ID: 1099281137

View in Genome Browser
Species Human (GRCh38)
Location 12:80647842-80647864
Sequence TTATGTTTACCCTGAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099281135_1099281137 7 Left 1099281135 12:80647812-80647834 CCCTGTTTGGCAATGGAATAGTC 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1099281137 12:80647842-80647864 TTATGTTTACCCTGAGAAGCTGG 0: 1
1: 0
2: 2
3: 18
4: 188
1099281136_1099281137 6 Left 1099281136 12:80647813-80647835 CCTGTTTGGCAATGGAATAGTCT 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1099281137 12:80647842-80647864 TTATGTTTACCCTGAGAAGCTGG 0: 1
1: 0
2: 2
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099281137 Original CRISPR TTATGTTTACCCTGAGAAGC TGG Intronic
900950599 1:5856328-5856350 TAAAGTTTACCTTGAGAACCTGG + Intergenic
901337751 1:8465833-8465855 TTCTGCTTTCCCTGAGCAGCAGG + Intronic
904506702 1:30962270-30962292 TTTTGTTTTCCCTGTGAAGAAGG - Intronic
905325379 1:37148107-37148129 TTCTGTTTACACTGTGACGCAGG - Intergenic
905691955 1:39949866-39949888 ATCTATTTACCCTGAGAAGCGGG - Intergenic
905829845 1:41056838-41056860 TTATATTTACTGTGAGAATCCGG - Intronic
906838855 1:49113836-49113858 TTTTTTTTTCCCTGAGAAGTAGG + Intronic
908626214 1:66046216-66046238 AAATGTTTACCTTGAGCAGCAGG + Intronic
910208419 1:84770726-84770748 TGATGTTGACCCTGAGCAGTGGG + Intergenic
910881153 1:91923424-91923446 GTCTGTTTATCCTGAGAAGAAGG - Intergenic
912510714 1:110188491-110188513 TTCTGTTTTCCCTGTAAAGCAGG - Intronic
913432332 1:118809015-118809037 TTATGTTTGTCCTTAGAATCTGG - Intergenic
916209697 1:162350230-162350252 ACATGTTTACTCTGAGGAGCTGG + Intronic
916863207 1:168828698-168828720 TTTTGTTCACTCTGACAAGCTGG - Intergenic
917620310 1:176788751-176788773 TCATGTCTACTTTGAGAAGCTGG + Intronic
924865640 1:247976945-247976967 TGATGTGTACCCTGAGAAAAGGG - Intronic
924867090 1:247995179-247995201 TGATGTTTACACTGAGAAAAGGG - Intronic
1063264584 10:4434077-4434099 TTGTGTGTAGCCTGAGAACCAGG + Intergenic
1064590288 10:16883180-16883202 TTAACTTTACCCTGAGTAGCTGG + Intronic
1066646108 10:37611093-37611115 TTATGTTCATTCTGTGAAGCAGG - Intergenic
1070846216 10:79524245-79524267 TTAGGGCTACCCTGAGAAACTGG + Intergenic
1070927582 10:80236065-80236087 TTAGGGCTACCCTGAGAAACTGG - Intergenic
1072435630 10:95412704-95412726 TTATGTTTGCCTGGAGTAGCAGG - Intronic
1074858182 10:117488899-117488921 CTATGTTGACACTGTGAAGCAGG - Intergenic
1075924407 10:126238831-126238853 TCAGGTTTACCCTCAGAAACAGG - Intronic
1076016025 10:127028172-127028194 TTATGTCTAACGGGAGAAGCAGG + Intronic
1078697491 11:13648980-13649002 ATATGTTTACCCGGAGAAGGGGG - Intergenic
1078849024 11:15147122-15147144 TTAGTTTTACCCTGAGAAGTTGG + Intronic
1079842000 11:25414886-25414908 TTATGTTCTCACTCAGAAGCGGG + Intergenic
1080373863 11:31684767-31684789 TTTTGTTTACGCTGTGAAGAAGG - Intronic
1083038194 11:59659892-59659914 TTAAGTTTACACTTAGAAACAGG + Intronic
1083195115 11:61081467-61081489 TTCTGGCTACCTTGAGAAGCTGG + Intergenic
1084345641 11:68546402-68546424 TTATGTGTACACTGAAAATCGGG - Intronic
1085682730 11:78593438-78593460 TGATCTTCACCCTGAGAACCTGG + Intergenic
1087273928 11:96141457-96141479 TTGTGCTTACCCTGAGAACAGGG + Intronic
1088688347 11:112304044-112304066 TCATGATCACCCTAAGAAGCAGG + Intergenic
1088823085 11:113473412-113473434 TAATGAATTCCCTGAGAAGCTGG - Intronic
1089693609 11:120201878-120201900 TTATGATAACTCTGGGAAGCAGG - Intergenic
1089807298 11:121102608-121102630 TTCTGTTTACTCTGGCAAGCTGG + Intronic
1093885850 12:24459466-24459488 TTATATTTAACTGGAGAAGCAGG - Intergenic
1099281137 12:80647842-80647864 TTATGTTTACCCTGAGAAGCTGG + Intronic
1101654519 12:106708347-106708369 TTTTTTTTTCCCTGAGAAGTAGG + Intronic
1102291942 12:111708032-111708054 TCATGCTTACCTTGAGAAGGAGG + Intronic
1103051003 12:117779452-117779474 TCATGTTCACCCTAAGAAGAGGG - Intronic
1104742820 12:131191204-131191226 TAATGCTTACCCCGTGAAGCTGG + Intergenic
1105449039 13:20482451-20482473 ATAAGTTTACTCTGAAAAGCTGG - Intronic
1105665602 13:22552453-22552475 TTATGTTTACTCTGAGGCTCGGG + Intergenic
1106613797 13:31308459-31308481 ATCTGTTTACCCTGAGAAGGGGG - Intronic
1107146224 13:37063138-37063160 TTATGTTTTCTCTAAGAAGATGG + Intergenic
1107288223 13:38821173-38821195 TTATGTTTTCCTTGAGAAATAGG + Intronic
1107663641 13:42665678-42665700 TGATATTCACCGTGAGAAGCAGG - Intergenic
1109116722 13:58398138-58398160 TTATGTTTGCCCTGGGATCCAGG + Intergenic
1109321659 13:60817916-60817938 TTATTTTTACTTTTAGAAGCAGG + Intergenic
1111894209 13:94120533-94120555 TTTTTTTTCCCCTGAAAAGCTGG + Intronic
1111974725 13:94953575-94953597 TTATGTTTATGGTGAAAAGCAGG - Intergenic
1112511591 13:100014229-100014251 GCATGCTTACTCTGAGAAGCTGG + Intergenic
1114130150 14:19782136-19782158 TTAAGTTTAACATGAGAGGCAGG - Intronic
1116708485 14:48334785-48334807 ATATGTTTTCCCTCATAAGCGGG - Intergenic
1120511143 14:85415870-85415892 TTCAGTTTATCCTGAGAGGCAGG + Intergenic
1120877051 14:89384703-89384725 TTATGGTTCCACTGAGAAGAGGG + Intronic
1121145863 14:91581816-91581838 TTATGTTTCCTTTGTGAAGCAGG + Intronic
1122069460 14:99196217-99196239 TCATGTGTTCCCTGAGAAGAGGG - Intronic
1123959843 15:25385903-25385925 CTATATTTACTGTGAGAAGCTGG - Intronic
1126617209 15:50596651-50596673 TTATATTTACCCTTCGAGGCAGG + Intronic
1127854114 15:62940969-62940991 TTATGTCTGCTCTGAGGAGCTGG + Intergenic
1129079147 15:73024076-73024098 TTATGTCTAGCTTGAGAGGCTGG - Intergenic
1135888678 16:26337362-26337384 TTTTGTTTACTCGGAGAAGGTGG + Intergenic
1135934038 16:26764148-26764170 TTAGTTTTACCTTGAGATGCAGG + Intergenic
1137661603 16:50211806-50211828 TAATGTTTACCCTGGCAGGCTGG - Intronic
1140951672 16:79824408-79824430 CTATGTTGAACATGAGAAGCAGG + Intergenic
1141812589 16:86385354-86385376 TGATGTTTAGCCTGACAAACAGG - Intergenic
1141864233 16:86739086-86739108 TTGTCTTTACCCTGAGCCGCTGG + Intergenic
1143098138 17:4489438-4489460 TTTTGTTTTTCCTGAGAAGGAGG + Intergenic
1143437462 17:6939861-6939883 TTATGTTCACCCTGAGAGACAGG + Intronic
1144551939 17:16248558-16248580 TTATGTATTCTCTGAGAAGATGG + Intronic
1147191576 17:38740975-38740997 TTAGGCTTCCTCTGAGAAGCAGG + Intronic
1147249762 17:39145976-39145998 TCTTGTTAACCCTGAGAAGACGG - Intronic
1149432694 17:56607036-56607058 CTATTTGTACCCAGAGAAGCTGG + Intergenic
1149547491 17:57514826-57514848 TTCTGTTGACCCTGAGAGGTTGG - Intronic
1150379391 17:64708716-64708738 TTATGTTTACGATGAAATGCAGG + Intergenic
1157619916 18:49011130-49011152 TCATGTTTACCCTGGGATTCAGG - Intergenic
1162175112 19:8824539-8824561 TGATCTTTACCCTGAGAAGCAGG - Intronic
1164877100 19:31699086-31699108 TTATGTTTATGCTGAGAATGCGG - Intergenic
1165159423 19:33807089-33807111 TTATGGTTACCATGACAACCAGG - Intronic
928305080 2:30162915-30162937 ATCTGTTTACCCTGAGAATGGGG + Intergenic
929071912 2:38039473-38039495 TTGTATTTTCCCAGAGAAGCGGG - Intronic
930519230 2:52442794-52442816 TGATGTTTCTCCAGAGAAGCTGG + Intergenic
931570961 2:63668694-63668716 TTCAGTTTACCCTGGAAAGCGGG - Intronic
932193516 2:69762562-69762584 TTATTTTTGCCCAGAGAACCAGG - Intronic
932194905 2:69774810-69774832 GTCTGTTTACCCTGAGAAGGGGG - Intronic
935856732 2:107282561-107282583 GGATCTTTACCCTGAGAATCTGG + Intergenic
935890741 2:107675064-107675086 TTGTCTTCACCCTGAGAACCTGG + Intergenic
937809870 2:126187311-126187333 TCCTGTTTACCCTGTGAAGGGGG - Intergenic
938902258 2:135808275-135808297 TTATATGTTCCTTGAGAAGCTGG - Intronic
939172805 2:138715500-138715522 GTTTATTTACCCTGATAAGCAGG - Intronic
941884171 2:170511574-170511596 TTATAGTAACCCTGAGAAGTAGG + Intronic
942792107 2:179772460-179772482 TTATTTTTCCCCTGAGAAAGAGG - Intronic
942891403 2:180993434-180993456 TTATTTTTCCCCAGACAAGCTGG - Intronic
945372114 2:209031972-209031994 TGATGTTTACCTTGATAACCTGG - Intergenic
1169400188 20:5273177-5273199 TTATGTTAACACTGAGACTCAGG - Intergenic
1169570322 20:6898993-6899015 TTTTGTTCTCCCTGAGCAGCAGG + Intergenic
1169697286 20:8404519-8404541 TTTTTTCTCCCCTGAGAAGCAGG + Intronic
1170531387 20:17295999-17296021 CTTTGTGTACCCTTAGAAGCTGG - Intronic
1170637263 20:18118324-18118346 ATATATTTACCATGAGAACCTGG + Intergenic
1175563165 20:59950339-59950361 TTATGTTTTCACTTAGAAGTGGG - Intergenic
1177447672 21:21218745-21218767 TTAATTTTAACCTGATAAGCTGG + Intronic
1180905266 22:19405951-19405973 TTCTGTGTGCCCTGATAAGCTGG - Intronic
1182064342 22:27419917-27419939 TTATATTCACCCAGAGCAGCTGG + Intergenic
1182973557 22:34600364-34600386 TTATGCTGACCCTATGAAGCTGG - Intergenic
1184208078 22:43017827-43017849 TTGTGTTTGTCCTGAGAAGGAGG - Intergenic
1184969486 22:48005041-48005063 TAATGCTCACCCTGAGCAGCCGG + Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950058576 3:10049809-10049831 TTAAATTTAGCCTGGGAAGCTGG + Intronic
950597717 3:13999303-13999325 GTATATTCACCCTGAGAACCTGG + Intronic
950748620 3:15110646-15110668 TTATGATGACCCTGGGAGGCGGG + Intergenic
952754277 3:36852419-36852441 ACATGTTTTTCCTGAGAAGCAGG + Intronic
957050434 3:75407573-75407595 GTTTGTTTACCCTGAGAAGGGGG + Intergenic
957282177 3:78167575-78167597 TTATGATGACACTGACAAGCAGG + Intergenic
957401599 3:79722516-79722538 TTTTGTTAACCCCGAGTAGCTGG + Intronic
959020370 3:101181987-101182009 GTCTGTTTACCCTGAGAAAGGGG + Intergenic
961882734 3:130074017-130074039 GTGTGTTTACCCTGAGAAGGGGG + Intergenic
962141073 3:132791559-132791581 TTCTGTTTAGCCTCACAAGCAGG + Intergenic
964641895 3:158917293-158917315 CTATGCTTGCCCTGAGGAGCTGG - Intergenic
965231234 3:166055423-166055445 TTATTTGTACCCTGAAAACCTGG + Intergenic
965843756 3:172937950-172937972 ATCTGTTTATCCTGAGAAGGGGG + Intronic
967972941 3:195012547-195012569 TTTTGTTCAGCCTGTGAAGCAGG - Intergenic
970248805 4:14092744-14092766 TCATGCTTTCCCTGAGAAGAAGG + Intergenic
970797051 4:19925210-19925232 TCATGTTTACCCTGTAAGGCAGG - Intergenic
971630310 4:28984066-28984088 TTATGTTTACTCTGTGAACTTGG + Intergenic
975973580 4:80071926-80071948 TTGTGTTTACTCTGAAGAGCTGG - Intronic
978215187 4:106192345-106192367 TTATGTTTACTTTGGCAAGCTGG + Intronic
978397186 4:108293979-108294001 TTATGTTTATTCTGAGAGGGTGG + Intergenic
978807937 4:112820052-112820074 GTATCTTCACCCTGAGAAGCAGG - Intronic
979552227 4:122003878-122003900 CTATGTTTACCCTGAGAGAATGG + Intergenic
979977235 4:127211979-127212001 GCATGTTTAGTCTGAGAAGCAGG - Intergenic
980633179 4:135464743-135464765 TTATGATTATCCTGAGAAATAGG - Intergenic
981212979 4:142130583-142130605 TTATATTAACCCTGAGAGGAAGG + Intronic
982344116 4:154337479-154337501 TAAGCTTTACCCTGAAAAGCTGG - Intronic
983404556 4:167311445-167311467 GTATATTTCCACTGAGAAGCTGG + Intergenic
984566538 4:181337473-181337495 TCATGTTTACCATTAGAGGCAGG + Intergenic
987877995 5:23705812-23705834 TTATGTTTTCCCTTGGAAGTGGG - Intergenic
990826027 5:59898915-59898937 ATATGTTGTCCCTGAGAAGATGG + Intronic
992499943 5:77332045-77332067 TAATTTCTACCCTGAGATGCTGG - Intronic
992506908 5:77395904-77395926 ATCTGTTTACCCTGAGAATGGGG - Intronic
994358467 5:98822542-98822564 TTATGTTTTCACTTACAAGCAGG + Intergenic
995283741 5:110363520-110363542 TTATATGTACACTGAGAAGAAGG + Intronic
996161370 5:120170840-120170862 TGATGTTTACTCTGAGAATCTGG + Intergenic
997427282 5:133812046-133812068 AGATGTTTATCCTGAGCAGCTGG - Intergenic
998638639 5:143985063-143985085 ATATGATTAGCCTGAGTAGCTGG - Intergenic
999833956 5:155349257-155349279 TGATATTTACTCTGAGAACCTGG - Intergenic
1000387793 5:160691616-160691638 TCATATTTACCATGACAAGCTGG - Intronic
1000461636 5:161528425-161528447 TTATGTTTACTTTGTAAAGCAGG - Intronic
1000870689 5:166573430-166573452 TAATATTTACCCTTAGAAGACGG - Intergenic
1000923665 5:167168070-167168092 TTATGCTTACACTGAAAAACAGG - Intergenic
1004082109 6:12404919-12404941 TTTTTTTTCCCCAGAGAAGCTGG + Intergenic
1004583093 6:16973344-16973366 TGATGTTGAATCTGAGAAGCAGG - Intergenic
1006884123 6:37366105-37366127 GTAAGTTTGCCCTCAGAAGCTGG - Intronic
1006918697 6:37613598-37613620 TTATGTTGACCCTGAGATGCAGG - Intergenic
1007453367 6:41957286-41957308 TTAAATTTAACCTGATAAGCAGG - Intronic
1008299665 6:49820009-49820031 TTACGTCTAACCTCAGAAGCAGG + Intergenic
1010420760 6:75672689-75672711 TTATGATTAATCTGAGAAACAGG + Intronic
1012242241 6:96886861-96886883 TTATGCTTACCCTGAAATGCAGG + Intergenic
1014971228 6:127817884-127817906 TCATCTTCACCCTGAGAACCTGG - Intronic
1016231413 6:141809755-141809777 TTATGTTTCACCTGAGAACTGGG + Intergenic
1017261173 6:152389558-152389580 TTATGGATACTCTGAGAAGAGGG + Intronic
1017681392 6:156867674-156867696 TTATTCTTAACCTGAAAAGCAGG - Intronic
1020153095 7:5698719-5698741 GTCTGTTTTCCCAGAGAAGCTGG + Intronic
1020985527 7:15129308-15129330 TTATGTGTTAACTGAGAAGCTGG - Intergenic
1021067896 7:16198973-16198995 TTCTGTTTACTCAGAGAGGCTGG - Intronic
1021688567 7:23211048-23211070 TTCTGTTTTCTCTGTGAAGCAGG - Intergenic
1022261116 7:28705942-28705964 TTATAAATACCCTGAGAAGAGGG + Intronic
1023002498 7:35825066-35825088 TTATTTTTCCCCTGAGCAGCTGG + Intronic
1024331677 7:48161174-48161196 TTCTGTTTACCCCAAGAAGGGGG - Intergenic
1025918374 7:65886346-65886368 TAATGTGTACCCTCAGAAACTGG - Intronic
1025972636 7:66342325-66342347 TTCTCTTTACCCTGAGAATCTGG - Intronic
1028984747 7:97000949-97000971 TGATGTTTAGTTTGAGAAGCTGG + Intergenic
1029211551 7:98912822-98912844 TTTTTTTTTCCCTGAAAAGCTGG - Intronic
1030305189 7:108010752-108010774 GTATTTTTACCCTGGGAAGATGG + Intergenic
1031303934 7:120100232-120100254 TTGTGTGTGACCTGAGAAGCAGG - Intergenic
1033785493 7:144725271-144725293 TAACTCTTACCCTGAGAAGCAGG - Intronic
1033973310 7:147069393-147069415 TTCTGTTCACCCTCAGAAGAAGG + Intronic
1034253089 7:149707750-149707772 TTATTTTTACCCTCTGGAGCTGG + Intergenic
1035149322 7:156854400-156854422 TAATCTTTACTCTGAGAATCTGG - Intronic
1035710502 8:1709846-1709868 TGATCTATACCCTGAGAACCTGG - Intergenic
1040802418 8:51358043-51358065 TCATGTTTATCCTGTGAAGATGG - Intronic
1042640994 8:70933909-70933931 AAATGTTTACCATGAGAATCGGG - Intergenic
1044374509 8:91453693-91453715 TTATGTGAATCCTGAGAAGGAGG - Intergenic
1045061550 8:98415631-98415653 TTATCTTTACCCTGAAATGTGGG + Intronic
1045505698 8:102776909-102776931 GGCTGTTTGCCCTGAGAAGCTGG + Intergenic
1046125537 8:109901903-109901925 ATATATGTACCCTAAGAAGCTGG + Intergenic
1046190642 8:110790376-110790398 ATATTTATACCCTGAGAAGGAGG + Intergenic
1047968967 8:130068702-130068724 GTCTGTTCACCCTGAGAAGGGGG + Intronic
1048505485 8:135017095-135017117 TTTTCTTTACCCTTAGAATCTGG + Intergenic
1048654855 8:136524318-136524340 AATTGTATACCCTGAGAAGCTGG - Intergenic
1049672502 8:143876221-143876243 TTCTATTTACCATGAGAACCAGG - Intronic
1058128940 9:101227637-101227659 TTATGTATAGCCTGAGCTGCTGG - Intronic
1191624412 X:63254737-63254759 TTAAGTTTACTCTGTGTAGCTGG + Intergenic
1191660346 X:63643020-63643042 TTATGGTAATCCTGAGAAGCTGG - Intronic
1193456773 X:81741276-81741298 TTTTGTTTATCGTGAGAAGTAGG + Intergenic
1193571459 X:83149990-83150012 TTCTGCTTACCCTGAGTAGCAGG + Intergenic
1193863223 X:86696816-86696838 ATATCTTCACCCTGAGAATCTGG - Intronic
1194114444 X:89878584-89878606 TTCTCTTTACCATGAGAAACTGG - Intergenic
1196504227 X:116422349-116422371 TTATGTTAGCCCTGAGTAGTGGG + Intergenic
1196565861 X:117204465-117204487 TTATTTTTCCCCTGAGGAGAGGG + Intergenic
1197443115 X:126514154-126514176 TCCTGTTTACCCTGAGAAAGGGG - Intergenic
1197492663 X:127138191-127138213 TTCTGTTTACTCTGAGAAGAGGG + Intergenic
1198580766 X:138061870-138061892 TGATGTTTACCCTGAAAAGGTGG + Intergenic
1198982556 X:142416026-142416048 GTCTGTTTACCCCGAGAAGGGGG + Intergenic
1200467182 Y:3533955-3533977 TTCTCTTTACCATGAGAAACTGG - Intergenic