ID: 1099275040

View in Genome Browser
Species Human (GRCh38)
Location 12:80563909-80563931
Sequence GTATTCAACATTTGTCAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099275038_1099275040 15 Left 1099275038 12:80563871-80563893 CCTTATTACTGCTAAGAGAGAGA 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1099275040 12:80563909-80563931 GTATTCAACATTTGTCAGTATGG 0: 1
1: 0
2: 1
3: 11
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099275040 Original CRISPR GTATTCAACATTTGTCAGTA TGG Intronic
907649755 1:56283909-56283931 GTCTTGAACATTTTTTAGTAAGG - Intergenic
908017024 1:59853112-59853134 GTATTCTATATATGTCAGTTAGG + Intronic
910453308 1:87369605-87369627 TTATTCAACATTTATCAATTGGG + Intergenic
911509060 1:98789300-98789322 ATATTCAACATTTGTCAGATGGG - Intergenic
912831969 1:112960896-112960918 GTATACAACATTTGTATGTATGG - Intergenic
920988174 1:210910207-210910229 GATTGCAACATTTTTCAGTAAGG - Intronic
923749654 1:236735721-236735743 GTACTCAACACTTGTCCGTCCGG + Intronic
1063099543 10:2937362-2937384 GTATAAAAAATTTGTCACTAAGG - Intergenic
1064962635 10:20982696-20982718 GTATTCAAAAGTTCTTAGTATGG + Intronic
1065500658 10:26378979-26379001 GAATTCAAAATATTTCAGTAGGG + Intergenic
1067978240 10:51050891-51050913 GTATTCAACATTAATCATCAGGG - Intronic
1069141456 10:64831771-64831793 GTATTCAAACTTTGTCATTATGG + Intergenic
1069732679 10:70628689-70628711 GTGTTCAACATTAGTCCTTAGGG - Intergenic
1070019715 10:72572284-72572306 GTATTCAAGATTTATTAGTTTGG + Intronic
1072856908 10:98957050-98957072 GTATGCAACATTAGTCATCATGG - Intronic
1073415346 10:103376389-103376411 GTATTAAACATTTCTCATTCAGG - Intronic
1074148949 10:110741242-110741264 GTATTCAATATTTGTTAGGGTGG + Intronic
1077453896 11:2666551-2666573 GAATTCTGCATTTGTCAGCAAGG + Intronic
1079613224 11:22458653-22458675 GTCTACAACATTTTTCTGTATGG - Intergenic
1080791977 11:35529488-35529510 GCATTCAACATTAGTCAGTATGG - Intronic
1082215590 11:49563844-49563866 GTATATAACTTTTGTCAGAAGGG + Intergenic
1082715594 11:56608134-56608156 GTATTCAACATTTATTTATATGG + Intergenic
1085496219 11:76972329-76972351 ATGTTCAACATTAGTCATTAAGG - Intronic
1086718008 11:90086671-90086693 AGATGCAACATTTGTCAGTGAGG + Intergenic
1087209827 11:95435927-95435949 TTATTCAACATTTGGCATTGGGG + Intergenic
1087335871 11:96843665-96843687 GTAATAAAAATTTGTAAGTAAGG + Intergenic
1088605330 11:111524669-111524691 GTTTTCTACATATGGCAGTAAGG - Intronic
1088844729 11:113655363-113655385 GTATACAAAATTTGCCAATATGG - Intergenic
1089691554 11:120189896-120189918 GGACTCAACATTTGCCAGTGGGG + Intergenic
1092805491 12:12218582-12218604 ATGTTCAACATCAGTCAGTAAGG + Intronic
1095269145 12:40195830-40195852 CTATTCAACATATTTCTGTAAGG + Intergenic
1095551476 12:43446594-43446616 GTCTTCAACAGTTCTCATTATGG - Exonic
1097482807 12:60152019-60152041 ATATTCAATAATTATCAGTAAGG + Intergenic
1098019559 12:66138968-66138990 TTATTCAACATTTGTCTTTATGG + Intronic
1099053705 12:77811545-77811567 ATCTTCCACATTTGTCAGAAGGG + Intergenic
1099275040 12:80563909-80563931 GTATTCAACATTTGTCAGTATGG + Intronic
1100967933 12:100033379-100033401 TTATTCAATACATGTCAGTAGGG - Intronic
1102903068 12:116653747-116653769 GTGTTCAACAATTGTCACCAAGG + Intergenic
1104132236 12:125905321-125905343 GAATTCAACATCAGTCAGTGAGG + Intergenic
1105962111 13:25351596-25351618 ATGTTCAACATTAGTCATTAGGG - Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1110183762 13:72648463-72648485 GTATTCAACCTCAGGCAGTATGG - Intergenic
1112279127 13:98047399-98047421 GTCTTCAATGTTTGTTAGTAAGG - Intergenic
1112935419 13:104791745-104791767 GTGTTAAACATTTGGCAGTGGGG + Intergenic
1114203226 14:20542525-20542547 GTATTCAACACTGGTCAAAAAGG + Intergenic
1114381292 14:22207333-22207355 TTATTCAGCATTTCTCAGTCTGG + Intergenic
1114892145 14:26938338-26938360 TTATTCAACAGTTGTAAGTTGGG + Intergenic
1114919475 14:27308516-27308538 GTATACAACATGTGCCAGGAAGG + Intergenic
1115712315 14:36063884-36063906 GCATTCAACACTTGTCTGTGTGG - Intergenic
1117863170 14:60114538-60114560 GTATTGATCATTTGTAAGTTGGG + Intronic
1118712501 14:68533741-68533763 GTACTCAACATTGCTCAGAAAGG - Intronic
1124009677 15:25828296-25828318 GTATTCTACAGTTGTCTGTCAGG - Intronic
1125058901 15:35395251-35395273 GTATTTAACCATTGACAGTAGGG - Intronic
1125865704 15:43046273-43046295 GTCTACTACATTTGTGAGTATGG + Intronic
1128464166 15:67895049-67895071 GTGTTCTACAGTTGTCAATAAGG + Intergenic
1128473552 15:67976903-67976925 GAATTCAACATTAGTCATTAGGG - Intergenic
1129623407 15:77170698-77170720 GTACTCAAAATATGTCCGTAAGG + Intronic
1131726354 15:95229976-95229998 GAATTCAAAATTACTCAGTATGG + Intergenic
1131788989 15:95944007-95944029 GTATTCAGTATTTGTCATTAGGG + Intergenic
1132135207 15:99330190-99330212 GATTTCAACATTTGGCATTATGG + Intronic
1132413421 15:101603111-101603133 GTAGTGGACATTGGTCAGTAGGG - Intergenic
1138302157 16:55939671-55939693 GTATTCCATAAATGTCAGTAAGG - Intronic
1146386000 17:32374064-32374086 TTTTTCAATATTTTTCAGTAGGG + Exonic
1147210954 17:38872154-38872176 GTATTCACCATCTGTCAGATGGG + Intronic
1155058709 18:22208876-22208898 ATATTCAACATTTGTCCAAATGG + Intergenic
1156635040 18:39017586-39017608 GTATTCAAAACTTGTCTGTTTGG + Intergenic
1156676621 18:39534400-39534422 GTAACCACCATTTGTCATTATGG - Intergenic
1166867670 19:45850411-45850433 GTATTAAATATTTGTTTGTAAGG - Intronic
926446662 2:12951009-12951031 GTGCTCAAAATTTGTCAGTTCGG + Intergenic
927135364 2:20092820-20092842 ATCTTCGAGATTTGTCAGTAAGG + Intergenic
928567930 2:32572419-32572441 GTATTGAACATTTCTTTGTAGGG + Intronic
929308837 2:40398891-40398913 GTTTGCAAAATTTGTCAGTGTGG + Intronic
930906403 2:56573401-56573423 ATATGCAACATTTTTTAGTAAGG + Intergenic
933555663 2:83827271-83827293 GTATTCTACATTTAACAGCAGGG + Intergenic
933657321 2:84899757-84899779 GTGTTCCAGATTTGGCAGTAAGG - Intronic
934577181 2:95410422-95410444 GGCCTCAACCTTTGTCAGTATGG - Intronic
938542907 2:132300412-132300434 GTAAACAACTTTTGGCAGTATGG + Intergenic
940449063 2:153815557-153815579 GTATTCAAGATTTGTATGTTTGG - Intergenic
940701326 2:157046840-157046862 GTTTTCCACATTTATCAGTGTGG + Intergenic
942636328 2:178010733-178010755 ATATTCTACATTTGTCATTTTGG - Intronic
943688792 2:190847805-190847827 GTATTCAAAATTTTCCAGGAAGG + Intergenic
945751402 2:213789600-213789622 ACATTCAACATTTGACAGTTCGG + Intronic
1171871785 20:30533245-30533267 GTAAACAACTTTTGGCAGTATGG + Intergenic
1173149322 20:40552035-40552057 GAATCCAACAGTGGTCAGTAAGG + Intergenic
1177304261 21:19292342-19292364 TTATTCAAGATTTTTCAATAGGG - Intergenic
951924175 3:27888742-27888764 TTATTGAACATTTGGCTGTAAGG - Intergenic
952481378 3:33764986-33765008 ATAATCAACATTTTACAGTATGG - Intergenic
955630403 3:60966991-60967013 ATATTCCACAATGGTCAGTATGG + Intronic
955805669 3:62731470-62731492 GTAGTCCACATTTGTCATTGTGG + Intronic
956353344 3:68363196-68363218 GTGTTCAACATTTGTTAATTTGG + Intronic
957823498 3:85409968-85409990 ATACTCAAGAGTTGTCAGTAAGG - Intronic
958028748 3:88081441-88081463 GTCTGCAACATTTGTCATTGTGG + Intronic
960139327 3:114137272-114137294 CCATTCAGCAGTTGTCAGTAAGG - Intronic
960298865 3:115977181-115977203 GTATTTTACCTTTTTCAGTATGG + Intronic
963884732 3:150569024-150569046 GAATTGAACATGTGTAAGTAGGG + Intronic
965086694 3:164109403-164109425 CTATTCAAGATTTCTCAGAATGG - Intergenic
966338093 3:178893616-178893638 GTGTTCAACAATTGTCAATTAGG - Intergenic
967612282 3:191521560-191521582 GGATTCTACACATGTCAGTAAGG - Intergenic
967999251 3:195191999-195192021 GTATTCCATATATGTCAGTTAGG - Intronic
970025771 4:11622578-11622600 GACTTGAAAATTTGTCAGTATGG - Intergenic
971095168 4:23392597-23392619 GTTTTCATCAATTCTCAGTATGG - Intergenic
971956240 4:33422883-33422905 TTATTCAAGATTTGGCAGAATGG + Intergenic
973309490 4:48693032-48693054 GCATTCCACATAGGTCAGTAGGG - Intronic
974583870 4:63844148-63844170 GTGTTCCACATTAGTCATTAAGG + Intergenic
975723876 4:77273536-77273558 GTATACAGCATTTGTCATGAAGG + Intronic
979962890 4:127042331-127042353 GTATCCCACATTAGTCAGAATGG + Intergenic
984125654 4:175806688-175806710 TTCTACAACATCTGTCAGTAGGG - Intronic
987540258 5:19245832-19245854 ATATTCGACCTTTGTCAGAAGGG - Intergenic
990122008 5:52466394-52466416 GTATGCAGCATTTGTCAGCATGG - Intergenic
990237420 5:53783057-53783079 GTATTCAATAATGGTCAGTTAGG + Intergenic
990271832 5:54150488-54150510 GTATTCATGTTTTGTCAATATGG + Intronic
990925125 5:61012382-61012404 GTCTTCAATATTTGTCTGTTGGG - Intronic
995254559 5:110031706-110031728 GTAGTGAACATTTTTCAGGAAGG + Intergenic
995273737 5:110254165-110254187 GTGTTCTATATATGTCAGTAAGG - Intergenic
996957856 5:129206723-129206745 GTATTTATCATTTTTTAGTAAGG + Intergenic
997029016 5:130100598-130100620 TTATTTAACTTTTGTCACTAAGG - Intronic
998753328 5:145349330-145349352 GATTTCAACATTTGCCATTATGG + Intergenic
1003884423 6:10508375-10508397 GTCTTCAACATTAGTGATTAGGG + Intronic
1004160759 6:13210755-13210777 GTATTGAACATTAGCCAGCATGG + Intronic
1007148670 6:39664803-39664825 GATTTCAACATTTGGCATTACGG - Intronic
1008358318 6:50583443-50583465 GTATTCAACAGTTTTCATAAAGG + Intergenic
1008469919 6:51873234-51873256 GTTTTCATCATTTGTAAGTTTGG - Intronic
1009472057 6:64039152-64039174 GATTTCTACATTTGTCAGTCAGG - Intronic
1009486370 6:64228107-64228129 GTAGTCGACATGTGTCAGTATGG + Intronic
1010150861 6:72730514-72730536 GGATTCAACTTTTTTCTGTATGG + Intronic
1010696806 6:78985424-78985446 GTATTCAACATATCTTAGGAAGG - Exonic
1011972830 6:93249150-93249172 ATATGCAACATTTGTAATTATGG - Intronic
1014653880 6:124074623-124074645 GTATTGAAAGTGTGTCAGTATGG - Intronic
1018843924 6:167540921-167540943 CTTTTCAACATTTGTCAGGCGGG - Intergenic
1020688809 7:11329265-11329287 GTATTCAAAATTTGTAGATACGG - Intergenic
1021231963 7:18095730-18095752 ATATTCAACATTTGTTTGTTGGG - Intronic
1027583967 7:80033864-80033886 GTATACCACATTATTCAGTATGG + Intergenic
1028562964 7:92195605-92195627 GAATTCAACATCTGGCAGTCTGG - Intergenic
1030816322 7:114041881-114041903 TTTTTCAAGATTTGTAAGTAGGG + Intronic
1035645767 8:1217989-1218011 GTATTAGACCTTTGTCAGAAGGG + Intergenic
1036991396 8:13600353-13600375 GTAATTAAAATTTCTCAGTAAGG + Intergenic
1037208238 8:16352175-16352197 GTATTCCAGATTTGTCAATTAGG + Intronic
1038582450 8:28760756-28760778 ATATTCAACACTGGTCATTAGGG - Intergenic
1038788437 8:30644155-30644177 GAATCAAAGATTTGTCAGTATGG - Intronic
1041339753 8:56832022-56832044 GTTATCCTCATTTGTCAGTACGG + Intergenic
1043254803 8:78121159-78121181 ATATTCAATGTCTGTCAGTATGG + Intergenic
1045678704 8:104635586-104635608 TTATTCAACATATGTCATGATGG + Intronic
1047124981 8:121949822-121949844 GTATTCTGCATTAGTCAGTGTGG + Intergenic
1048674455 8:136762525-136762547 ATATTCAACCTTTGTCAGATGGG + Intergenic
1057739741 9:97701035-97701057 ATATTCATCATTAGTCATTAGGG + Intergenic
1188117302 X:26261210-26261232 TGATTCAACATTTGTAACTAAGG - Intergenic
1188158933 X:26776549-26776571 ATATTGAACATTTGCCAGTCAGG - Intergenic
1188815705 X:34711382-34711404 TTATTCAACATTTGGCAGGAAGG - Intergenic
1188947410 X:36323532-36323554 TTATTCAATATTAGGCAGTAAGG + Intronic
1189433946 X:40974426-40974448 GAATTTTAAATTTGTCAGTAAGG + Intergenic
1190342703 X:49310154-49310176 GAATACAACATTTGTAAGTCAGG + Intronic
1190497846 X:51043779-51043801 GTATTCATCTCTTGCCAGTATGG - Intergenic
1194116783 X:89910219-89910241 GTATTCATCATTAGTCATTAGGG + Intergenic
1195072468 X:101293655-101293677 AAACTCAACATATGTCAGTAAGG - Intergenic
1195198716 X:102525189-102525211 GTATTAGACCTTTGTCAGAAGGG - Intergenic
1196856456 X:119989893-119989915 TTATTTGACATTTATCAGTAGGG + Intergenic
1196857987 X:120001245-120001267 TTATTTGACATTTATCAGTAGGG - Intergenic
1197144962 X:123161285-123161307 ATTTTCAACATATGTCATTAAGG - Intergenic
1200469577 Y:3567386-3567408 GTATTCATCATTAGTCATTAGGG + Intergenic