ID: 1099265620

View in Genome Browser
Species Human (GRCh38)
Location 12:80443083-80443105
Sequence TGCTGCCTGTACCTCCTCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099265620_1099265623 23 Left 1099265620 12:80443083-80443105 CCTTCGAGGAGGTACAGGCAGCA 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1099265623 12:80443129-80443151 GAAGCAAAGGTAGAAAAATATGG 0: 1
1: 1
2: 3
3: 65
4: 766
1099265620_1099265621 1 Left 1099265620 12:80443083-80443105 CCTTCGAGGAGGTACAGGCAGCA 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1099265621 12:80443107-80443129 GAACAAAATTTTTGAAAAAGTGG 0: 1
1: 0
2: 5
3: 99
4: 982
1099265620_1099265622 10 Left 1099265620 12:80443083-80443105 CCTTCGAGGAGGTACAGGCAGCA 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1099265622 12:80443116-80443138 TTTTGAAAAAGTGGAAGCAAAGG 0: 1
1: 0
2: 5
3: 64
4: 992

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099265620 Original CRISPR TGCTGCCTGTACCTCCTCGA AGG (reversed) Intronic
900927195 1:5713124-5713146 TGCTGGCTGTACCTTCCCCAGGG + Intergenic
902285866 1:15408696-15408718 TGCTGGCTTTACATTCTCGAGGG + Intergenic
904143524 1:28371675-28371697 TGCAGCCTGGACCTCCTCCTGGG + Intronic
905495855 1:38385251-38385273 TGCAGCCTGTCCAACCTCGAAGG - Intergenic
906322636 1:44826665-44826687 TGCTGCCCGGGCCCCCTCGATGG + Exonic
908262946 1:62352964-62352986 TGCTGCCTGGGCCTCCTTGTTGG + Intergenic
908751690 1:67430199-67430221 TGCTGCCTTCAGCACCTCGAAGG + Exonic
913104119 1:115595899-115595921 TTCTGCCAGCACCTCCTCAAGGG - Intergenic
915580397 1:156809600-156809622 CGCTGCCTGCACCCCCTCGCAGG + Intronic
917936634 1:179874512-179874534 TCCTGCCTGAACCTCCTAAAAGG - Intronic
922788461 1:228295502-228295524 TGCTGCCTTTATCTGCTCGGCGG + Intronic
923085688 1:230702106-230702128 CTCTGCCTGCTCCTCCTCGATGG - Intergenic
923498148 1:234542553-234542575 GGCTTCCTGCACCTCCTCCAAGG + Intergenic
1063164988 10:3453601-3453623 TGAAGCCTGTATCTCCTCAAGGG + Intergenic
1063583554 10:7330911-7330933 TGCTGCCTGTCCCCCTTCCAGGG - Intronic
1065322480 10:24522211-24522233 TTCTGCCTGTACCTCCTGAGTGG - Intronic
1067721271 10:48729389-48729411 AGCTCCCTGTACTTCCTAGATGG - Intronic
1068793222 10:61049598-61049620 TGCTGCCTGGACCTGCGCCATGG - Intergenic
1069606383 10:69741361-69741383 TTATCCCTGTACCTCCTCAAAGG - Intergenic
1073583105 10:104685456-104685478 TGCTGCCTCTTCCTCCTGGGTGG - Intronic
1076051490 10:127337227-127337249 TGCTGCATGTACATCCTCAGAGG + Intronic
1078238542 11:9508805-9508827 GGCTTCCTGCTCCTCCTCGATGG - Exonic
1081597342 11:44467982-44468004 GCCTGCCTGTACCTCCTCTGAGG - Intergenic
1084014117 11:66368725-66368747 TCCTGCCGGCACCTCCTCCAGGG - Intronic
1085254352 11:75164090-75164112 TGGGGCCTGTACCTCGTTGAAGG - Exonic
1085299034 11:75447863-75447885 TGCTGCCTGTGCATCTTGGAGGG - Intronic
1088074034 11:105824914-105824936 TCAAGCCTGTACCTCCTGGATGG - Intronic
1089166310 11:116479542-116479564 TGCTGCCTATACCACCTCTTGGG - Intergenic
1091636692 12:2202620-2202642 TTCTGCCCCTTCCTCCTCGAAGG + Intronic
1091748498 12:3008294-3008316 TGCTTCCTGTTTCTCCTCCAGGG - Intronic
1096679037 12:53242553-53242575 AGCTGCCTCTACCTGCTTGAGGG - Intergenic
1097342288 12:58453047-58453069 TGCAGCCTGTATCTCCTTCAAGG + Intergenic
1099265620 12:80443083-80443105 TGCTGCCTGTACCTCCTCGAAGG - Intronic
1105476078 13:20729191-20729213 TGCTGCCTGTTCTTCCATGATGG + Exonic
1109058561 13:57582796-57582818 TGCGGCCAGTACCTCCAAGAGGG + Intergenic
1109603074 13:64658111-64658133 TATTGCCTGTGCCTCCTGGAGGG - Intergenic
1117896691 14:60494840-60494862 TGCTCCCAGTAGCTCCTTGAAGG - Intronic
1119418237 14:74490244-74490266 TGCTGCCTGTACCTACCCTTGGG + Intronic
1121631015 14:95422008-95422030 TGCTGCCCTTAACTCCTCGGAGG + Intronic
1130332941 15:82935389-82935411 TGCTGGCTCTTCCTCCTCTATGG + Intronic
1131891875 15:96981708-96981730 AGCAGCCTGGACCTCCTCCAGGG + Intergenic
1136747845 16:32607530-32607552 TGCTGCCAGTCCATCCTCCATGG - Intergenic
1137039690 16:35599353-35599375 TCCTGCCTGTCCCTCCCCTAAGG - Intergenic
1140217985 16:73023555-73023577 TGCTGCCTGTAGCGCATCGTGGG - Intronic
1141497497 16:84420111-84420133 TGCTCCCTGTCCCTCCTCCCAGG + Intronic
1141621086 16:85236783-85236805 TGCTGCCTGTAATACCTCTAAGG + Intergenic
1142169729 16:88615253-88615275 GGCTGCCTCTACCTCCTCCAGGG + Intronic
1203049980 16_KI270728v1_random:866737-866759 TGCTGCCAGTCCATCCTCCATGG - Intergenic
1142753614 17:2002789-2002811 TGCTGCCCCTGCCTCCTCGCCGG - Intronic
1142993757 17:3748939-3748961 TGCTGCCTGAAACTCCTCCACGG - Intronic
1143271430 17:5678376-5678398 TGCTGCCTGTGCTTTCTGGATGG - Intergenic
1144464849 17:15488970-15488992 TGCTGCATGAAGCTCCTCGCCGG - Intronic
1144771768 17:17763437-17763459 TGCTGCCAGCAGCTCCTTGAGGG - Intronic
1148701857 17:49592347-49592369 TGCTGCCTAAAGCTCCTCCATGG + Intergenic
1152892039 17:82887873-82887895 TGCCGTCTGTACCTCCTCTTTGG + Intronic
1152922811 17:83074261-83074283 TGCTGCCTGGGGCTCCTCGTGGG - Intergenic
1156461151 18:37322041-37322063 TGCTGCCCGTCTCCCCTCGACGG + Intronic
1159582146 18:70245512-70245534 TGCTGCCTGTCCCTATCCGAAGG - Intergenic
1160269116 18:77368008-77368030 TGCTGCCTGTGTCTCCTCGTTGG + Intergenic
1161060060 19:2210392-2210414 TGCCTCCTGTTCCTCCTGGAAGG - Exonic
1165406889 19:35636590-35636612 TGCTGCCTGCTCCTCCGCCATGG - Intronic
1166391873 19:42412878-42412900 CCCTGCCTGTCCCTCCTGGAAGG + Intronic
1167574144 19:50309708-50309730 TGCTTCCTCTGCCTCCTCGTCGG - Exonic
932355840 2:71068025-71068047 GGCTGCCGGGACCGCCTCGAGGG + Intronic
935269417 2:101420641-101420663 TGCTGCCTTTACCTGCACCATGG + Intronic
935678421 2:105616278-105616300 TGCTGGCTGTAGCCCCTTGAAGG + Intergenic
937030597 2:118736132-118736154 TGCAGCCTTGACCTCCTCAAAGG - Intergenic
937325001 2:120985168-120985190 TCCTGACTGTACCTCCCCTAAGG + Intronic
941765387 2:169291027-169291049 AGCTGGCTGTACCTCCCCTATGG - Intronic
942144086 2:173008684-173008706 TGCTGCCTCTACATCCTGGGAGG + Intronic
944341811 2:198610246-198610268 TTCTACCTGTCCCTCCTCTAAGG - Intergenic
946051163 2:216863783-216863805 TGGTGTCTGTATCTCCTAGACGG + Intergenic
946224648 2:218257729-218257751 TGCTGCCTCAGCCTCCTTGAGGG + Intergenic
948761645 2:240195773-240195795 TGGGGCATGTGCCTCCTCGATGG - Intergenic
1173668195 20:44778000-44778022 TGCTGCCTCTTCTTCCTCCATGG + Intronic
1175923780 20:62462262-62462284 TGCTGCCTCTACCACCTGAAGGG - Intergenic
1175933166 20:62502906-62502928 GGCTCCCTGCACCTCCTCGCAGG - Intergenic
1175973557 20:62699153-62699175 TGCAGCCTGTGGCTCCTCCAAGG + Intergenic
1176181283 20:63750936-63750958 GGCTGCCTGTTCCTTCTCGTTGG - Intronic
1179617637 21:42592486-42592508 TCCTTCCTGGACCTCCTCTAGGG - Intergenic
1179892887 21:44345779-44345801 TGCTGCCTGTCCCTTCTCCCAGG - Intergenic
1183538243 22:38415510-38415532 GGCTGCCTGTTCCTCCTGGTTGG - Intergenic
1184437517 22:44488576-44488598 TGTCGCCTGTACCTCCTCTTAGG - Intergenic
1184637153 22:45842001-45842023 TGCTGCCTTTATCTGCTCGTGGG + Intronic
1184660071 22:45961593-45961615 AGCTCCCTGTGCCTCCTCTAAGG - Intronic
1185223436 22:49640343-49640365 GGCTGCCTGTGCCTCTTCTATGG - Intronic
949807163 3:7968094-7968116 TGCAGCCTTTTCCTCCTGGATGG + Intergenic
950444705 3:13029899-13029921 TGCTGCCTGAACCTGCTCCATGG + Intronic
955352109 3:58201191-58201213 TGCAGCCTGTGCCTTCTGGAGGG - Intronic
960559996 3:119073466-119073488 TGCGGCCTGAGCCTCCCCGATGG - Intronic
960720705 3:120622394-120622416 TCCTGCCAGTCCCTCCTCCAGGG - Intergenic
965960665 3:174425043-174425065 TCCTGCCTGTCTCTCCTGGAGGG + Intergenic
968629031 4:1640875-1640897 TGCTGCCTGCACCTGCCCCAGGG - Exonic
968915199 4:3494221-3494243 TCCTGTCTGAACCTCCTCGCAGG + Exonic
974838194 4:67275308-67275330 TGCAGCCTGAACCTCCCTGATGG - Intergenic
975217342 4:71770633-71770655 GGCTGCTTCTACCTCCTCCAGGG - Intronic
975329578 4:73099153-73099175 TGCTGCCTGTGCCTCACTGAAGG + Intronic
976767934 4:88617952-88617974 TGCTGCCTCCACTTCCTTGAGGG - Intronic
976806401 4:89052118-89052140 TGCTGCCTGTACCCTTTGGAAGG + Intronic
977640088 4:99347775-99347797 TGCAACCTCTACCTCCTCAATGG + Exonic
982334415 4:154217301-154217323 TTCTGCCTGTCTCTCCTTGAAGG + Intergenic
982758383 4:159251234-159251256 TGCTGCCTGAGCCTTCCCGACGG + Intronic
983834197 4:172369531-172369553 TGCAGCCTGAACCTCCCCGACGG - Intronic
986415110 5:7520361-7520383 TGATGCCTGTCCCTCCTCTGTGG + Intronic
994699152 5:103111638-103111660 TGGGGCCTGTACTTCCTCTAAGG - Intronic
998039978 5:138945716-138945738 TGCTGCCTTTACAGCCTCGCAGG - Intergenic
998385304 5:141753866-141753888 TGTTGCTTCTTCCTCCTCGAAGG - Intergenic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1000430878 5:161150681-161150703 TGCTGCCAGTAACTCCACTAGGG + Intergenic
1001989065 5:176100904-176100926 TGCTGCCGGTCCATCCTCCATGG - Intronic
1001989684 5:176105916-176105938 TGCTGCCGGTCCATCCTCCATGG - Intronic
1002169825 5:177368777-177368799 TGCTGTGTGTACCTGCCCGATGG + Exonic
1002227186 5:177732221-177732243 TGCTGCCGGTCCATCCTCCATGG + Intronic
1002227804 5:177737233-177737255 TGCTGCCAGTCCATCCTCCATGG + Intronic
1005494259 6:26375063-26375085 TACTGCCTGTATCTCCTCAAAGG + Intronic
1006431956 6:34002573-34002595 TGCTGAGTGTACCTCTTCAAAGG - Intergenic
1006902715 6:37513337-37513359 TCCTGCCTGTACCTCGCCAAGGG - Intergenic
1009471870 6:64036557-64036579 TGATGTCTGTAGCTCCTCAATGG - Intronic
1012221725 6:96657484-96657506 TGCGGTCTGCACCTCCTGGAGGG - Intergenic
1013493671 6:110676074-110676096 TGATGCCTTGACCTCCTTGAAGG - Intronic
1015997626 6:139010748-139010770 TGCTGCCTTGGCCTCCTAGAGGG + Intergenic
1016124818 6:140386814-140386836 TCCTGCCTCTACCTCCTGAATGG - Intergenic
1016159605 6:140861977-140861999 TGCAGCCTCAACCTCCTCGGTGG - Intergenic
1017531558 6:155297467-155297489 TGCTGCCTGTACCCCCTTCCTGG - Intronic
1020892007 7:13889708-13889730 TGCAGCCTTTACCTCCTCCCAGG - Intergenic
1022111589 7:27235647-27235669 TGCTGCCTGGAGCCCCTTGAGGG - Intergenic
1027136578 7:75628772-75628794 TGCGGCCTGTACCTCTTTTAAGG + Intronic
1032225021 7:130024311-130024333 TGGTGCCTGAATCTCCTCGGAGG - Exonic
1034876589 7:154729967-154729989 TGCTGCCTGTACCTCTTTGGTGG - Intronic
1035254700 7:157618889-157618911 AGCTGCCTGCACCTCCTCCCAGG - Intronic
1035772569 8:2159815-2159837 TGCTTCCTATACCTTCTAGAAGG - Intronic
1037837724 8:22224105-22224127 GGCTGCCAGTCCCTCCTCTAGGG - Intronic
1038676203 8:29624766-29624788 TGCTGCCTGTCTCTCTTCCAAGG - Intergenic
1048632664 8:136260979-136261001 TCCTTCCTGGAACTCCTCGAAGG + Intergenic
1049108429 8:140627989-140628011 TGCTCCCTGGAGCTGCTCGAGGG + Intronic
1049507843 8:143013368-143013390 TGCTGCTTGTCCCTCCTCTTGGG - Intergenic
1055630638 9:78220055-78220077 TGCTGCCCTTTCCTCCTAGAGGG - Intergenic
1057636576 9:96774960-96774982 TGCTGCTTGTCCCTTCTCAAAGG - Intronic
1058842092 9:108919785-108919807 TGCTGCCTTTACCACCTCTGTGG - Intronic
1060374097 9:123103116-123103138 GGCTGCCTGCACCTCATTGAGGG - Exonic
1061949981 9:133930760-133930782 TGCTGCCCCTCCCTCCTCCACGG - Intronic
1193996560 X:88372452-88372474 AGCTGCCTGGACCTCCCCAATGG + Intergenic
1196864765 X:120060734-120060756 TGTAGCCTGTTCCTCCTCCAAGG - Intergenic
1196878336 X:120175597-120175619 TGTAGCCTGTTCCTCCTCCAAGG + Intergenic
1199016256 X:142819588-142819610 TGGGGCCTGTGCCTCCTTGATGG - Intergenic
1201297049 Y:12472834-12472856 TGCTACCTGTACTTCTTCAAAGG - Intergenic