347582-56347604 CTGTTTGAGCAGTATTGGAGAGG + Intergenic
1158513157 18:58109410-58109432 CAGCATGTGCAGAAGTCTAGAGG + Intronic
1160591229 18:79945683-79945705 CTGCAGGAGCAGGAGTGCAGGGG + Intronic
1161484218 19:4525988-4526010 GTGGGTGAGCAGATGTGGAGGGG - Intronic
1161740602 19:6018821-6018843 CTGCAGGAGCAGAGCTGGAGGGG - Intronic
1162757230 19:12867615-12867637 CTGCGTGAGAAGACCTGGAGAGG + Exonic
1163145300 19:15375674-15375696 TTGCATGGGCTGAAGTGCAGTGG + Intronic
1163627686 19:18399750-18399772 CTGCATAGGCTGGAGTGGAGTGG - Intergenic
1166390886 19:42408164-42408186 CTGCTTGGGCAGGAGTGGGGAGG + Intronic
1167615485 19:50530561-50530583 CTGCAGGTGCAGAGGTGGAGAGG + Intronic
1168463291 19:56580421-56580443 ATCCATCAGCAGAAGTGAAGAGG + Exonic
925574689 2:5348902-5348924 GAGCATGAGCAGGTGTGGAGGGG + Intergenic
926058635 2:9791581-9791603 ATGCATGAAGAGAGGTGGAGAGG + Intergenic
926391341 2:12396587-12396609 CTGCATGTGCATAACTGAAGAGG + Intergenic
926996232 2:18739249-18739271 CTGCATTGGCACTAGTGGAGGGG - Intergenic
927282164 2:21318345-21318367 CTACATCAGCAGAGTTGGAGGGG - Intergenic
927477922 2:23428227-23428249 CTGCATGGGCAGAAATGTAGGGG + Intronic
928791145 2:34955666-34955688 CTGCCCAAGCAGAAGTGCAGTGG - Intergenic
929471306 2:42196760-42196782 CTGCATGGGCAGAGGGGGAAGGG - Intronic
929888073 2:45896005-45896027 CTGGATGCGCAGGAGTGGGGTGG + Intronic
929948487 2:46388494-46388516 CTGCATGATCAGAAGGGGCAGGG - Intergenic
930031481 2:47060746-47060768 CTGCAAAAGCAGAAGGGCAGTGG - Intronic
931803622 2:65782849-65782871 GTGGATGAGAAGAAGTGGATTGG - Intergenic
931931137 2:67135381-67135403 TGCCATGAGCAGAATTGGAGGGG - Intergenic
932113713 2:69025333-69025355 TTGCATGACAAGCAGTGGAGTGG + Intronic
933141310 2:78794926-78794948 GTGCCTGAGCGGAAGAGGAGAGG + Intergenic
934606374 2:95698660-95698682 TAGCATGGGCAGAAGTGGGGTGG + Intergenic
935390085 2:102541834-102541856 CTGAATCAGCAGATGTGGGGTGG + Intergenic
936746281 2:115580533-115580555 CTGCAGGAGCACATGTGAAGAGG - Intronic
936931176 2:117790377-117790399 GTGCGTGAGTAGAAGGGGAGAGG - Intergenic
937619645 2:123970952-123970974 CTGCAGGAGTAGAATTTGAGAGG - Intergenic
938067244 2:128287770-128287792 TTCCATGAGCAGAAGGGGTGAGG + Intronic
938248707 2:129797670-129797692 CAGCAGGGGCAGAAGTGGATAGG + Intergenic
938678780 2:133667354-133667376 CTGAATCAGCAGAGATGGAGTGG - Intergenic
941713452 2:168739338-168739360 CACCATGAGCAAAAGCGGAGAGG + Intronic
942465227 2:176200988-176201010 CTGGAGCAGCAGCAGTGGAGGGG + Intergenic
942583603 2:177449460-177449482 CTGCCTGAGCTGGAGTGCAGTGG + Intronic
943426968 2:187749729-187749751 CAGGATGACCAGATGTGGAGAGG - Intergenic
943477643 2:188378611-188378633 CTGCATGAGCAGAGATGGTATGG + Intronic
945019572 2:205557440-205557462 CTGCAGGAGCAGAAGTTGAGGGG - Intronic
945571954 2:211479266-211479288 TTGCAGGAGCAGAAATAGAGGGG - Intronic
945719095 2:213396579-213396601 CTCCATCAGCAGCAGTGGACAGG + Intronic
947127399 2:226884191-226884213 CTGCACAAGCAGAAGAGGAAAGG - Intronic
947476049 2:230448678-230448700 AAGCATGAACAGATGTGGAGAGG + Intronic
947489616 2:230582216-230582238 AAGCATGAACAGATGTGGAGAGG - Intergenic
947729655 2:232420882-232420904 CTGCCTGAGCAGGAGCGAAGCGG + Intergenic
948101713 2:235379880-235379902 TAGCATCAGCAAAAGTGGAGGGG + Intergenic
948361240 2:237422016-237422038 CAGCAGGCGCAGAAGTGGAGGGG + Intronic
948856154 2:240731650-240731672 GCCCATGAGCAGAGGTGGAGGGG - Intronic
1169282483 20:4279482-4279504 ATGCAGGTGCAGGAGTGGAGTGG - Intergenic
1170415036 20:16130492-16130514 CTGCAGGAACTGAAGTGGGGAGG - Intergenic
1171292490 20:23990268-23990290 CTGCAGGAGCAGAAGTGCCAGGG - Intergenic
1171533511 20:25867208-25867230 CTCCATGGGCATAAGGGGAGGGG + Intronic
1171543840 20:25986127-25986149 CTCCACGAGCATAAGAGGAGGGG - Intergenic
1172240117 20:33407602-33407624 GTGCATGAGCAGTATTGGAATGG + Intergenic
1174110638 20:48195575-48195597 CCACATGAGCAGAAGTGAGGAGG - Intergenic
1176980473 21:15375726-15375748 CTCCATGAGCAGAAGATAAGAGG + Intergenic
1178765158 21:35443641-35443663 CTGCATGTGCTGAAATGGAAAGG - Intronic
1178767891 21:35471534-35471556 CTGCAGGACCAGGAGTGCAGGGG - Intronic
1179048168 21:37865419-37865441 CTGCATGGGCAGGAGAGGAAAGG + Intronic
1180854086 22:19035579-19035601 CTGCTGGGGCAGGAGTGGAGTGG - Intergenic
1182112710 22:27734643-27734665 CTGTGTGTGCAGAAGTGGATGGG - Intergenic
1182880672 22:33730636-33730658 ATGAATGATGAGAAGTGGAGAGG + Intronic
1183635770 22:39061574-39061596 CAGCCTGAGGAGAAGAGGAGAGG + Intronic
1184040010 22:41937333-41937355 CTGCCTGGGCTGAAGTGCAGTGG + Intergenic
1184717741 22:46291421-46291443 CTGCATTAGGAGACGTGGAGGGG + Intronic
1184876858 22:47281785-47281807 CTGCCTGTGCAGAAGAGGTGGGG - Intergenic
1185194806 22:49462444-49462466 CTGCGTTAGCAGAGGGGGAGCGG - Intronic
949185640 3:1188213-1188235 CTGCATCCCCAGAACTGGAGGGG + Intronic
950457566 3:13101738-13101760 CTGGATGGGTAGCAGTGGAGTGG + Intergenic
950744163 3:15073767-15073789 CTGACTGACCAGCAGTGGAGAGG - Exonic
951089263 3:18553193-18553215 CTTCATGAGCAGATATGGAAAGG - Intergenic
951570970 3:24062880-24062902 CTGCCTAAGCAGAAGTTGAAAGG + Intergenic
952747056 3:36791368-36791390 CAGAATCAGCAGAAGAGGAGTGG - Intergenic
953344029 3:42160200-42160222 CTGGCTCAGCTGAAGTGGAGGGG - Intronic
953441861 3:42925128-42925150 CTGGAGCTGCAGAAGTGGAGAGG + Intronic
953702138 3:45204846-45204868 CTTGATGATCAGAAGGGGAGTGG - Intergenic
954961871 3:54572574-54572596 TTTCCTGAGCAGAAGTGAAGAGG + Intronic
955488301 3:59457095-59457117 GTGGATGATCAGAGGTGGAGAGG - Intergenic
956971444 3:74531250-74531272 AAGCATTATCAGAAGTGGAGTGG + Intergenic
958497597 3:94864508-94864530 CAGCCTGAGGGGAAGTGGAGAGG + Intergenic
958979409 3:100703916-100703938 TTGCATGGGGAGAAGTGCAGAGG + Intergenic
959382199 3:105654431-105654453 CATCATGAGCAGAAGAGGATGGG - Intergenic
960292030 3:115897426-115897448 CTCCATGAAGAGAAGAGGAGAGG + Intronic
961321423 3:126078976-126078998 TTGCATCAGGAGAAGAGGAGGGG - Intronic
961353119 3:126316506-126316528 GTGCATGAGCTGCAGTGGGGAGG + Intergenic
963461547 3:145620069-145620091 CTGCATGATATGAAGGGGAGAGG + Intergenic
963579720 3:147110153-147110175 CTTTATGTGTAGAAGTGGAGAGG + Intergenic
964032941 3:152160402-152160424 CAGCCTAAGCAGGAGTGGAGAGG - Intergenic
965420343 3:168450020-168450042 CTGCAGGAGCACAAGTGGTGAGG - Intergenic
965898618 3:173611102-173611124 GTGCATGGGCAGAAGTATAGTGG + Intronic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
966450472 3:180053792-180053814 CAGGATGAGAAGCAGTGGAGTGG - Intergenic
966774518 3:183532222-183532244 GTGCGTGAGCAGGAGTGGTGAGG - Intronic
967051802 3:185791874-185791896 CTGCCTTAGCAGAGGTGTAGTGG - Intronic
968422862 4:499754-499776 CTGGACGAGTAGAAGTGGAGAGG - Intronic
968889616 4:3361530-3361552 GCGCATGAGCAGAAATGGCGAGG + Intronic
969155845 4:5209089-5209111 CTCCATGTGCAGAAGTGCTGAGG - Intronic
969195996 4:5564296-5564318 CTGCACTAATAGAAGTGGAGTGG - Intronic
970209620 4:13695786-13695808 GTTCAGGAGCAGAAGTGGAATGG + Intergenic
971465702 4:26957751-26957773 CTAGATGTGCAGAAGGGGAGGGG - Intronic
971813044 4:31452596-31452618 TGGCAGGAGCAGAGGTGGAGAGG - Intergenic
972134658 4:35877094-35877116 CTGAATGAGCTGAAGTGAACTGG + Intergenic
973193147 4:47409539-47409561 CTCCATGAGCAGAAGAGCAGAGG - Intronic
973303948 4:48622452-48622474 CTGCTTTGGCAGAACTGGAGTGG + Intronic
973918378 4:55659647-55659669 CTGCCTGGGCTGAAGTGCAGTGG - Intergenic
979439405 4:120733639-120733661 CTGCATACCCAGAAGGGGAGTGG - Intronic
979466037 4:121039692-121039714 CGGCTTGAGGAGAAGGGGAGAGG - Intronic
980252466 4:130335557-130335579 CAACATGAGCAGGAGTGGAGAGG + Intergenic
981373483 4:143987191-143987213 CTCCATGAGCAGAAGATCAGAGG + Intergenic
981544203 4:145877936-145877958 ATGTATGAGCAGCAATGGAGTGG + Intronic
982103628 4:151992643-151992665 CTTCAGGAGCAGAGGTGGAAGGG - Intergenic
983059587 4:163142868-163142890 CTGTATGAGGAGAAGTGGGCCGG - Intronic
983373682 4:166897439-166897461 CTGCATGAGCAAAGGTTGGGTGG + Intronic
983655147 4:170075372-170075394 CTGCCTGGGCTGAAGTGCAGTGG + Intronic
984562715 4:181289875-181289897 CTGCAAGAGCAAAGGTGCAGTGG - Intergenic
985289256 4:188370999-188371021 CTGCATTTGCAGAAGTGAAAGGG - Intergenic
985480502 5:107502-107524 CTGCATGAGCAGATGGGTAAGGG - Intergenic
985908828 5:2863545-2863567 CTCCGTGTGCAGTAGTGGAGAGG + Intergenic
985998362 5:3610524-3610546 CTGTTTCAGCAGGAGTGGAGTGG + Intergenic
986785243 5:11108215-11108237 CAGCATGAACAGAAGCGTAGAGG + Intronic
986789059 5:11143041-11143063 CTGAGTGAGCAGAAGTCAAGGGG - Intronic
986976884 5:13405212-13405234 TTGCATGAGAGGAGGTGGAGTGG + Intergenic
987131371 5:14863266-14863288 CTGCATGACCAGTAGTGTTGTGG - Intronic
988335812 5:29908077-29908099 CTGAAGGAGCAGAGGGGGAGGGG - Intergenic
990987464 5:61654387-61654409 CTGCATGAGCAGGAGAGGCCAGG + Intronic
991547622 5:67800817-67800839 CTGCAGAAGCAGATGAGGAGAGG + Intergenic
992158226 5:73975455-73975477 CTGCCTGCGCTGAAGGGGAGGGG + Intergenic
992299328 5:75362403-75362425 CTGTGTGAGCTGAATTGGAGAGG + Intergenic
992608218 5:78483624-78483646 GTGACTGATCAGAAGTGGAGAGG - Intergenic
993867354 5:93211259-93211281 CTCCATGACCAGATGAGGAGAGG - Intergenic
994395996 5:99226223-99226245 CCTAATAAGCAGAAGTGGAGAGG - Intergenic
994396216 5:99227647-99227669 CCTAATAAGCAGAAGTGGAGAGG - Intergenic
996710141 5:126535659-126535681 CTCCACGAGCAGAAGAGCAGAGG - Intergenic
996720762 5:126628094-126628116 CTGAAGCAGCAGCAGTGGAGGGG + Intergenic
996726675 5:126678710-126678732 TTGCCTGAGCAGGAGTGCAGTGG - Intergenic
998022928 5:138786610-138786632 ATCCATGAGAAAAAGTGGAGTGG - Intronic
998628874 5:143876501-143876523 CTGAATGAGCAGAAGTGAACTGG + Intergenic
998750770 5:145319064-145319086 CTCCATGAGCAGAGGAGCAGAGG - Intergenic
1002854350 6:1024088-1024110 CTGCATGAGAGAAAGTGGAGAGG + Intergenic
1002882061 6:1261950-1261972 CTACAAGGGCAGAAGTGGGGTGG - Intergenic
1003591047 6:7437139-7437161 CTGCATGAACAGAAAGGGTGTGG + Intergenic
1003701143 6:8466571-8466593 AAGCATGAGAAGAAATGGAGAGG + Intergenic
1004440117 6:15641969-15641991 CTGCATCAGCAACAGTGTAGGGG - Intronic
1005342682 6:24858099-24858121 CTGCAAAAGCAGGAGGGGAGAGG - Intronic
1007071057 6:39038450-39038472 CTTCATGAACAGATGTGGAAGGG - Intergenic
1007228196 6:40329305-40329327 CAGCATGAGCAGAGGTTGGGAGG + Intergenic
1007301140 6:40868807-40868829 GTGCATGAGGAGGAGTGGAAAGG - Intergenic
1007381642 6:41494015-41494037 GGGCATGAGCAGGTGTGGAGGGG - Intergenic
1009624928 6:66126897-66126919 CTTCATGGGCAGGGGTGGAGGGG - Intergenic
1010387694 6:75301557-75301579 TAGCATTAGCAGAAGTAGAGAGG + Intronic
1011220306 6:85048185-85048207 CTGCATGAGCAAAAATGGGGAGG - Intergenic
1019581780 7:1767789-1767811 CTGCATGAGCAGACGGGGGTGGG - Intergenic
1021827668 7:24571751-24571773 CTGGATGAAATGAAGTGGAGTGG - Intergenic
1023615584 7:42016297-42016319 CTGCAAGAGAAGAACTGGAGCGG - Intronic
1023806341 7:43875569-43875591 CTGGATGGGCAGAGCTGGAGCGG - Intronic
1023862601 7:44225265-44225287 CTGCCCTTGCAGAAGTGGAGGGG - Intronic
1025003447 7:55337306-55337328 CTCCATAAGCAGAAGAGCAGGGG - Intergenic
1025295213 7:57771206-57771228 CTCCACGAGCACAAGGGGAGGGG - Intergenic
1026320552 7:69264161-69264183 CCACATGGGCAGAAGTGAAGTGG - Intergenic
1026429132 7:70326296-70326318 CTGCCTTGGGAGAAGTGGAGAGG - Intronic
1028964252 7:96784101-96784123 CAGCATGAGCAGAATTGTAGTGG + Intergenic
1029271411 7:99379327-99379349 CTTCAAGAGCAGAGCTGGAGAGG + Intronic
1029685815 7:102147203-102147225 CTGCTTTGGCAGAAGTAGAGGGG - Intronic
1030068479 7:105678745-105678767 CGGCCTGAGAAGGAGTGGAGTGG - Intronic
1031643320 7:124191972-124191994 CAGCATGAGCAGGAGTGCATGGG - Intergenic
1031835424 7:126675787-126675809 CTGAATGGGCAGAAGTTGAAAGG + Intronic
1032437314 7:131910717-131910739 CTGCAGGAGCAGAAGCGAAGGGG - Intergenic
1033649311 7:143328873-143328895 CTGGATGAGCAGGGGAGGAGAGG - Intronic
1034000557 7:147407897-147407919 AGGCATGAGCAGAAGTGTGGAGG + Intronic
1035034566 7:155886486-155886508 AAGCATGCGCAGACGTGGAGAGG + Intergenic
1035218004 7:157384613-157384635 CTGCATGAGGAGAGGGGGAGGGG + Intronic
1035418749 7:158709867-158709889 CTGCAGGGGCAAAAGTGAAGAGG + Intergenic
1036474968 8:9084832-9084854 CTGAAGAAGCTGAAGTGGAGAGG + Intronic
1036529945 8:9575861-9575883 CTGCTTGATAAGAAGTGTAGTGG + Intronic
1037073311 8:14680179-14680201 TTGCAAGAGGTGAAGTGGAGGGG + Intronic
1037425628 8:18751419-18751441 CTTCTGGAGCAGAAGGGGAGCGG + Intronic
1037426117 8:18756697-18756719 CTTCTGGAGCAGAAGGGGAGCGG + Intronic
1037739254 8:21592290-21592312 CAGCATGAGCAGAAGGACAGAGG + Intergenic
1039212919 8:35236217-35236239 CGGCTTGAGAGGAAGTGGAGAGG - Intronic
1039416946 8:37403652-37403674 CTGCATGGGCAGCTGTGGTGTGG - Intergenic
1039416955 8:37403739-37403761 CTGCATGGGCAGCTGTGGTGTGG - Intergenic
1039416964 8:37403826-37403848 CTGCATGGGCAGCTGTGGTGTGG - Intergenic
1039447705 8:37646043-37646065 CAGCAAGAGCAGTTGTGGAGAGG + Intergenic
1040988042 8:53317832-53317854 CTGCATGCTCAGAAGTGGCCTGG - Intergenic
1042190162 8:66177918-66177940 CAGCAAGGGCAGAAGTGGAGAGG - Intronic
1042863053 8:73333045-73333067 AGGCATGAGCAGAACAGGAGAGG + Intergenic
1045036170 8:98178196-98178218 CTGCATGAGCAGATGGGAACTGG - Intergenic
1045320681 8:101079787-101079809 CTGGAAGAGCAGCAGGGGAGGGG + Intergenic
1046149749 8:110208135-110208157 CGGCATGTGCAGAAGTACAGTGG + Intergenic
1047573133 8:126122761-126122783 CTGCTTCTGGAGAAGTGGAGGGG + Intergenic
1047724383 8:127671365-127671387 CTGCATAAGCAGAGGTGTGGAGG - Intergenic
1048732594 8:137460455-137460477 CTGCATAGGTAGAAGTTGAGTGG + Intergenic
1049281933 8:141753820-141753842 CTGAATGAACAAAAGGGGAGAGG - Intergenic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1049986130 9:953615-953637 CAGCTTAAGCAGCAGTGGAGAGG - Intronic
1052113488 9:24619255-24619277 CTCCATGAGCAGAAGAGCAGAGG - Intergenic
1054458505 9:65449566-65449588 GTGCAGGTGCAGAAGTGCAGAGG + Intergenic
1055515601 9:77030231-77030253 CTGACTCAGCAGATGTGGAGTGG + Intergenic
1056834781 9:89945483-89945505 CTTCACCATCAGAAGTGGAGGGG + Intergenic
1057711222 9:97446947-97446969 CAGCAGAAGCAGAAGTGAAGAGG + Intronic
1058900464 9:109438108-109438130 CTGCATGAGCAGCACAGGTGAGG - Exonic
1059023299 9:110598938-110598960 CCCCATGAGCAGGAGTGGATCGG + Intergenic
1059556048 9:115281592-115281614 CTGAATGAGCAGAATAGGTGGGG + Intronic
1060207525 9:121690912-121690934 CAGCATAAGCAGAGGTGTAGAGG - Intronic
1060778238 9:126392408-126392430 CTGAATGCGCAGAAGGGCAGGGG - Intronic
1060785835 9:126451085-126451107 CTGCATCACCAGAAGAGCAGGGG + Intronic
1060962837 9:127693354-127693376 CAGCAGGAGCAGAGGAGGAGAGG - Intronic
1061311496 9:129766175-129766197 GTGCAAGAGCAGAAGATGAGAGG + Intergenic
1061889679 9:133611601-133611623 CAGCATGGGGAGAAGTGGAAGGG - Intergenic
1185961804 X:4552777-4552799 CTCTATGAGCAGAAGAGCAGAGG - Intergenic
1187103870 X:16220883-16220905 CAGCTTGAGGAGAAGGGGAGAGG + Intergenic
1188981661 X:36732386-36732408 CAGAATGTGCATAAGTGGAGTGG - Intergenic
1190039438 X:47057926-47057948 CTGAAAGAGCAGAGGTGAAGAGG + Intronic
1190777266 X:53562912-53562934 TTCAGTGAGCAGAAGTGGAGAGG - Exonic
1191750511 X:64536993-64537015 CTCCATGGGCTGAAATGGAGTGG + Intergenic
1196723303 X:118874943-118874965 CTGCATTCACAGAACTGGAGAGG + Intergenic
1197188908 X:123622521-123622543 CCTCATGAGTAGAAGGGGAGTGG - Intronic
1198853931 X:140996000-140996022 CTCCATGAGCAGACGAGCAGAGG - Intergenic
1198878083 X:141249106-141249128 CTCCATGAGCAGACGAGCAGAGG + Intergenic
1200007075 X:153093909-153093931 TAGCCTGAGGAGAAGTGGAGAGG + Intergenic
1201119293 Y:10860745-10860767 CGGAATGAAAAGAAGTGGAGTGG - Intergenic
1201137378 Y:11000235-11000257 CTGAATGGGCTGGAGTGGAGTGG - Intergenic
1201725982 Y:17152630-17152652 CTCCATGAGCAGAATTGCAGAGG - Intergenic