ID: 1099261840

View in Genome Browser
Species Human (GRCh38)
Location 12:80392047-80392069
Sequence CACATATAGAACTATTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099261840_1099261842 3 Left 1099261840 12:80392047-80392069 CCAACCTAATAGTTCTATATGTG No data
Right 1099261842 12:80392073-80392095 TAGCTGTAACCCTTACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099261840 Original CRISPR CACATATAGAACTATTAGGT TGG (reversed) Intergenic
No off target data available for this crispr