ID: 1099273712

View in Genome Browser
Species Human (GRCh38)
Location 12:80548541-80548563
Sequence CTGCCTACACCGCTCTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099273712_1099273717 26 Left 1099273712 12:80548541-80548563 CCCAGGTAGAGCGGTGTAGGCAG 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1099273717 12:80548590-80548612 AAGCACTATGTTTTGCATAATGG 0: 1
1: 0
2: 2
3: 20
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099273712 Original CRISPR CTGCCTACACCGCTCTACCT GGG (reversed) Intronic
900511137 1:3061762-3061784 CTGCCGCCACCGTTCTACCTTGG + Intergenic
903212958 1:21828908-21828930 CTGCACACCCTGCTCTACCTGGG - Exonic
907638340 1:56159069-56159091 CTGCCTATCCAGCTCTATCTTGG - Intergenic
910245892 1:85137777-85137799 CTCCCTGCACCCTTCTACCTTGG + Intergenic
912707943 1:111928777-111928799 CTCCCTACACAGCCCTTCCTGGG + Intronic
916525509 1:165605422-165605444 CTGCTGAAACCACTCTACCTGGG - Intergenic
918312048 1:183291971-183291993 CCGCCCACCCCGCTCTTCCTGGG + Intronic
919130855 1:193448835-193448857 CTCTCTACTCAGCTCTACCTGGG - Intergenic
922517982 1:226222988-226223010 TTGCCAACCCCGCCCTACCTAGG + Intergenic
1065240522 10:23699226-23699248 CTGACTTCACAGCTCTGCCTAGG - Intronic
1071747899 10:88442700-88442722 CTGCCTACACCACGTTCCCTAGG + Intronic
1075133682 10:119763278-119763300 CTGCCTCCACGGCTCTACCCAGG + Intronic
1075402515 10:122171337-122171359 CTACCTCCACCCCCCTACCTCGG - Intronic
1077902348 11:6499438-6499460 CTGCCAACTCCACTCTGCCTTGG - Intronic
1080786389 11:35478646-35478668 CTGACTACACCTCTCTGTCTAGG + Intronic
1085928849 11:81056304-81056326 CTGCCTAGAATGCTATACCTTGG + Intergenic
1087107876 11:94429701-94429723 CTGCCTACTGCTCACTACCTGGG + Intronic
1091361961 11:134984972-134984994 CTGCCTTCACTGCTCTCCCTAGG - Intergenic
1092195982 12:6550025-6550047 CTGACTGCACCCCTCTTCCTGGG + Intronic
1094426208 12:30320030-30320052 CTGCCTCCACCTCCCCACCTTGG - Intergenic
1099273712 12:80548541-80548563 CTGCCTACACCGCTCTACCTGGG - Intronic
1107605133 13:42048961-42048983 CCGCCTCCTCCGCCCTACCTTGG - Exonic
1124843165 15:33263721-33263743 CTGCCTACTCCTCTCTCCCTGGG + Intergenic
1130275469 15:82473935-82473957 TTGCCTATACCCCTCTAACTTGG - Intergenic
1130467829 15:84201330-84201352 TTGCCTATACCCCTCTAACTTGG - Intergenic
1130496436 15:84472212-84472234 TTGCCTATACCCCTCTAACTTGG + Intergenic
1130590121 15:85205928-85205950 TTGCCTATACCCCTCTAACTTGG - Intergenic
1133536168 16:6704428-6704450 CTGCCCACATGGCTCTAGCTGGG + Intronic
1135566860 16:23517689-23517711 CTTCCAACACCCATCTACCTGGG + Intronic
1137876066 16:51997745-51997767 CTGCCTTCACCTCTCAACATGGG - Intergenic
1138351977 16:56350821-56350843 CTGCCTAGACCTCTCCTCCTGGG - Intronic
1139965071 16:70740817-70740839 CTGCCTTCACCGCTCTGCGAGGG + Intronic
1141941291 16:87277880-87277902 CTGCCTCCACACCTCCACCTAGG + Intronic
1146835929 17:36110647-36110669 CTGCCTAAACAGGTCTACCTTGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1148747740 17:49927844-49927866 CTGCCAAGACCCCTCTTCCTTGG + Intergenic
1153817153 18:8800450-8800472 CTGCATATACCGATCAACCTTGG + Intronic
1156630031 18:38956203-38956225 CTGCCTCCATGGATCTACCTTGG + Intergenic
1156848814 18:41701556-41701578 CTGCCCCCTCTGCTCTACCTAGG + Intergenic
1157809522 18:50684738-50684760 CTGCCTTCACCTGTCTTCCTCGG - Intronic
1162991651 19:14306837-14306859 CTACCTACACCTCTCTGCCTGGG + Intergenic
1166194633 19:41197791-41197813 CTGCCTCCACCGCTCCCCGTTGG - Exonic
1167642805 19:50691114-50691136 CTGCCAACACCTCTCTATCCAGG - Intronic
934683884 2:96306183-96306205 CTGCCTTCACCGGTTTCCCTGGG - Intergenic
945047668 2:205796175-205796197 CTGTCTACACTGCTCAGCCTTGG - Exonic
947751681 2:232535828-232535850 CTGCCTTGACCTCTCTGCCTAGG + Exonic
947967065 2:234290541-234290563 CTTCCTGCTCCTCTCTACCTGGG - Intergenic
948117702 2:235505786-235505808 CCGCCTACCCCGCTCTTCCCAGG - Intronic
948606996 2:239142262-239142284 CTGCCTCCACCGCTCCATATGGG + Intronic
948767003 2:240227558-240227580 CTGCCTGCAGCACTCTGCCTGGG - Intergenic
1169184929 20:3606520-3606542 CTGCCTGGACAGCCCTACCTGGG + Intronic
1173405095 20:42757451-42757473 CTTCCAACACCTCTCTTCCTTGG + Intronic
951036456 3:17938317-17938339 CTGCCTGCCCTGCTCTACCAAGG + Intronic
962872163 3:139506848-139506870 CAGCCTACAGCGCTACACCTGGG + Intergenic
966884881 3:184371820-184371842 CTGTCTACACAGCCTTACCTGGG + Intronic
972406405 4:38750840-38750862 CTGCCTGCAGCTCTCTCCCTAGG - Intergenic
974741575 4:66014136-66014158 CTGCCACCACCCCTCTCCCTAGG + Intergenic
986574684 5:9199415-9199437 CTGCCCTCCCCGCTCTTCCTAGG + Intronic
987123807 5:14792531-14792553 CCTCCTTCACCGCTCTATCTAGG + Intronic
1005511427 6:26515346-26515368 CTGCCTTCACCTCTCTCTCTTGG - Intergenic
1007179072 6:39915522-39915544 CTGGCTCCACCTGTCTACCTTGG + Intronic
1008462583 6:51792803-51792825 CTGGCTCCACCACTCTCCCTGGG + Intronic
1009903538 6:69839677-69839699 CTGCCTACACCGATGTTACTTGG + Intergenic
1015853970 6:137603908-137603930 ATGCCTGCACCCCTCTACCCAGG + Intergenic
1031394671 7:121258447-121258469 CTGCAAACACCACTCTGCCTAGG - Intronic
1036978089 8:13437660-13437682 CTGCCTACACAGTTGTCCCTGGG - Intronic
1039516887 8:38141108-38141130 CTGCATTTACCTCTCTACCTCGG + Intronic
1040542376 8:48371999-48372021 CTGACTACACAGCTTTAACTTGG - Intergenic
1045150779 8:99405214-99405236 CTGCCTACACATCTCTACTTAGG + Intronic
1048620751 8:136130289-136130311 ATGTATACACCGCTCTACCTGGG + Intergenic
1057353793 9:94319595-94319617 CTCCCTCCGCTGCTCTACCTGGG + Exonic
1061920528 9:133780037-133780059 CTGCCTTGACCCCTCTATCTAGG - Intronic
1192577998 X:72258215-72258237 CTGCCTCCCCAGCTCTGCCTTGG + Intronic
1201799763 Y:17942237-17942259 CTACCTACACCACTATATCTAGG - Intergenic
1201801790 Y:17963719-17963741 CTACCTACACCACTATATCTAGG + Intergenic