ID: 1099265555

View in Genome Browser
Species Human (GRCh38)
Location 12:80442349-80442371
Sequence TTGGTTAGACGGATCAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099265552_1099265555 8 Left 1099265552 12:80442318-80442340 CCTCACACAAATCAGTAAATGTG 0: 1
1: 0
2: 12
3: 39
4: 338
Right 1099265555 12:80442349-80442371 TTGGTTAGACGGATCAGTCATGG 0: 1
1: 0
2: 0
3: 4
4: 41
1099265550_1099265555 28 Left 1099265550 12:80442298-80442320 CCTGAAGCAATAGTATTAACCCT 0: 1
1: 0
2: 2
3: 9
4: 108
Right 1099265555 12:80442349-80442371 TTGGTTAGACGGATCAGTCATGG 0: 1
1: 0
2: 0
3: 4
4: 41
1099265549_1099265555 29 Left 1099265549 12:80442297-80442319 CCCTGAAGCAATAGTATTAACCC 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1099265555 12:80442349-80442371 TTGGTTAGACGGATCAGTCATGG 0: 1
1: 0
2: 0
3: 4
4: 41
1099265551_1099265555 9 Left 1099265551 12:80442317-80442339 CCCTCACACAAATCAGTAAATGT 0: 1
1: 0
2: 0
3: 19
4: 286
Right 1099265555 12:80442349-80442371 TTGGTTAGACGGATCAGTCATGG 0: 1
1: 0
2: 0
3: 4
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099265555 Original CRISPR TTGGTTAGACGGATCAGTCA TGG Intronic
901659801 1:10791777-10791799 TAGGTTAAACAGATCATTCAAGG - Intronic
904910347 1:33929926-33929948 TACTTTAGACGGAGCAGTCAGGG - Intronic
907657174 1:56356129-56356151 TTTGTTAGACGGGTGAGTCAAGG - Intergenic
911806771 1:102220204-102220226 TTTGTGAAACTGATCAGTCAAGG + Intergenic
912227989 1:107757977-107757999 TTAGTTGGACGGATGAGTCCGGG - Intronic
915630325 1:157149208-157149230 TTGGTTAGAGACACCAGTCATGG + Intergenic
918030061 1:180799031-180799053 TTGGTAATCAGGATCAGTCAAGG + Intronic
919289161 1:195606229-195606251 TTGGTTATGTGGATCAATCATGG + Intergenic
921971948 1:221159551-221159573 TGGGTTAAACAGATCAGACATGG + Intergenic
1066497167 10:35953792-35953814 TTAGATAGACAGATCAGACAAGG + Intergenic
1076523818 10:131097994-131098016 TTGGTTATTTGGGTCAGTCAGGG + Intronic
1079941171 11:26682492-26682514 TTGGTTAGTAGGATCAGCTATGG + Intronic
1083489709 11:63007270-63007292 TTGATGAGACGGATCAGCCAAGG - Intronic
1089611637 11:119672615-119672637 TGGGTTAGACTGAGCATTCAGGG - Intronic
1089777693 11:120850078-120850100 TTGATGAGATGGAGCAGTCATGG - Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1099265555 12:80442349-80442371 TTGGTTAGACGGATCAGTCATGG + Intronic
1101512227 12:105403630-105403652 TTTGATAGGCGGATGAGTCATGG - Intergenic
1103034440 12:117645028-117645050 TTGGTTAGAGTGATCAGTTCAGG + Intronic
1106530155 13:30583165-30583187 ATGCTTAGAAAGATCAGTCAGGG - Intronic
1109769672 13:66954529-66954551 TTGGTAAGTCTGATCATTCAAGG - Intronic
1126506972 15:49416295-49416317 TTTGTTAGATGGATGAATCAAGG + Intronic
1146625473 17:34431897-34431919 TGTGTTAGAGAGATCAGTCATGG - Intergenic
1146933875 17:36797846-36797868 TTTGTTAAATGTATCAGTCAAGG - Intergenic
1168056345 19:53867221-53867243 TTGGGGAGACCCATCAGTCAGGG + Intronic
927462235 2:23309305-23309327 TAGGTTAGAGGAATCAGACATGG + Intergenic
930916437 2:56695021-56695043 TTGGTGAAATTGATCAGTCAAGG - Intergenic
932302016 2:70674138-70674160 TTGGCTAGCCTGATCAGTCCCGG - Intronic
938628798 2:133142209-133142231 TTGGTTAACCACATCAGTCAAGG + Intronic
943798258 2:192025894-192025916 TTGGTTAAATAGTTCAGTCAGGG - Intronic
944076490 2:195737978-195738000 TTGGTCAGAGGGAAGAGTCATGG + Exonic
954211907 3:49102525-49102547 TTGGTGGGTAGGATCAGTCAGGG - Intronic
956787567 3:72655265-72655287 TTGTTTAGACAGAGCAATCAAGG + Intergenic
971311632 4:25530230-25530252 TTGCTGAGATGGAGCAGTCATGG + Intergenic
988240791 5:28605482-28605504 TTTGTTACACAGATCAGTAAAGG - Intergenic
1000967384 5:167674430-167674452 TTTGTTAGAGGCATCAGTTATGG - Intronic
1001270687 5:170309497-170309519 TTGCTTAGACGAAACAGTCAAGG + Intergenic
1017328482 6:153168547-153168569 TTGGTTAAACGAAACTGTCATGG - Intergenic
1020964654 7:14849788-14849810 TTGGTGAGACTGATCAGTGGTGG - Intronic
1032811315 7:135421057-135421079 TTAGTAAGAAGGATCTGTCATGG - Intronic
1034416236 7:150965641-150965663 TGGGTCAGACGGAGCAGTCAAGG - Intronic
1035027410 7:155835083-155835105 TTGGTGGGAAGGAGCAGTCAGGG + Intergenic
1050507715 9:6364710-6364732 AGGGTTAGACGGATCTGTAAAGG + Intergenic
1061673304 9:132201423-132201445 TGGGTTAGACGGTTCAGCGAAGG + Intronic
1189352443 X:40286184-40286206 TTGGTTAGACACATGAGCCATGG + Intergenic
1198227024 X:134654533-134654555 GTGGTTATATGGAACAGTCAGGG + Intronic