ID: 1099266840

View in Genome Browser
Species Human (GRCh38)
Location 12:80457956-80457978
Sequence ATATAGATACATATTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 529}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099266840 Original CRISPR ATATAGATACATATTAATGG GGG (reversed) Intronic
901288236 1:8100207-8100229 ATATATATATATATATATGGAGG + Intergenic
902554028 1:17236226-17236248 ATATTCATACATATGATTGGAGG - Intronic
903627032 1:24738259-24738281 ATATATATATATATTTATGGAGG - Intergenic
904110860 1:28124866-28124888 ACATACATACATATTAATGGAGG - Intergenic
905072324 1:35237861-35237883 ATATATATATATATGAATGTCGG + Intergenic
906463027 1:46051652-46051674 ATATAGGTACATAATGATGATGG - Intronic
907908389 1:58805916-58805938 ATATAGATACATATCGATTACGG + Intergenic
908590382 1:65625906-65625928 ATATAGGTATATATTAATTCAGG + Intronic
908881762 1:68740897-68740919 ATATAGAAAATTATGAATGGTGG + Intergenic
908979475 1:69936964-69936986 ATCTAGATGCCTATCAATGGTGG - Intronic
910083259 1:83368500-83368522 ATATATATACATATATATGCAGG - Intergenic
910160335 1:84265598-84265620 ATATATATATATAGTAATGACGG + Intergenic
910697432 1:90035489-90035511 AAAATGATACATTTTAATGGAGG + Intronic
910712366 1:90195150-90195172 AATTATATACATATTAATGTGGG - Intergenic
911147270 1:94564831-94564853 AGATAGATAAATAGTGATGGAGG - Intergenic
911833392 1:102583612-102583634 ATATATATATATATCCATGGGGG - Intergenic
913944458 1:125145370-125145392 ATATATATACATTTTATTGGGGG - Intergenic
913954721 1:143278403-143278425 ATATATATACATTTTATTGGGGG + Intergenic
913982716 1:143536962-143536984 ATATATATACATTTTATTGGGGG - Intergenic
915057382 1:153146984-153147006 ATATAGATACATATCCATGTGGG - Intergenic
915866514 1:159505257-159505279 ATAGTAATACATATTTATGGGGG + Intergenic
916198544 1:162248110-162248132 ATATATATATATATTAGAGGTGG - Intronic
916359183 1:163949016-163949038 ATGATGATACATATGAATGGAGG - Intergenic
916590693 1:166187199-166187221 ATATAGATAAATATAGATAGTGG - Intergenic
917231130 1:172839287-172839309 ATATATATATATATATATGGTGG + Intergenic
917392200 1:174550160-174550182 ATCTAGATATATATTTGTGGAGG - Intronic
917773944 1:178313170-178313192 ATATAGTTACATAATAATTTTGG - Intronic
918732963 1:188021670-188021692 TCAGAGATACATATTAATGAGGG - Intergenic
918803586 1:189007451-189007473 ATATAGATACATTTTTATCAAGG + Intergenic
918969040 1:191389192-191389214 ATATTGTAACACATTAATGGTGG + Intergenic
919076197 1:192816025-192816047 ATATAGATAAATACTTATGAAGG + Intergenic
919574436 1:199289859-199289881 ATATAGATACATCTTGATTGGGG - Intergenic
919613045 1:199770445-199770467 ATATAGATAAATATGAACGATGG + Intergenic
920615210 1:207485834-207485856 ATATAGAGACATAATAAAGCAGG + Intronic
920823140 1:209400139-209400161 ATATATATATATATGAATGCAGG - Intergenic
921133545 1:212240086-212240108 ATACATCAACATATTAATGGAGG + Intergenic
921439746 1:215171943-215171965 ATATATATGTATATAAATGGGGG - Intronic
921748475 1:218765350-218765372 ACATAGACACATATTCATGTAGG + Intergenic
921969026 1:221124540-221124562 ATACACACACATATTAATGGGGG - Intergenic
922549992 1:226487703-226487725 ATATATATACATATTTTTTGAGG - Intergenic
922626047 1:227044573-227044595 ATATAGATACCTATTACAGAAGG - Intronic
922794178 1:228331403-228331425 ATATATATATATATATATGGTGG - Intronic
922951899 1:229565369-229565391 ATATATATATATATGAATGATGG + Intergenic
923464597 1:234236947-234236969 ATATATATATATATATATGGAGG + Intronic
1062949209 10:1484748-1484770 ATATAGGTACATATACAGGGAGG + Intronic
1063912474 10:10845919-10845941 AAATAGTTACATAATAATGAGGG - Intergenic
1064288728 10:14014342-14014364 ATACACGTACATATTAATGGGGG - Intronic
1064814916 10:19249918-19249940 ACATAGAAACATAAAAATGGGGG + Intronic
1064869675 10:19923754-19923776 ATACTGATAAATAGTAATGGAGG - Intronic
1065495624 10:26324801-26324823 ATATATATATATATATATGGTGG - Intergenic
1065850423 10:29783085-29783107 ATATTGATAACTATTAAAGGAGG - Intergenic
1068005576 10:51389696-51389718 ATATAGAGAAATAATAATGCTGG + Intronic
1068249646 10:54421951-54421973 ATATATATATATATTTAGGGAGG + Intronic
1068389449 10:56375103-56375125 ATACAGAGAGATATGAATGGGGG - Intergenic
1068532614 10:58206976-58206998 ATATATATATATATACATGGTGG - Intronic
1068740913 10:60469415-60469437 ATATATATATATATATATGGTGG + Intronic
1068740915 10:60469441-60469463 ATATATATATATATATATGGTGG + Intronic
1068740925 10:60469553-60469575 ATATATATATATATATATGGTGG + Intronic
1068740927 10:60469579-60469601 ATATATATATATATATATGGTGG + Intronic
1068740929 10:60469603-60469625 ATATATATATATATATATGGTGG + Intronic
1068740931 10:60469637-60469659 ATATATATATATATATATGGTGG + Intronic
1068740933 10:60469663-60469685 ATATATATATATATATATGGTGG + Intronic
1068877631 10:62013848-62013870 ATAATAATACATATTTATGGGGG + Intronic
1069280051 10:66644444-66644466 ATATATATACATATTTGGGGGGG - Intronic
1069884135 10:71612838-71612860 ATGGCGATACATTTTAATGGGGG - Intronic
1070571590 10:77643615-77643637 ATATATAAAAATATTAATAGTGG - Intergenic
1071036173 10:81248561-81248583 ATATAGATACAGATATATGCAGG - Intergenic
1071053916 10:81486815-81486837 ATACACATACATATATATGGGGG + Intergenic
1071069495 10:81674972-81674994 AAATAGAAACATTTTAATGAAGG + Intergenic
1071224079 10:83507336-83507358 ATTTATATACATTTTAATAGTGG - Intergenic
1071984873 10:91040299-91040321 AAATGGATAGATCTTAATGGTGG - Intergenic
1073965342 10:108982484-108982506 ATTTAGATACATTATAGTGGTGG - Intergenic
1074315603 10:112358997-112359019 ATATATATATATATTCCTGGGGG + Intergenic
1075235312 10:120722518-120722540 CTATAGATCCACATTAATAGTGG - Intergenic
1076367434 10:129931051-129931073 ATATAGATACAGATATATGGGGG - Intronic
1077965466 11:7127821-7127843 ATATATATATATATAAATGGGGG - Intergenic
1078504209 11:11918568-11918590 ACAAAGATACATAATAATGTTGG + Intronic
1079661804 11:23047095-23047117 ATACTGAAAAATATTAATGGTGG + Intergenic
1079727668 11:23896366-23896388 ATATACATACATATTTTTTGAGG + Intergenic
1079826282 11:25199670-25199692 ATATATATATATATATATGGTGG - Intergenic
1080167470 11:29256488-29256510 ACATAGATGCATATTAATGGTGG - Intergenic
1080345976 11:31325701-31325723 ATATATATACATATATATGTAGG + Intronic
1081007139 11:37758805-37758827 ATGTAGATAAATATTAATTTTGG - Intergenic
1081237717 11:40665374-40665396 ATATATATATATATTATTAGGGG + Intronic
1082213231 11:49532442-49532464 AAAAAGAGACATAATAATGGGGG - Intergenic
1084685493 11:70692144-70692166 ATAAAAATACAAAATAATGGCGG + Intronic
1085659129 11:78346670-78346692 ATATATATATATATATATGGAGG - Intronic
1085798977 11:79570012-79570034 GTATAGATGTATCTTAATGGTGG - Intergenic
1085931820 11:81092642-81092664 ATGTATATCCATTTTAATGGAGG + Intergenic
1086636375 11:89092097-89092119 AAAAAGAGACATAATAATGGGGG + Intergenic
1086772104 11:90779169-90779191 AGATAGATAGATATTAAGGATGG - Intergenic
1087223233 11:95569015-95569037 ATATATATATATACTAATAGTGG - Intergenic
1087553427 11:99682321-99682343 AAATAGAAAGATATTAATTGTGG + Intronic
1088171492 11:107002738-107002760 CTCTAGATATATATTAATGATGG - Intronic
1088308240 11:108433279-108433301 ATATAGATATATATATATGCCGG + Intronic
1088329220 11:108633060-108633082 ATATAGATAGATATAAATATAGG - Intergenic
1088713757 11:112530680-112530702 ATATATATATATATGAATGATGG - Intergenic
1089042672 11:115468202-115468224 AAATAGATACATGTTCATTGGGG + Intronic
1090051492 11:123383781-123383803 ATATATATATATATTCATGAAGG - Intergenic
1091882006 12:3986878-3986900 ATATAGATAGATATAGATGTAGG + Intergenic
1092677471 12:10937328-10937350 ATAATGATACTTGTTAATGGTGG - Intronic
1092994609 12:13937169-13937191 ATATATATATATATAACTGGAGG + Intronic
1093211110 12:16310062-16310084 ATATATATATATACTAATAGTGG + Intergenic
1093253801 12:16840920-16840942 ATATACATACATATTAGGTGAGG - Intergenic
1093323434 12:17742438-17742460 ATATATATATATATATATGGTGG - Intergenic
1093441326 12:19200240-19200262 ATATCTATACATATTTAAGGGGG - Intronic
1093981224 12:25477771-25477793 ATATATATACATATATATGCAGG + Intronic
1094101032 12:26762783-26762805 ATATAAATATATATAAATTGTGG + Intronic
1094405544 12:30112325-30112347 ATATATATATATATATATGGGGG - Intergenic
1095199836 12:39370795-39370817 ATATATATACATATATATTGTGG - Intronic
1095583791 12:43829135-43829157 ATTTAGATACACAGTAATGGGGG - Intergenic
1097385387 12:58944623-58944645 ATATATATATATATGAATGATGG - Intergenic
1097547268 12:61019606-61019628 ATATATATATATATGTATGGTGG - Intergenic
1098302092 12:69064589-69064611 AGATACATACGTGTTAATGGTGG + Intergenic
1098374189 12:69795968-69795990 TTATGGATACATGATAATGGTGG - Intronic
1099266840 12:80457956-80457978 ATATAGATACATATTAATGGGGG - Intronic
1099383849 12:81989781-81989803 CTATAAGTACATATTATTGGGGG + Intergenic
1100131825 12:91503683-91503705 ATATAGCAAAATATTAATAGAGG + Intergenic
1100862918 12:98826126-98826148 ATATAAATACATCTGAATGATGG - Intronic
1102291468 12:111703898-111703920 ATATATATATATATAAATTGTGG - Intronic
1104356925 12:128095190-128095212 ATATAGATATATAGATATGGTGG + Intergenic
1105500745 13:20969738-20969760 ATATATATATATATATATGGCGG + Intergenic
1106339758 13:28817585-28817607 ACATAAATCCATATAAATGGAGG + Intergenic
1106723681 13:32462721-32462743 ATATTTGTACATTTTAATGGGGG - Intronic
1107326818 13:39253152-39253174 ATAAATATACATTTCAATGGAGG + Intergenic
1107695599 13:42996350-42996372 ATATTTGTACATATTAATGCAGG - Intergenic
1107860244 13:44653779-44653801 ATATATATATATATATATGGTGG - Intergenic
1108994776 13:56714569-56714591 ATATAGATACTAATTTATTGTGG - Intergenic
1109137446 13:58672308-58672330 CTATATATACATATTTATGGAGG + Intergenic
1109485830 13:63017909-63017931 ATATAAATACATATAAATATAGG + Intergenic
1109602727 13:64654024-64654046 ATATATATGCATATACATGGAGG + Intergenic
1109660282 13:65449675-65449697 ATATATATATATATATATGGAGG + Intergenic
1109690619 13:65883097-65883119 ATATATATATATATAATTGGAGG - Intergenic
1110386872 13:74922739-74922761 ATTTATATACATATTTATGTGGG - Intergenic
1110815797 13:79858771-79858793 ATATATATATATATTTTTGGTGG - Intergenic
1110948709 13:81457530-81457552 ATATATATATATATAAATGATGG - Intergenic
1111330089 13:86754578-86754600 ATATATATATATATATATGGTGG + Intergenic
1111399642 13:87717760-87717782 ATATATATATATATATATGGAGG + Intergenic
1112647018 13:101345495-101345517 AGATACATAGATATTAATGAAGG - Intronic
1112951454 13:105002117-105002139 ATGTACATACATATAAATGTAGG - Intergenic
1113204780 13:107904333-107904355 ATACAGATACATATTTGTGTGGG + Intergenic
1113336591 13:109382862-109382884 ATATATATATATATATATGGTGG + Intergenic
1114922315 14:27348138-27348160 ATATAGGTGCCTATCAATGGTGG - Intergenic
1115019654 14:28660812-28660834 ATATATTTACATATATATGGAGG - Intergenic
1115050734 14:29059431-29059453 GTATATATACATATATATGGTGG + Intergenic
1115078605 14:29422260-29422282 ATATATGTACATATTAATGTGGG + Intergenic
1115111296 14:29826180-29826202 ATATATATACATATATATGATGG + Intronic
1115111297 14:29826206-29826228 ATATATATACATATATATGATGG + Intronic
1115111298 14:29826232-29826254 ATATATATACATATATATGATGG + Intronic
1115111299 14:29826258-29826280 ATATATATACATATATATGATGG + Intronic
1115111300 14:29826284-29826306 ATATATATACATATATATGATGG + Intronic
1115111301 14:29826310-29826332 ATATATATACATATATATGATGG + Intronic
1115111302 14:29826336-29826358 ATATATATACATATATATGATGG + Intronic
1115111303 14:29826362-29826384 ATATATATACATATATATGATGG + Intronic
1115111304 14:29826388-29826410 ATATATATACATATATATGATGG + Intronic
1115111306 14:29826438-29826460 ATATATATACATATATATGATGG + Intronic
1115111307 14:29826462-29826484 ATATATATACATATATATGATGG + Intronic
1115126862 14:30006252-30006274 ATATGGATAAAGATTAATAGTGG + Intronic
1115286080 14:31713876-31713898 ATACAGATACATTTTTAAGGAGG - Intronic
1115958142 14:38805337-38805359 ATATATATATATATTAATGTTGG - Intergenic
1116131505 14:40860103-40860125 ATGTAGATCCCTATTAATGGTGG - Intergenic
1116290502 14:43030616-43030638 ATATATATATATATAAAGGGAGG - Intergenic
1116451937 14:45076824-45076846 ATATACCAACATCTTAATGGTGG + Intergenic
1117224703 14:53643487-53643509 ATAATTATACATATTTATGGGGG + Intergenic
1118524983 14:66630033-66630055 ACATAGTTAAATATTGATGGGGG + Intronic
1119940422 14:78634848-78634870 ATATATATATAAATTAGTGGGGG + Intronic
1120660475 14:87243292-87243314 ATATATATATATATAAATTGAGG + Intergenic
1121157920 14:91704276-91704298 AGAAAGTAACATATTAATGGAGG + Intronic
1121670663 14:95708515-95708537 ATATATATATATATATATGGAGG + Intergenic
1121771631 14:96549084-96549106 ACATAAATACATGTAAATGGTGG + Intronic
1123460222 15:20463546-20463568 ATATATTTACACATTAAAGGGGG + Intergenic
1123657840 15:22536871-22536893 ATATATTTACACATTAAAGGGGG - Intergenic
1123786152 15:23675846-23675868 ATATATATACATATATATGAAGG - Intergenic
1124194931 15:27616295-27616317 ATATATATATATATTATTTGAGG - Intergenic
1124311750 15:28632069-28632091 ATATATTTACACATTAAAGGGGG - Intergenic
1124985496 15:34607153-34607175 ACATAGCTACATCTTGATGGTGG + Intergenic
1126077463 15:44925663-44925685 ATATAGAAACTTCTTAATGGTGG - Intergenic
1126081252 15:44964859-44964881 ATATAGAAACTTCTTAATGGTGG + Intronic
1126169856 15:45686144-45686166 ATATATATATATATTAAATGAGG - Intronic
1126426397 15:48531222-48531244 TTATAAATACATATAATTGGAGG - Intronic
1127365284 15:58283930-58283952 AGATAAATACATGCTAATGGAGG + Intronic
1128607995 15:69051725-69051747 ATACAGATATATATTTATGGGGG + Intronic
1128709800 15:69863278-69863300 AAATAGCTACATTTTCATGGAGG - Intergenic
1128903054 15:71442690-71442712 ATATATATATATATGAAGGGAGG + Intronic
1130139026 15:81207762-81207784 ACCTAGATACCTATTAACGGTGG - Intronic
1130744522 15:86636694-86636716 ATATATATATATATGACTGGTGG - Intronic
1130860105 15:87878251-87878273 AATTAGATACAGACTAATGGTGG - Intronic
1131056130 15:89376292-89376314 ATATATATATATTTTAATGGAGG + Intergenic
1131421677 15:92311488-92311510 ATATTGATTCATTTTAATAGAGG + Intergenic
1132107787 15:99076440-99076462 TTATAGATTCAGATTAGTGGTGG - Intergenic
1133609987 16:7424258-7424280 ATATATATACATATATATGGGGG + Intronic
1134273517 16:12755577-12755599 ATAAAGATACATATTGAGGCAGG - Intronic
1134358495 16:13507062-13507084 ATATATATATATATACATGGTGG - Intergenic
1135486505 16:22870291-22870313 ATCTGGATACATTTTAATGCTGG - Intronic
1135704185 16:24660437-24660459 ATATATATATATATGAATGATGG - Intergenic
1135779399 16:25286905-25286927 AAATAAATAAATATTAATAGAGG - Intergenic
1137352097 16:47722516-47722538 GTAAAGATACATAGTAATGTTGG + Intergenic
1137489251 16:48917341-48917363 ATATAGATATAGATATATGGGGG + Intergenic
1138311002 16:56023977-56023999 AAATACATACATATTACTTGGGG + Intergenic
1138734465 16:59234544-59234566 ATGTAGATAGAAATTAATGCTGG - Intergenic
1139314942 16:66059962-66059984 ATATCGATAATTTTTAATGGTGG + Intergenic
1139774165 16:69303757-69303779 ATATAAATACATATTTATCATGG - Exonic
1140661279 16:77193013-77193035 ATATTAATAGATGTTAATGGTGG + Intronic
1144173174 17:12679545-12679567 ATATACATATATATAAATGTAGG - Intronic
1148939628 17:51197100-51197122 ATATATATATATATATATGGAGG + Intronic
1149300011 17:55296444-55296466 ATTTATATACATATATATGGGGG + Intronic
1149749424 17:59130756-59130778 GTATACATACATGTTCATGGGGG - Intronic
1150869326 17:68887877-68887899 ATATATATATATATATATGGAGG - Intronic
1151089349 17:71418257-71418279 ATATAGGCAAATATTAATGATGG + Intergenic
1203184125 17_KI270729v1_random:95923-95945 ATATATATACTTTTTATTGGGGG - Intergenic
1152984386 18:308484-308506 ATACAGATAGATATTAAAGTGGG + Intergenic
1153430816 18:5015121-5015143 ATATAGATTCAGAATAGTGGTGG + Intergenic
1153658031 18:7302543-7302565 ATAATTATACATATTCATGGGGG + Intergenic
1154515632 18:15162227-15162249 ATATATATACTTTTTATTGGGGG + Intergenic
1155283940 18:24270003-24270025 ATATAGCTACAAATTAATTTTGG - Intronic
1155485211 18:26334002-26334024 ATATATATACATATATATGTGGG - Intronic
1155815684 18:30305950-30305972 ATTTAGACACATATTAATTTGGG + Intergenic
1156787563 18:40933658-40933680 ATATATATATATATATATGGGGG + Intergenic
1157041576 18:44045764-44045786 ATAAAGATACATGTGGATGGAGG - Intergenic
1157440508 18:47708030-47708052 ATATAGATACATATGTAGGGAGG - Intergenic
1158030210 18:52954075-52954097 ACACAGGTACATATAAATGGAGG - Intronic
1158046326 18:53159640-53159662 ATATAGATACAGATAGATTGGGG - Intronic
1158382775 18:56952447-56952469 AAATATATACATCTTAATGCAGG + Intronic
1158748563 18:60230377-60230399 ATATATATAAATATTATTGGGGG - Intergenic
1158810194 18:61023312-61023334 ATATATATACATATATATGTTGG - Intergenic
1159035157 18:63269960-63269982 ATATATATACATTTCAAAGGTGG - Intronic
1159142278 18:64411938-64411960 TTACAGATACATATTAATACCGG - Intergenic
1159253951 18:65921288-65921310 ATCTAAGTGCATATTAATGGAGG + Intergenic
1159273883 18:66190621-66190643 ATATATATATATATATATGGAGG + Intergenic
1159537411 18:69732346-69732368 ATATGGTTACATGTTAATGAGGG - Intronic
1159640010 18:70852700-70852722 AAATAGATACACAGTAATTGTGG - Intergenic
1165019624 19:32913284-32913306 ATATATATATATATATATGGTGG - Intronic
1166090976 19:40508696-40508718 ATATATATATATATGACTGGTGG + Intronic
1166404979 19:42513889-42513911 ATATATATATATATATATGGAGG - Intronic
1166648471 19:44551545-44551567 ATATATATATATATGAATGATGG + Intergenic
1168318618 19:55495208-55495230 ATATATATATATATGAAAGGAGG - Intronic
925067517 2:939986-940008 ATATATATATATATTTAAGGGGG + Intergenic
925340934 2:3135438-3135460 ATATATATATATATTTATGATGG - Intergenic
925561973 2:5205896-5205918 ATATATATATATATATATGGGGG - Intergenic
925579916 2:5399816-5399838 ATACACATACATATAAATGATGG - Intergenic
926226286 2:10969365-10969387 ACATAGATACATATTTAAAGTGG - Intergenic
926617281 2:15009666-15009688 ATATATATACATATATATGTAGG + Intergenic
926902282 2:17765755-17765777 ATATCCAGACATATTAATGGTGG + Intronic
926999557 2:18778872-18778894 ATATATATTCATTTTCATGGGGG - Intergenic
927527503 2:23759703-23759725 ATATAAATAGAAATTAATAGGGG - Intronic
928279447 2:29931188-29931210 AAAGTGATACATATTAATTGTGG + Intergenic
928822996 2:35385534-35385556 ATATATATACATATTCAAAGAGG - Intergenic
928870679 2:35974267-35974289 ATATTCATACATGTTAATGTGGG - Intergenic
928930916 2:36623160-36623182 TTCTAGATACATATCACTGGAGG - Intronic
930677004 2:54213334-54213356 ATCTAGATGCCCATTAATGGTGG - Intronic
930749728 2:54922681-54922703 GTATATATACATATACATGGTGG + Intronic
931573312 2:63693477-63693499 AGATAGATAGAATTTAATGGAGG + Intronic
931585966 2:63828449-63828471 ACATAGATATATATTCTTGGGGG - Intergenic
931806522 2:65812513-65812535 ATATAAATGCATATTGATGATGG + Intergenic
933373855 2:81453173-81453195 ATATAGTTACAAATTAAAAGTGG - Intergenic
934791233 2:97062487-97062509 ATATATATAAACATTAATGTAGG + Intergenic
934815208 2:97320043-97320065 ATATATATAAACATTAATGTAGG - Intergenic
934822487 2:97388440-97388462 ATATATATAAACATTAATGTAGG + Intergenic
936404448 2:112189606-112189628 ATATAGTTTCATATTATTTGAGG + Intergenic
936714811 2:115173771-115173793 ATATATGTACATCTTAAAGGGGG - Intronic
937606430 2:123806869-123806891 ATTTGGTTACATAATAATGGTGG + Intergenic
937864360 2:126737666-126737688 ATATAGATACACATTTCTGTTGG - Intergenic
938132184 2:128725964-128725986 ATATAGATATATTTTGAAGGTGG + Intergenic
939087275 2:137736558-137736580 ATATATATATATATGAATGATGG + Intergenic
939839488 2:147169954-147169976 ATATATATATATATATATGGGGG - Intergenic
939970248 2:148650270-148650292 ATATAGATAGATATTGGGGGAGG - Intronic
940552245 2:155174363-155174385 ATATATATATATATGAATGATGG - Intergenic
940591049 2:155728103-155728125 AAATAGATACATTTTAGTTGTGG + Intergenic
941475521 2:165947165-165947187 ATATATATATATATATATGGGGG - Intronic
942434037 2:175951576-175951598 ATATATATATATATGAATGATGG - Intronic
942960722 2:181827571-181827593 ATATAGATCCAGGTTTATGGCGG + Intergenic
943282290 2:185951215-185951237 ATATGTATACATATATATGGTGG - Intergenic
943463149 2:188194607-188194629 ATATAGATACAGATTAAATATGG + Intergenic
944552238 2:200855306-200855328 ATATATATATATCTTAATAGAGG - Intronic
944862944 2:203832261-203832283 ATGTAGAAACATATGAAAGGTGG + Intergenic
945479100 2:210323666-210323688 ATATACATACACATTTGTGGGGG - Intergenic
945648730 2:212535231-212535253 ATATATATATATATAAAAGGGGG - Intronic
946983672 2:225247779-225247801 ATATATATATATATATATGGTGG + Intergenic
947113709 2:226747227-226747249 CTATAAATACTTCTTAATGGCGG - Intronic
947634644 2:231673762-231673784 ATATATATATATATATATGGAGG - Intergenic
948669327 2:239557744-239557766 ATGTGGATACATATTGATGCTGG + Intergenic
1168755771 20:316489-316511 ATACAGAAGCAGATTAATGGTGG + Intergenic
1169174039 20:3492908-3492930 ATATAAATACATATATATGTGGG + Intronic
1169938252 20:10908547-10908569 ATATTTATATATATTAATTGGGG - Intergenic
1170336237 20:15273413-15273435 ATATATATATATATATATGGAGG - Intronic
1170653039 20:18260259-18260281 ATATGGATCCATATATATGGTGG + Intergenic
1170758765 20:19230608-19230630 ATAGAAAGACATATTGATGGGGG + Intronic
1170758774 20:19230644-19230666 ATAGAAAGACATATTGATGGGGG + Intronic
1171890850 20:30713527-30713549 TTATAGAGACACATTAATTGAGG + Intergenic
1172473745 20:35221546-35221568 ATATAAATAAATATGAAAGGAGG + Intergenic
1173236615 20:41252094-41252116 AGAAAGATCCACATTAATGGTGG - Intronic
1174009275 20:47436478-47436500 ATATATATATATATTTTTGGGGG + Intergenic
1174566452 20:51468312-51468334 ATATATATATATTTTTATGGAGG - Intronic
1174731624 20:52923634-52923656 ATGTAAATAAATAGTAATGGGGG + Intergenic
1177311308 21:19397701-19397723 AGATAGATATATATTAAATGTGG + Intergenic
1177347907 21:19897666-19897688 ATATGGTGACATTTTAATGGAGG + Intergenic
1177601659 21:23323075-23323097 AAATAGAAACATGTTAAAGGAGG + Intergenic
1177898047 21:26878456-26878478 TTATAGATTAAAATTAATGGTGG + Intergenic
1177975510 21:27844931-27844953 ATATATATACTTTTTATTGGAGG - Intergenic
1178053921 21:28778031-28778053 ACAAATATACATATTTATGGTGG + Intergenic
1178136394 21:29632567-29632589 ATATATATACATATTTATGGAGG - Intronic
1178642722 21:34358607-34358629 TTCTAGATACAAATTCATGGTGG + Intergenic
1180525674 22:16257350-16257372 ATATATATACTTTTTATTGGGGG - Intergenic
1180527257 22:16304090-16304112 ATATATATACTTTTTATTGGGGG - Intergenic
1180665423 22:17507029-17507051 TTATTGATACATGTTAATAGAGG + Intronic
1181895949 22:26107548-26107570 ATATATATATATAAGAATGGTGG + Intergenic
1182941151 22:34278668-34278690 ATATACATACATATATATGTAGG + Intergenic
1184054548 22:42035585-42035607 TAATAGCTACATATTAATGATGG - Intronic
1184989825 22:48159803-48159825 ATTTAGATAAATATTAATCTTGG + Intergenic
1203322697 22_KI270737v1_random:83563-83585 ATATATATACTTTTTATTGGGGG + Intergenic
949151542 3:773878-773900 ATATAGACACATACAAATAGAGG + Intergenic
949461620 3:4301003-4301025 ATATATATATATATTGGTGGAGG - Intronic
949774364 3:7615005-7615027 ATTTAGTTACATTTTAAAGGTGG + Intronic
951085168 3:18503867-18503889 ATATACATACATATTTAAAGGGG - Intergenic
951104756 3:18729946-18729968 ATATAGATACATAAGCATGAAGG - Intergenic
951220515 3:20064227-20064249 ATAATTATACATATTGATGGGGG + Intronic
951612508 3:24506640-24506662 ATATATATATATATAAATGGAGG + Intergenic
953275898 3:41497415-41497437 ATCTATATACATAATAATTGGGG + Intronic
953953561 3:47212440-47212462 ATATAGCACCATATTAGTGGTGG + Intergenic
955702057 3:61691489-61691511 ATATACATACATATTTAGGATGG - Intronic
956011523 3:64836542-64836564 ACAAAGAAACATATTAATTGTGG - Intergenic
956307207 3:67838379-67838401 ATATAGATATATATAAAAAGGGG - Intergenic
956679985 3:71769530-71769552 ATATATATATATATATATGGGGG + Intergenic
957056600 3:75447974-75447996 ATATATATATATATGTATGGTGG - Intergenic
957313982 3:78553757-78553779 ATATATATATATATAAAGGGGGG - Intergenic
959182417 3:102998479-102998501 ATCCAGATACCCATTAATGGTGG + Intergenic
959360654 3:105386653-105386675 ATATATATATATATTTATGGTGG - Intronic
959953095 3:112203657-112203679 ATATATATACTTATTTGTGGAGG + Intronic
960410636 3:117319385-117319407 ATATATATATATATATATGGAGG - Intergenic
961980753 3:131075599-131075621 ATGTAGATAGAAATTGATGGTGG - Intronic
962669684 3:137692460-137692482 ATTTAGCTAAATATTAATTGAGG - Intergenic
963071569 3:141309283-141309305 ATATATATATATATATATGGTGG - Intergenic
963823364 3:149924331-149924353 ATATAAATACATTTTCATGCTGG - Intronic
964056055 3:152459364-152459386 ATATAGTTGCATATTTGTGGTGG + Intronic
964106194 3:153042645-153042667 AAATAAATAAATATAAATGGAGG - Intergenic
964215974 3:154283045-154283067 ATATATACACAAAGTAATGGGGG - Intronic
964427189 3:156566450-156566472 ATATATAAAAATATTAATAGTGG - Intergenic
965102360 3:164315277-164315299 ATATTGTCACATATTACTGGTGG + Intergenic
965227932 3:166014658-166014680 TTATAGATAAATATTTATAGTGG - Intergenic
965752246 3:171988014-171988036 ACATATATACATATAAATGTAGG - Intergenic
965882702 3:173405959-173405981 ATATAAATACATAATAGTGGAGG + Intronic
966245069 3:177798823-177798845 ATATATATATATATTTATGTTGG + Intergenic
966247033 3:177820341-177820363 AAATAGAAACAAATTAATGCTGG - Intergenic
966774844 3:183534865-183534887 ATATACATACATATATATGATGG - Intronic
967309702 3:188094435-188094457 ATATATATATATATTGCTGGTGG - Intergenic
967488909 3:190066228-190066250 ATATACATACATATATATGATGG + Intronic
967488911 3:190066269-190066291 ATATACATACATATATATGATGG + Intronic
967556104 3:190860995-190861017 GTATAGATCCATATTAATTTTGG + Intronic
967577398 3:191109959-191109981 AGGTAGTTACATATTACTGGAGG + Intergenic
967722321 3:192828587-192828609 ATATATATATATATATATGGGGG - Intronic
968681318 4:1922422-1922444 ATATAAATACATCTTTATTGAGG - Intronic
968803618 4:2758398-2758420 AAATAGGTACATATAACTGGGGG + Intergenic
969287180 4:6210322-6210344 ATATACATACATACATATGGGGG + Intergenic
970803020 4:19998114-19998136 ATATAAATACATGTTTGTGGAGG - Intergenic
971667678 4:29511766-29511788 ATATAAATATATATAAATAGAGG - Intergenic
971767333 4:30850193-30850215 ATATATGTACATATTATTTGTGG + Intronic
971923348 4:32972600-32972622 ATATACATATATATGAAAGGGGG + Intergenic
973169751 4:47125948-47125970 ATATAAATATATATTAAGGCTGG + Intronic
973905243 4:55522695-55522717 AAATACATACATATATATGGTGG - Intronic
974223474 4:59006916-59006938 ATATAGATATATATTTATTTAGG - Intergenic
974234507 4:59163292-59163314 ATAAAGCTACATAATAATAGTGG + Intergenic
974308662 4:60174949-60174971 ATATAAATATATATATATGGGGG - Intergenic
974424789 4:61727341-61727363 ATATATAAACATATTTATAGAGG + Intronic
974469069 4:62295759-62295781 ATATATATATATATTATAGGCGG - Intergenic
974602357 4:64100528-64100550 ATATAGATAGATATAAGTGCTGG + Intergenic
974675636 4:65085044-65085066 ACCTAGGTACCTATTAATGGTGG - Intergenic
975367182 4:73543796-73543818 ATATATATATATATAAATGTCGG + Intergenic
975687863 4:76935548-76935570 ATATATATACATATATATGTAGG - Intergenic
976325072 4:83762122-83762144 TTATAGATACCCATTAATGGAGG - Intergenic
976384011 4:84434339-84434361 ATATAGATATATATTCATGGTGG + Intergenic
976464945 4:85356410-85356432 ATATAGTTACCTATCACTGGAGG - Intergenic
976797050 4:88945749-88945771 ATATATATATATACTAATAGTGG - Intronic
976853283 4:89574354-89574376 ACATAGAAAAATATTATTGGTGG - Intergenic
978012000 4:103698907-103698929 ATAATTATACATATTTATGGGGG - Intronic
978070764 4:104465246-104465268 ATATAAATACATAATAACTGTGG - Intergenic
978185444 4:105851865-105851887 ATATAGATATTTTTTAATTGGGG - Intronic
978250263 4:106622441-106622463 ATATATATAAATATTATTGCTGG + Intergenic
978540107 4:109807430-109807452 ATATATATATATATATATGGAGG + Intergenic
978642274 4:110884760-110884782 ATATATATATATATGAATGAAGG + Intergenic
978787613 4:112627335-112627357 ATCTAGACAAAAATTAATGGAGG - Intronic
979040851 4:115792163-115792185 ACAGAGATAAACATTAATGGAGG + Intergenic
979122614 4:116922111-116922133 ATATATACACATAATACTGGAGG - Intergenic
979611752 4:122696825-122696847 ATTTACATACATCTCAATGGGGG + Intergenic
979756911 4:124352044-124352066 GTATAGATACATGTGTATGGGGG + Intergenic
980689393 4:136274803-136274825 TTATAAATAAATGTTAATGGAGG - Intergenic
980805444 4:137807288-137807310 ATATATAAAAATATTAATGTCGG + Intergenic
982134652 4:152262860-152262882 ATATAAATATATATTATTTGGGG - Intergenic
982596617 4:157393891-157393913 AAATAGATATTTATTAATTGGGG - Intergenic
982818820 4:159920579-159920601 ATATATATATATATTAGTGTTGG - Intergenic
982903150 4:161032830-161032852 ATATAGAGATATCTTGATGGTGG + Intergenic
982974710 4:162040802-162040824 AAAAAGATAAATAATAATGGGGG - Intronic
983397734 4:167223363-167223385 ATATAAATATATATTTATAGAGG + Intronic
983484049 4:168312699-168312721 ATATAGATAGATATAGATGATGG + Intronic
983826751 4:172271936-172271958 ATATATATATATATTTATGATGG - Intronic
984605073 4:181775801-181775823 ATATTTGTACATATTTATGGGGG + Intergenic
984642252 4:182180280-182180302 GTTTAGTTACATATTTATGGAGG + Intronic
985354041 4:189098054-189098076 ATATAGAAAAATATTAATAGAGG + Intergenic
986191775 5:5503101-5503123 ATATATGTACATATAAAAGGGGG - Intergenic
986557051 5:9020963-9020985 ACCTAGATACCTATCAATGGTGG - Intergenic
987427317 5:17787883-17787905 ATATAGAAATATATTTATGCAGG + Intergenic
987902093 5:24025534-24025556 AGATAGTTACAAAATAATGGTGG + Intronic
987990379 5:25201259-25201281 ATATACATACATATTAACAAGGG - Intergenic
987999742 5:25332180-25332202 ATATAGATATAGATAAATAGAGG - Intergenic
988071743 5:26298926-26298948 ATATATATACATATATATGATGG + Intergenic
988215213 5:28263014-28263036 AAAGAGATACAGTTTAATGGAGG - Intergenic
988807343 5:34752669-34752691 ATATAGATATTTCTTACTGGAGG - Intronic
989277484 5:39606726-39606748 ATATATATCCATATTAATAGAGG - Intergenic
989323954 5:40168011-40168033 ATATATATATATATAAATCGGGG - Intergenic
990056016 5:51579389-51579411 ATATATATACATATTAAACAAGG + Intergenic
990760544 5:59124847-59124869 ATATAGATAGATAATTTTGGAGG - Intronic
990909449 5:60839034-60839056 ATATATATATATATTTATGATGG + Intronic
990918738 5:60938791-60938813 ATAAAGCTACATATATATGGAGG - Intronic
991266646 5:64727450-64727472 ATATATATATATATATATGGTGG - Intronic
991349324 5:65704437-65704459 TTATAGACACATTTTAATCGTGG + Intronic
992764365 5:79983072-79983094 ACATAGATAAATATTAAAGGTGG - Exonic
993512838 5:88793603-88793625 ATATAGATACATATTATACAAGG - Intronic
993883145 5:93386321-93386343 ATTTTGATACATATGAAAGGAGG - Intergenic
994455331 5:99998723-99998745 ATATAGAAACTTATAAAGGGTGG - Intergenic
994466780 5:100144808-100144830 ATATATATACATATATATGTGGG - Intergenic
994796387 5:104306152-104306174 ATAACAATAAATATTAATGGAGG - Intergenic
994961298 5:106606935-106606957 ATTAAGTTATATATTAATGGGGG - Intergenic
994994103 5:107037489-107037511 ATATTTATACATATGTATGGGGG - Intergenic
995900735 5:117063229-117063251 ATATAGGTACATAGTGATAGTGG + Intergenic
996108446 5:119535674-119535696 ATATATATATATATTTTTGGGGG + Intronic
998398362 5:141834367-141834389 ATATACATAAACTTTAATGGTGG + Intergenic
998845453 5:146304642-146304664 ATATTAATAAATATTAAGGGTGG - Intronic
999191433 5:149750478-149750500 ATATATATATATGTTAATAGGGG + Intronic
1000130636 5:158294457-158294479 ATATAAATACATATAGATTGGGG - Intergenic
1000189572 5:158896935-158896957 TTATAGCTAAATAGTAATGGAGG + Intronic
1000757358 5:165178021-165178043 ATATATATACATATATATGATGG - Intergenic
1001286766 5:170429376-170429398 ATATATATACATATATATGTAGG - Intronic
1001609857 5:172991707-172991729 ATATAAATAAATATGTATGGGGG - Intronic
1002611578 5:180422355-180422377 ATATAGATAAATTAAAATGGAGG + Intergenic
1004337372 6:14776597-14776619 AAATAGTTACAAATGAATGGGGG - Intergenic
1004466570 6:15890997-15891019 TCATGGATACATACTAATGGTGG + Intergenic
1004801328 6:19152036-19152058 ATACAAATACATAATAATGTTGG + Intergenic
1005501545 6:26433088-26433110 ATATAGATACATATGATGAGCGG - Intergenic
1005918502 6:30376531-30376553 ATATTGAAAAATATTAGTGGAGG + Intergenic
1005990926 6:30901513-30901535 ATATATATATGTATAAATGGGGG - Intergenic
1008678011 6:53842388-53842410 AGCTAGATAAATATTACTGGAGG + Intronic
1009501246 6:64417476-64417498 ATTTAGATACATATTGTTGGTGG + Intronic
1009569176 6:65359695-65359717 ATATAGGCAGATATTAATAGTGG + Intronic
1009819623 6:68783283-68783305 ATATATATATATATTTAGGGAGG - Intronic
1010558382 6:77314937-77314959 ATATAGAAAAATATGAAAGGTGG - Intergenic
1010587324 6:77669119-77669141 TTATAGACATTTATTAATGGGGG - Intergenic
1011769692 6:90661687-90661709 ATATATATATATATATATGGTGG - Intergenic
1012018547 6:93885614-93885636 ATTTAGATACGTATAAATAGAGG + Intergenic
1012130809 6:95489957-95489979 ATATAAATACACATCAAAGGTGG - Intergenic
1012529221 6:100214151-100214173 ATCTAGATACTCATCAATGGTGG + Intergenic
1012645566 6:101675185-101675207 ATATAAATAAAAATAAATGGAGG - Intronic
1013347083 6:109271174-109271196 CTATAGATAAATGTTCATGGTGG - Intergenic
1013684459 6:112563326-112563348 AAATGGATACATATTATTGTAGG + Intergenic
1014252824 6:119131845-119131867 CTATAGATACATTTTAATACAGG + Intronic
1014863578 6:126500653-126500675 ATATATAGAAATATGAATGGAGG - Intergenic
1016417742 6:143850900-143850922 GTATAGATGGATATTAATAGTGG + Intronic
1016616060 6:146049642-146049664 AGATAGATAGATATGAAAGGAGG - Intronic
1016676267 6:146772585-146772607 ATATAATTACATATTAATATAGG - Intronic
1017076966 6:150627989-150628011 ATTTAAATAAATATTAATGTAGG - Intronic
1017294311 6:152776525-152776547 ATATATATATATATTTGTGGGGG + Intergenic
1017735327 6:157357768-157357790 ATATATATAAATATTGATGCTGG + Intergenic
1020314669 7:6896910-6896932 ATATATATATATATATATGGTGG + Intergenic
1020742663 7:12041719-12041741 AGATAGATACATAGGAAAGGTGG + Intergenic
1022805450 7:33816716-33816738 ATATGGATACTAATTAATGTAGG + Intergenic
1023035805 7:36130598-36130620 ATATAGATACATATGCCTGGGGG + Intergenic
1023502707 7:40867213-40867235 AGATAGAGACATATATATGGGGG - Intergenic
1023749096 7:43353067-43353089 ATAAATATACATATTTATAGTGG + Intronic
1025475003 7:60908258-60908280 ATATATATACTTTTTATTGGGGG - Intergenic
1025487896 7:61074733-61074755 ATATATATACTTTTTATTGGGGG + Intergenic
1025511998 7:61581616-61581638 ATATATATACTTTTTATTGGGGG + Intergenic
1025563372 7:62399625-62399647 ATATATATACATTTTATTGGGGG - Intergenic
1025566091 7:62435738-62435760 ATATATATACTTTTTATTGGGGG - Intergenic
1026449895 7:70518999-70519021 AAAGAGGTACATATTATTGGCGG - Intronic
1027582019 7:80009443-80009465 ATATATATACATATATATGTTGG + Intergenic
1027927206 7:84481166-84481188 AGAAAGATACAACTTAATGGTGG + Intronic
1028379570 7:90184000-90184022 ATATATATATATATTACTGTTGG - Intronic
1028478606 7:91279222-91279244 ATATAGATTTATATATATGGAGG - Intergenic
1028624303 7:92860926-92860948 GAATAGAGCCATATTAATGGTGG + Intergenic
1028664734 7:93328419-93328441 ATATAGATACCTATTTATATAGG - Intronic
1029046694 7:97637036-97637058 ATATAGATATATATTAGTGAGGG + Intergenic
1029267378 7:99352962-99352984 ATATATATATATATTTTTGGGGG - Intronic
1030388591 7:108897024-108897046 ATTTACTTACATTTTAATGGTGG + Intergenic
1030851990 7:114499323-114499345 ATATAGATCCATTATAATGGTGG - Intronic
1030941227 7:115651821-115651843 AAATATATTCATATTGATGGAGG - Intergenic
1031095413 7:117413213-117413235 ATATAAATACATTCTACTGGTGG + Intronic
1031202524 7:118706511-118706533 CTATATATAAATATTAAAGGTGG + Intergenic
1031441026 7:121794721-121794743 ATATATATATATATATATGGGGG - Intergenic
1031475877 7:122221000-122221022 ATATATATATATATATATGGTGG - Intergenic
1031599407 7:123687786-123687808 ATAGAGATAAATATTTATTGTGG - Intronic
1031655686 7:124351680-124351702 ATAAAGATGCATATAAATGTGGG + Intergenic
1033859280 7:145605382-145605404 ATATATATATATATTTAAGGTGG - Intergenic
1035852166 8:2931457-2931479 ATATATATATATATGAATGATGG + Intergenic
1035888504 8:3319519-3319541 ATTTAGATACATTTTAATTATGG - Intronic
1036171133 8:6486133-6486155 ACATAGATAAATATTAAAGTGGG - Intronic
1037135547 8:15455362-15455384 ATATACATACATATACATGATGG - Intronic
1037220508 8:16513669-16513691 ATATAGATATAAATAAATGAGGG + Intronic
1037338809 8:17818938-17818960 ATATAGACATATATAAATGTAGG + Intergenic
1038676020 8:29623606-29623628 ACATACATACATATACATGGGGG - Intergenic
1039331113 8:36537822-36537844 ATATATATATATATGAATGGCGG + Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040327569 8:46361349-46361371 ATATATATATATATTACTGTAGG + Intergenic
1040448670 8:47522317-47522339 ATACAGTTACATATTTATTGTGG - Intronic
1041130194 8:54690616-54690638 ATACATGTACATATTAATAGGGG + Intergenic
1041542600 8:59002922-59002944 ATATAGATGCTTATAAATGCTGG + Intronic
1041949145 8:63480564-63480586 ATCCACATATATATTAATGGTGG + Intergenic
1042601163 8:70501184-70501206 TTAAAGATACATATTGATGCTGG - Intergenic
1042601608 8:70504272-70504294 ATATTGATATATATTAAATGTGG - Intergenic
1042628319 8:70785815-70785837 ATATAGATAAATATAAATTTAGG - Intronic
1043196520 8:77299705-77299727 ATATATATACATATTGCTGGAGG + Intergenic
1043212951 8:77548810-77548832 ATATAGATGCAAGTAAATGGTGG - Intergenic
1043299747 8:78712804-78712826 ATTAATATACCTATTAATGGTGG + Intronic
1043755071 8:83993402-83993424 AAATACATCCATTTTAATGGTGG + Intergenic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1044202740 8:89455405-89455427 ATATATACACATATATATGGAGG + Intergenic
1044328124 8:90884112-90884134 ATATATATACATTTTAATTTTGG - Intronic
1044497029 8:92898859-92898881 ATATATATATATATAGATGGGGG + Intronic
1046308788 8:112405210-112405232 ATATATATATATATATATGGGGG - Intronic
1047965744 8:130045443-130045465 ATATAAATACATATAAATTGGGG - Intergenic
1048599433 8:135903832-135903854 ATATATATACAGATTAATTCTGG - Intergenic
1048747660 8:137632954-137632976 ATATAAATATGTATCAATGGAGG + Intergenic
1050136904 9:2475171-2475193 ATATACATATATAATAATGTGGG + Intergenic
1050186184 9:2976879-2976901 ATATATATCCATTTTAATTGTGG - Intergenic
1050611322 9:7356843-7356865 ATATATATATATATAACTGGAGG - Intergenic
1050970230 9:11861348-11861370 ATATAACTAAATATTAATAGAGG + Intergenic
1051066195 9:13106382-13106404 ATATATATGCATATTAGAGGTGG + Exonic
1052452429 9:28649382-28649404 ATATAGATACTAATTTATAGAGG + Intronic
1052457143 9:28714156-28714178 ATATATATATATATTATTTGAGG - Intergenic
1052651288 9:31305204-31305226 ATAAAAATAAATATTAATTGTGG - Intergenic
1052700019 9:31926454-31926476 ATAATTATACATATTTATGGGGG - Intergenic
1053563164 9:39217388-39217410 ATATATATATATATTCATTGTGG + Intronic
1054133983 9:61401691-61401713 ATATATATATATATTCATTGTGG - Intergenic
1054950171 9:70841663-70841685 CTATATATACATATATATGGTGG - Intronic
1055831926 9:80389978-80390000 ATATACATATATATATATGGAGG + Intergenic
1056548493 9:87632908-87632930 ATATATATATATATAAATGAAGG + Intronic
1056558383 9:87708528-87708550 ATATACATATATATTAATACTGG + Exonic
1056841183 9:89999194-89999216 ATATATATACATATATATTGAGG - Intergenic
1057351404 9:94301581-94301603 ATATATTTTCATATTTATGGAGG + Intergenic
1059002300 9:110361427-110361449 ATATGCATACACATTAATGTGGG + Intergenic
1059603290 9:115804884-115804906 ATATATATATATATTAGTAGAGG - Intergenic
1060907826 9:127323754-127323776 GTATATATATATATTTATGGGGG - Intronic
1203560460 Un_KI270744v1:51292-51314 ATATAGAGACACATTACTTGAGG + Intergenic
1185671684 X:1814881-1814903 ATATATATATATATATATGGAGG + Intergenic
1185972868 X:4684205-4684227 ATATATATATATATATATGGTGG - Intergenic
1186080500 X:5925821-5925843 ATATATATATATATATATGGTGG - Intronic
1186290396 X:8091130-8091152 ATGCAGATACATATTTATCGAGG + Intergenic
1186321509 X:8431277-8431299 ACATAGATAGAGATTAATGATGG + Intergenic
1187016841 X:15337365-15337387 TTATAAATAGATATTAATAGAGG + Intergenic
1187639385 X:21272103-21272125 AATTATATACATATTAAAGGAGG + Intergenic
1187803034 X:23086388-23086410 CTATTGAAACATATAAATGGTGG - Intergenic
1188767379 X:34111589-34111611 ATATATATATATATAAGTGGAGG - Intergenic
1188982381 X:36738648-36738670 ATATATATATATATTTATGAGGG - Intergenic
1189073732 X:37892583-37892605 ATATACATACATACTAATATTGG - Intronic
1189962661 X:46339248-46339270 ATATATATATATATGAATGATGG + Intergenic
1189970777 X:46416037-46416059 ATATATATATATATATATGGTGG - Intergenic
1190132200 X:47758943-47758965 ATATAGATGCATCATAATTGTGG - Intergenic
1190241706 X:48661729-48661751 ATATATTTAAAAATTAATGGAGG - Intergenic
1190487751 X:50945299-50945321 ATATATAAATATATAAATGGAGG - Intergenic
1192387932 X:70692630-70692652 ATACAGATACATATATATGATGG - Intronic
1193279167 X:79626879-79626901 ATATAGAGCCATTTTACTGGGGG + Intergenic
1194342733 X:92724777-92724799 ATATAGGTAAATATGAAAGGTGG + Intergenic
1196036026 X:111146247-111146269 TTATTAATACATATTTATGGAGG + Intronic
1196865076 X:120063770-120063792 ATATATATATATATATATGGAGG + Intergenic
1196878025 X:120172564-120172586 ATATATATATATATATATGGAGG - Intergenic
1196878027 X:120172587-120172609 ATATATATATATATATATGGAGG - Intergenic
1198196845 X:134372077-134372099 AAATAGATACCTAATAAGGGTGG - Intergenic
1198210712 X:134513091-134513113 ATATACATACATATACATCGGGG - Intronic
1198763668 X:140059922-140059944 ATATATATATATATATATGGTGG - Intergenic
1199316839 X:146389060-146389082 ATATTTGTACATATTAATGAGGG + Intergenic
1200363732 X:155638285-155638307 ATATATATATATATTAGAGGAGG - Intronic
1200651094 Y:5841442-5841464 ATATAGGTAAATATGAAAGGTGG + Intergenic
1201241317 Y:11959370-11959392 ATATATATATATATATATGGCGG + Intergenic
1201755238 Y:17480056-17480078 ATATATATATATATTAAAGGTGG - Intergenic
1201846314 Y:18425929-18425951 ATATATATATATATTAAAGGTGG + Intergenic
1202297241 Y:23372524-23372546 ACATAACTACATATTTATGGAGG + Intergenic
1202573566 Y:26298073-26298095 ACATAACTACATATTTATGGAGG - Intergenic