ID: 1099279641

View in Genome Browser
Species Human (GRCh38)
Location 12:80627469-80627491
Sequence ATGCATCTTTATCAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099279641 Original CRISPR ATGCATCTTTATCAGGAGCC AGG Intronic
905664421 1:39754068-39754090 ATGCCTATTTGTCAGGAGACAGG + Intronic
908363184 1:63390235-63390257 AGGAACCTTAATCAGGAGCCAGG + Intronic
909488058 1:76196317-76196339 TTGCATTTTTATCAGGTTCCTGG + Intronic
910656254 1:89621816-89621838 ATGCATCTATGTTAGGAGTCTGG + Intergenic
917093736 1:171379834-171379856 ATCCATCTTTTTGAGGAGCTTGG - Intergenic
919706207 1:200678246-200678268 AGCCATTTCTATCAGGAGCCTGG + Intergenic
920760730 1:208781569-208781591 ATGCATCTGCCTCAGGGGCCTGG + Intergenic
923274280 1:232383343-232383365 AAGCATTTTAATCAGGAGCTTGG + Intergenic
923495511 1:234521067-234521089 ATGCAGCTTTGTCAGGGGCTAGG + Intergenic
1070603288 10:77880578-77880600 ATTCAGCTTGATCAGGAGTCGGG - Intronic
1072165185 10:92806178-92806200 CTGGATATTTGTCAGGAGCCTGG + Intergenic
1073375115 10:103027201-103027223 TTGCATCTTTGTCAGGAAACTGG - Intronic
1074613702 10:115044922-115044944 GTCCCTATTTATCAGGAGCCTGG - Intergenic
1075240335 10:120772814-120772836 TTACAGCTTTAGCAGGAGCCTGG + Intergenic
1077349360 11:2085324-2085346 AACCATGTTGATCAGGAGCCCGG + Intergenic
1078025876 11:7695258-7695280 ATGCATCATTTTCAGGAGACAGG - Intronic
1079902052 11:26198959-26198981 ATGCATCTTTTGTATGAGCCAGG - Intergenic
1081567617 11:44269751-44269773 ATCCCTCTTTATCAGTGGCCTGG + Intronic
1084541041 11:69787450-69787472 ATGCATCTTTGTCAAGGGCATGG + Intergenic
1085616462 11:78003386-78003408 ATTCAACATTATCAAGAGCCTGG - Intergenic
1085888698 11:80552031-80552053 AGGCATGTTTATCTGGAGCATGG + Intergenic
1086965061 11:93018976-93018998 CTGCATTTTTATCAGCATCCTGG + Intergenic
1089358100 11:117868913-117868935 ATGAATCTGTAACAGGAGCTGGG + Intronic
1089364016 11:117910021-117910043 AGGCATCCTGATCAGGAGCTCGG - Intronic
1089833886 11:121353069-121353091 AAGCATATTTATCAGTACCCTGG + Intergenic
1091354534 11:134925842-134925864 ATCCATTTCTATAAGGAGCCTGG + Intergenic
1091891780 12:4061074-4061096 ATGAGTCTTTATCTTGAGCCAGG - Intergenic
1095122730 12:38438172-38438194 GTACATCTTTATCAGCAGCATGG - Intergenic
1096198028 12:49661629-49661651 AGGCATCTCTACCAGAAGCCAGG + Intronic
1098861256 12:75712954-75712976 ATCCATGTTTATTATGAGCCAGG - Intergenic
1099279641 12:80627469-80627491 ATGCATCTTTATCAGGAGCCAGG + Intronic
1101797326 12:107987334-107987356 ATGCAACTTTACCAGAAGGCTGG + Intergenic
1104185436 12:126425958-126425980 ATGCACCTTCATCATGAACCCGG + Intergenic
1104223125 12:126805280-126805302 AGGCATGGTTGTCAGGAGCCAGG - Intergenic
1104735569 12:131134083-131134105 CTGCTTCTTTTTCAGGAGTCTGG - Intronic
1105581440 13:21700387-21700409 ATGCATTTTTAACAGGTCCCTGG - Intronic
1106580081 13:31010205-31010227 ATGCATCTGTACCATGAGCAAGG - Intergenic
1112692645 13:101915572-101915594 AGGCATCCTATTCAGGAGCCAGG - Intronic
1113349460 13:109514074-109514096 GTGTATCTTTCTCAGGAGACTGG + Intergenic
1120048454 14:79836432-79836454 ATGGAACTTTCTCATGAGCCAGG - Intronic
1120708929 14:87773194-87773216 ATGCATCTTTGTCAGGGGTGCGG + Intergenic
1120762762 14:88300678-88300700 ATGCATTCTTATGATGAGCCAGG - Intronic
1125152263 15:36546440-36546462 GTGTATCTTTATCAGCAGCTTGG - Intergenic
1125175950 15:36821957-36821979 ATGCATTTTAATCAGGAGCTTGG + Intergenic
1125858523 15:42974924-42974946 ATGGATTTTTATCGGGAGGCTGG + Intronic
1129445987 15:75618372-75618394 ATACAGCTTTCTCAGAAGCCAGG + Intronic
1131046691 15:89321109-89321131 ATGCATGGTGAGCAGGAGCCGGG - Exonic
1135293455 16:21260015-21260037 ATACAATTTTATCTGGAGCCTGG - Intronic
1135956912 16:26963460-26963482 ATGGATGTGTAGCAGGAGCCTGG + Intergenic
1138825969 16:60320310-60320332 ATCCATCTTTATCAGTAGAATGG + Intergenic
1141118807 16:81334884-81334906 ATTCATATTTATCAAGTGCCTGG + Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1147446466 17:40478022-40478044 ATGCATCTTGATCATCAGACTGG + Intronic
1147684929 17:42281513-42281535 ATGCTTTTTTATCAAGTGCCAGG - Intergenic
1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG + Intergenic
1152830730 17:82495734-82495756 GTGCATCCTTCCCAGGAGCCTGG + Intergenic
1203174215 17_GL000205v2_random:180311-180333 AATGATTTTTATCAGGAGCCAGG + Intergenic
1153729305 18:7991985-7992007 ATGTATCTTTTTCTGGAGGCTGG - Intronic
1158509561 18:58078586-58078608 ATGCATCTTACTCAAGAGACAGG - Intronic
1158886447 18:61831518-61831540 ATTCAACTTTCTAAGGAGCCAGG + Intronic
1159484447 18:69036638-69036660 ATGCATGTATTTCAAGAGCCTGG - Intronic
1162682775 19:12359258-12359280 ATTCAACATTATCAGCAGCCTGG - Intronic
1163030860 19:14543246-14543268 ATGAATGTTTCTCAGGAGCTGGG + Intronic
1166133202 19:40759343-40759365 TTGGACCTTTATCAGGGGCCAGG - Intronic
1167777853 19:51572809-51572831 ATTCATATTTATCACGTGCCAGG + Intronic
929450937 2:42036657-42036679 CAGCATCTTTATCAGGAGCTGGG - Intergenic
933663620 2:84946923-84946945 ATGCAACTGTATCTGGAACCAGG - Intergenic
937907012 2:127057377-127057399 ATGCTTCTGTCTCAAGAGCCAGG - Intronic
938369487 2:130760391-130760413 ATGCTTCTTCATGAGGACCCAGG - Intronic
939171324 2:138699657-138699679 ATTCATCCTTCTCAGAAGCCTGG - Intronic
939493776 2:142904996-142905018 ATGCATCTTGATGGGCAGCCAGG - Intronic
939656742 2:144835637-144835659 AAGCATCTCTCTCTGGAGCCAGG + Intergenic
1176327501 21:5514297-5514319 AATGATTTTTATCAGGAGCCAGG - Intergenic
1176330205 21:5541953-5541975 AATGATTTTTATCAGGAGCCAGG + Intergenic
1176397552 21:6278998-6279020 AATGATTTTTATCAGGAGCCAGG - Intergenic
1176400256 21:6306654-6306676 AATGATTTTTATCAGGAGCCAGG + Intergenic
1176436901 21:6682450-6682472 AATGATTTTTATCAGGAGCCAGG - Intergenic
1176439605 21:6710106-6710128 AATGATTTTTATCAGGAGCCAGG + Intergenic
1176461163 21:7009520-7009542 AATGATTTTTATCAGGAGCCAGG - Intergenic
1176463867 21:7037175-7037197 AATGATTTTTATCAGGAGCCAGG + Intergenic
1176484724 21:7391298-7391320 AATGATTTTTATCAGGAGCCAGG - Intergenic
1176487428 21:7418954-7418976 AATGATTTTTATCAGGAGCCAGG + Intergenic
1180969325 22:19806894-19806916 ATGCAGCCTAATTAGGAGCCTGG - Intronic
1182022198 22:27090670-27090692 AGGCAGCTTGAACAGGAGCCAGG + Intergenic
1184007283 22:41719615-41719637 ATGCAGCGGTATCAGGAGCTGGG - Intronic
1184053507 22:42027121-42027143 AAGCCTCGTTTTCAGGAGCCTGG - Exonic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
951978798 3:28543450-28543472 AAGCAGCTTAAACAGGAGCCTGG - Intergenic
953404247 3:42652773-42652795 AGGCATCAGCATCAGGAGCCAGG - Intergenic
954984637 3:54778878-54778900 ATGCATCTTCACCATGAGACTGG + Intronic
956334705 3:68150329-68150351 ATGCATCTCAAGGAGGAGCCTGG + Intronic
958016459 3:87944239-87944261 ATGCATCTTGATGGGGAGCTGGG - Intergenic
960665021 3:120100189-120100211 CTCCATCTTAAACAGGAGCCGGG - Intergenic
964938113 3:162119783-162119805 TTATATCTTTATCAGGTGCCAGG + Intergenic
966034916 3:175399803-175399825 CTGCATCTTCAACAGGAGCCGGG - Intronic
967006437 3:185387473-185387495 AGGCATCAGAATCAGGAGCCAGG + Intronic
967322058 3:188204379-188204401 ATGCATCTTTAGGATGTGCCGGG + Intronic
969878586 4:10154728-10154750 ATGGTACTTGATCAGGAGCCAGG - Intergenic
970958261 4:21840417-21840439 ATGCATATTTAGCAAGAGCAGGG - Intronic
973982954 4:56321824-56321846 ATTCATATTTATAATGAGCCTGG - Intronic
975000880 4:69222600-69222622 AAGCAGCTTTAGCAGCAGCCTGG - Intergenic
975012979 4:69378640-69378662 AAGCAGCTTTAGCAGCAGCCTGG + Intronic
975356319 4:73409451-73409473 AGGCAGCTTTATCAGCAGCTTGG - Exonic
975600672 4:76096424-76096446 ATATATCTTTTTTAGGAGCCAGG + Intronic
977285761 4:95104811-95104833 TTGCACCTTTACCAGGAGCCTGG - Intronic
979225344 4:118278540-118278562 ATGCGTCTGGATCCGGAGCCAGG + Intergenic
980711941 4:136580377-136580399 ATGCATCTTTTTCAGGAAGTTGG + Intergenic
981307409 4:143261365-143261387 ACTAATCTTTATCAGGAACCTGG - Intergenic
985043809 4:185919369-185919391 GTTCATCTTGATGAGGAGCCTGG - Intronic
991657192 5:68915844-68915866 ATGCAGTTCTACCAGGAGCCAGG + Intergenic
994879197 5:105464525-105464547 ATTCATCTGTAGCAGGAGCTAGG - Intergenic
995896387 5:117016348-117016370 ATGCATCTTTAGCAAGGGCTGGG + Intergenic
996651665 5:125885279-125885301 ATGCATCCTTATCAATAGCCTGG - Intergenic
998744137 5:145237658-145237680 ATGAATCTTTAGAAGGAACCAGG - Intergenic
1000038448 5:157466851-157466873 ATGCCTCTATATCTGTAGCCTGG - Intronic
1001380379 5:171302373-171302395 ATACATCTTTCTCAGGGGCCAGG - Intergenic
1014670118 6:124292610-124292632 ATCCATCTTGAACAGGAGCTGGG - Intronic
1015370308 6:132443416-132443438 ATGCATACTTATCTGGACCCTGG - Intergenic
1017875144 6:158517982-158518004 AAGCATCTTTATGAGGTGCATGG + Intergenic
1021198487 7:17698908-17698930 ATGCAAGTTTATTTGGAGCCAGG - Intergenic
1021704683 7:23355184-23355206 ATGTATATTACTCAGGAGCCTGG + Intronic
1026344278 7:69460926-69460948 ATGCATCTTTCTTAGGAGACAGG - Intergenic
1026861232 7:73791228-73791250 CTCCATCTTTAACAGGAGCAGGG + Intergenic
1032433633 7:131882639-131882661 GAGCATCTTTCTGAGGAGCCTGG + Intergenic
1034107203 7:148500616-148500638 TTGCATCTTTCTTAGGATCCAGG - Intergenic
1034541839 7:151763472-151763494 ATGCATCTGTGCCAGGAGCTTGG - Intronic
1036035899 8:5018572-5018594 ATGCATCTGTATGAGGAGCATGG - Intergenic
1036201699 8:6775790-6775812 TAGAATCTTTGTCAGGAGCCAGG - Intergenic
1036693617 8:10960397-10960419 ATGCATCTTGACCAGGAGACTGG - Intronic
1037681210 8:21099142-21099164 ATGCATCTTTGCCAGGTACCAGG - Intergenic
1039415428 8:37389853-37389875 ATGCATCTTTATTATGTGCCAGG - Intergenic
1040780989 8:51109137-51109159 ATGCATCTTTATTAGTTGTCTGG + Intergenic
1042219306 8:66457872-66457894 ATGAATCTGTATCAGGAAGCAGG + Intronic
1043221799 8:77674705-77674727 ATGCATATTCATCAGAAACCAGG - Intergenic
1044167853 8:89010044-89010066 ACACAGCTTTAGCAGGAGCCTGG - Intergenic
1044639542 8:94364145-94364167 ATACATCTGTCTCAGGAACCTGG + Intergenic
1048780267 8:137991794-137991816 AAGCAGCTTTAGCAGCAGCCTGG + Intergenic
1050150323 9:2613434-2613456 AAGCACTTTTAGCAGGAGCCAGG - Intergenic
1052198423 9:25746702-25746724 ATGTATCTTTATTTGGAGGCAGG + Intergenic
1057224404 9:93282147-93282169 GGGCATATTTATCAGGAGGCAGG + Intronic
1061966616 9:134018070-134018092 AAGAATCTCTATTAGGAGCCTGG - Intergenic
1061975000 9:134063586-134063608 ATGCATCTGTGTGAGGTGCCCGG - Intronic
1203431890 Un_GL000195v1:98373-98395 AATGATTTTTATCAGGAGCCAGG - Intergenic
1203434610 Un_GL000195v1:126211-126233 AATGATTTTTATCAGGAGCCAGG + Intergenic
1203489549 Un_GL000224v1:90443-90465 CTGCAACTTGATCAGGAGCTAGG - Intergenic
1203502170 Un_KI270741v1:32331-32353 CTGCAACTTGATCAGGAGCTAGG - Intergenic
1185994942 X:4936134-4936156 ATTCTTCTCTATCTGGAGCCTGG - Intergenic
1188655320 X:32687152-32687174 AAACTTCTTAATCAGGAGCCTGG + Intronic
1188820414 X:34768044-34768066 ATGCATTTTTAGCAGGAGCTTGG + Intergenic
1190132203 X:47758954-47758976 ATGCATCTATATTAGGAGGATGG + Intergenic
1192470464 X:71394457-71394479 CTGCCTCTGTATCAGGTGCCTGG + Intronic
1193188250 X:78538883-78538905 CTGCAGCTTTATCAGGTGCATGG + Intergenic
1194021596 X:88698088-88698110 ATGGATCTTTATTAGGAAACAGG - Intergenic
1199041420 X:143119358-143119380 CTGCAGCTTTATCAGGTGCGCGG + Intergenic