ID: 1099281857

View in Genome Browser
Species Human (GRCh38)
Location 12:80660005-80660027
Sequence CTTTCTAAGGTGAAGATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099281857 Original CRISPR CTTTCTAAGGTGAAGATTGT AGG (reversed) Intronic
901595689 1:10383701-10383723 TTTTCTAAGGTGAAGACAATTGG + Intergenic
903316625 1:22512966-22512988 CTTTCTCCTGTGAAGAGTGTGGG + Exonic
904911969 1:33941490-33941512 CTTTCCATGATGAGGATTGTGGG - Intronic
909044132 1:70688916-70688938 CTTTCTAATGTGAGGGTAGTTGG + Intergenic
910861843 1:91749653-91749675 CTTTCTGAGATGGAGAGTGTAGG + Intronic
911824596 1:102465607-102465629 CTTTCTAAAGTGTAGCTTCTGGG - Intergenic
911946679 1:104118707-104118729 CTTCCTAAGATGAGGATTATGGG + Intergenic
913422569 1:118688476-118688498 CTTTCTAGTGTTAAGATTATAGG - Intergenic
916779570 1:168009921-168009943 CTTTAGAGGGTGAATATTGTTGG - Intronic
916906941 1:169296248-169296270 CTTTGTAAGGTGAATGTTGATGG - Intronic
917490594 1:175494823-175494845 CTTTCTAAGGGATAGATTTTTGG + Intronic
917588492 1:176452702-176452724 ATCTCTAAGGTGAAGAGTGTTGG + Intergenic
917746261 1:178010825-178010847 TTTTCCCAGGTGTAGATTGTTGG - Intergenic
919543996 1:198889615-198889637 CTTTCCTAGGTGAAAATTTTGGG + Intergenic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
1063493838 10:6489079-6489101 CTTTCTATAGTAAAGATTTTAGG - Intronic
1066243142 10:33557089-33557111 GTTTATAAGGTGAAGAATGGAGG + Intergenic
1068599433 10:58940322-58940344 CTTTGTAAGGAGTATATTGTTGG - Intergenic
1070386450 10:75929026-75929048 CTTTCAAAGGTGAGAATTGTAGG - Intronic
1072427217 10:95339642-95339664 ATTTCTAAGGCAAAGATTTTGGG + Intronic
1075234626 10:120715628-120715650 ATTTATAAGGTGGAGAGTGTTGG + Intergenic
1076437966 10:130459518-130459540 TTTTCCAAGGTGAAGAGTGAGGG + Intergenic
1076529101 10:131132784-131132806 CTTTCTAAGGAGGAGATTTGGGG + Intronic
1086891483 11:92263517-92263539 CTTTCTGATGTGAAGATTACAGG + Intergenic
1087394398 11:97578900-97578922 CTTTCTCAGGTGGTGATTTTGGG + Intergenic
1093929470 12:24940717-24940739 CTTTCAAAAGTGAATATAGTAGG + Intronic
1094260121 12:28485710-28485732 CCTTCTAAGGGGAAAATTCTGGG + Intronic
1095175095 12:39082857-39082879 ATTTCTAAAGAGAGGATTGTAGG + Intergenic
1098091990 12:66913037-66913059 CTTATCCAGGTGAAGATTGTAGG - Intergenic
1098448888 12:70596761-70596783 CTTCCTAGGTTGTAGATTGTTGG + Intronic
1099281857 12:80660005-80660027 CTTTCTAAGGTGAAGATTGTAGG - Intronic
1099839093 12:87943581-87943603 TTTTCTAAGGTGAATAAGGTTGG - Intergenic
1100866378 12:98861616-98861638 TTTTCTAAGATGATTATTGTGGG - Intronic
1101351682 12:103935522-103935544 CTTTCTAGGATGAAGAAAGTTGG - Intronic
1105342672 13:19542604-19542626 ATTTCTAATGTGAAGCTAGTAGG + Intergenic
1105493333 13:20908043-20908065 CCTTCTAAAGTGAAGATTACAGG + Intergenic
1109225588 13:59690702-59690724 GTTTCAAAGTAGAAGATTGTTGG + Intronic
1110123516 13:71912727-71912749 CTGTTTTAGGTGAAGCTTGTGGG + Intergenic
1110675042 13:78232406-78232428 TATTCTATGGTGAAGGTTGTAGG - Intergenic
1110708220 13:78620074-78620096 CTTACTAAGGTGAAGTTTTTTGG - Intronic
1111287086 13:86109208-86109230 CTTTCTAAAGTGAAACTTGCTGG - Intergenic
1111698340 13:91654130-91654152 CTTCCTAACATGAATATTGTTGG + Intronic
1112965582 13:105188340-105188362 CTTTCTAAGGAAAACATTTTTGG - Intergenic
1114014802 14:18418045-18418067 TTCTCTAAGGTGAAGCTTGGTGG + Intergenic
1115849022 14:37573079-37573101 CATTTTAAGCTAAAGATTGTTGG + Intergenic
1117661332 14:58008675-58008697 CTTACTAAAATGCAGATTGTTGG + Intronic
1120024560 14:79568502-79568524 CTCTCTGAGGTGGAGTTTGTTGG - Intronic
1122368405 14:101212930-101212952 CTTTGTAATTTGAAGCTTGTTGG + Intergenic
1126228491 15:46298362-46298384 CTTTTTAAGGTAATGATTGTGGG + Intergenic
1127511304 15:59644319-59644341 GTTTCTGAGTTGAAGATTTTAGG - Intronic
1132772548 16:1572331-1572353 CTTTCTAACGTGCCGACTGTGGG - Intronic
1141244819 16:82295943-82295965 CTTTCTGTGGTGAAGAATCTGGG + Intergenic
1142166638 16:88593859-88593881 CTTTCTCAGGTGACCATTGCAGG + Intronic
1142296735 16:89228555-89228577 CTTTCTAATGTAAAGAATGTGGG + Exonic
1148152923 17:45406858-45406880 CTTTCCAAGGTGAAGTTTGCAGG + Intronic
1150287156 17:63960926-63960948 CTTCCTAAGGTCCAGATTCTTGG - Intronic
1151567623 17:74908062-74908084 CCTTCTTAGGGGAAGAGTGTTGG - Intergenic
1152857237 17:82672495-82672517 CTTTCTAACGTGAAGTTTAGCGG - Intronic
1155382283 18:25237050-25237072 CATTCTAAGGTAGAGATTCTAGG - Intronic
1155619317 18:27758652-27758674 CTTTTTCAGGTGAACATTGTAGG + Intergenic
1156038129 18:32789015-32789037 CATTCTAAGCAGAAGATTGAAGG - Intergenic
1159172834 18:64795165-64795187 CTTTCTAAGATGAAGAGAGTCGG - Intergenic
1159422671 18:68243346-68243368 CTTTCTAAAGTTAGGATTGAAGG - Intergenic
1163126695 19:15248069-15248091 TTTTTTAAAGTGTAGATTGTGGG - Intronic
1164516580 19:28941948-28941970 CTTTCTACGGCAACGATTGTGGG - Intergenic
1165298090 19:34944917-34944939 CTTTCAAATGTGAAGAATATTGG + Exonic
1165967343 19:39593832-39593854 TTTTTTAAGGTGAGGATTCTTGG - Intergenic
1166587816 19:43966764-43966786 CCTTCAAATGTGAAGAATGTGGG + Exonic
1166597874 19:44066520-44066542 CTTTCAAATGTGAACAATGTGGG + Exonic
1166600184 19:44086923-44086945 CATTCAAATGTGAAGAGTGTGGG + Exonic
1166602267 19:44107356-44107378 CATTCAAATGTGAAGAATGTGGG + Exonic
1166602299 19:44107608-44107630 CATTCCAATGTGAAGAGTGTGGG + Exonic
1166602323 19:44107860-44107882 CATTCAAATGTGAAGAGTGTGGG + Exonic
1166604827 19:44131810-44131832 CATTCAAATGTGAAGAATGTGGG + Exonic
1166604865 19:44132146-44132168 CATTCAAATGTGAAGAGTGTGGG + Exonic
1166604890 19:44132398-44132420 CATTCAAATGTGAAGAGTGTGGG + Exonic
1166609458 19:44177187-44177209 CATTCAAATGTGAAGAATGTGGG + Exonic
1166615075 19:44236490-44236512 CTTACAAATGTGAAGAGTGTGGG + Exonic
929953937 2:46440861-46440883 CTTTCCAAGGCTAAGATTCTAGG + Intronic
936029073 2:109057146-109057168 CATTCTCAAGTGAATATTGTAGG - Intergenic
938544800 2:132318075-132318097 CCTACAAATGTGAAGATTGTGGG + Intergenic
938606749 2:132901703-132901725 CTTTTAAAGATGAAGATTTTGGG + Intronic
938943620 2:136191039-136191061 CTTGCTAAGCTGAAGGCTGTTGG + Intergenic
939918308 2:148076039-148076061 CTTTCTAAGGCCATGATTTTAGG - Intronic
941516191 2:166482079-166482101 ATTTCTAAGGTTAAGATCATTGG + Intronic
941527135 2:166620088-166620110 CTTGTTATGGTGAACATTGTTGG + Intergenic
943002747 2:182349546-182349568 CTTTCTAATCAGAAGATTGATGG - Intronic
944568383 2:201015682-201015704 CTTTTTAAAGTGAAGAGTTTAGG - Intronic
945150823 2:206789040-206789062 CTTTCTAAGGAGTACATTGATGG - Intronic
945401588 2:209388923-209388945 TTTTCTAGGGTGAAGAGTGGAGG + Intergenic
946602964 2:221371874-221371896 CTTTCTCAGGTGAGGGTTGAGGG + Intergenic
1169768960 20:9180786-9180808 CTTTCTAATGAGATGATTCTTGG - Intronic
1170405770 20:16034448-16034470 CTTTTTAAGCTAATGATTGTTGG - Intronic
1173142345 20:40495204-40495226 CTTTCTCTGGTGAAGCTTGGGGG - Intergenic
1173331132 20:42077278-42077300 CTTTCTGGGGTGAAGAATCTGGG - Exonic
1174748435 20:53087483-53087505 CTTTCAAAAGTGAAGACTGGGGG - Intronic
1176863950 21:14031994-14032016 CTCTCTAAAGTGAAGCCTGTTGG - Intergenic
1178432755 21:32530964-32530986 CTTTTTAAGGGGAAGTTTCTCGG + Intergenic
1178803800 21:35821665-35821687 CTTTGGAAGGTGAAGACTGAAGG + Intronic
1180439301 22:15348818-15348840 TTCTCTAAGGTGAAGCTTGGTGG + Intergenic
1181624161 22:24111785-24111807 CATTGTAAGTTGGAGATTGTCGG + Intronic
1181860177 22:25812238-25812260 TTTTCTTAGGTGAAGAATGCGGG + Intronic
1182722815 22:32417414-32417436 CTTTGGAAGGTCAAGATTGGAGG - Intronic
1184307499 22:43616346-43616368 TTTTCCAAGGTGAGGCTTGTAGG + Intronic
950724377 3:14907040-14907062 AGTTGTAAGGTGAACATTGTGGG - Intronic
951388564 3:22073529-22073551 CTTTCTAGGGTAAAAATTATTGG + Intronic
953924893 3:46977797-46977819 CTTTCTAAGCTGGGGATTGGGGG - Intronic
955097800 3:55817044-55817066 CTTTCAAAGGTAAGGCTTGTAGG + Intronic
955858688 3:63303083-63303105 TTTTAAGAGGTGAAGATTGTTGG + Intronic
957904027 3:86534787-86534809 CTTTCTAAGCTGAAAATTCATGG - Intergenic
958178898 3:90032120-90032142 CTTTCTAAAGTGCAGAATCTTGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962109354 3:132427622-132427644 CTTTTGAAGGTGAACATTCTAGG + Intronic
964058859 3:152495982-152496004 CTTTGTAAGGTGAGTATTTTGGG - Intergenic
964427822 3:156571674-156571696 CTTTCCAAGGAGAATATGGTGGG - Intergenic
964973681 3:162592396-162592418 CTTTTTATGCTGAAAATTGTAGG + Intergenic
967282348 3:187834384-187834406 CTTTCTGAAGTGAAGATGATGGG + Intergenic
968721546 4:2210276-2210298 TTTTTTAAGGGGATGATTGTGGG + Intronic
969101387 4:4771409-4771431 CTTTGAAAGGAGAAGAGTGTGGG + Intergenic
970124593 4:12794735-12794757 CATTCTAAAGTGAAAATTCTAGG + Intergenic
970268784 4:14320262-14320284 GTTTCTCAGGTGATGAGTGTAGG + Intergenic
971626878 4:28932533-28932555 CTTTCAGAGGTAAAGAGTGTTGG - Intergenic
971768391 4:30864395-30864417 CTTTCTAAGATAAAAATTGAAGG - Intronic
973200164 4:47491568-47491590 CTTGCTAAGATGAAGAATATGGG - Intronic
973533487 4:51856813-51856835 CTGTGTAAGGTGAAGATCATTGG + Intronic
974454967 4:62117748-62117770 CTTTCTAAGATGAAAAATTTAGG + Intergenic
976543742 4:86309055-86309077 CATTTTAATGTAAAGATTGTAGG - Intronic
977051846 4:92138054-92138076 CTTTAAAGGGTGAAGTTTGTAGG - Intergenic
978759808 4:112344347-112344369 CTTTCCAATGTGAAAATAGTGGG + Intronic
979976594 4:127204293-127204315 GTTTCTAATGAAAAGATTGTGGG + Intergenic
980293901 4:130884081-130884103 CTCTATAAGGTGAAAATTGATGG - Intergenic
981317375 4:143352578-143352600 ACTTCTAAAGTGAAGATTCTTGG + Intronic
981635455 4:146873322-146873344 CTTTCTTAGATGAAAAATGTGGG + Intronic
987793719 5:22601766-22601788 CTTTCAAAGGGGTAGATTTTAGG + Intronic
992459101 5:76943747-76943769 ATCTCTAAGGTGAAGGATGTGGG - Intergenic
995940964 5:117583291-117583313 CTTTGTAATCTGAACATTGTAGG + Intergenic
996381324 5:122865087-122865109 TTTACTAAGGAGAAGACTGTGGG + Intronic
998274028 5:140734819-140734841 TTTTCTAAAGTGAGGATTATAGG - Intergenic
999601532 5:153271384-153271406 CACCCTAAGGTGAAGATTGAAGG + Intergenic
1000005943 5:157185058-157185080 CTTTCTAAATTAAAGATGGTAGG + Intronic
1000206070 5:159060476-159060498 TTTTCTAAGGTGAATAGTTTTGG - Intronic
1000899504 5:166895564-166895586 TTTTCTACGGTGAACATGGTGGG - Intergenic
1002087852 5:176786833-176786855 CTTTGCAAGGTAAGGATTGTTGG + Intergenic
1002323370 5:178388893-178388915 CTCTCTAAGGTGGAGATTGGAGG + Intronic
1002668979 5:180849794-180849816 CTTACAAATGTGAAGAATGTGGG - Exonic
1002972068 6:2033766-2033788 CTTTCTAAAATGCAGATTCTTGG + Intronic
1003229756 6:4241332-4241354 CTTTCTCAGGTGCAGATACTTGG + Intergenic
1003379798 6:5614057-5614079 CTGTGTAAAGTGATGATTGTTGG + Intronic
1003708696 6:8564815-8564837 ATTTCTAAGGTGAAGAATAATGG - Intergenic
1004812763 6:19277715-19277737 CCTTCTTAGGGGAAGAGTGTTGG + Intergenic
1006991429 6:38218000-38218022 CTTCCTAAGGAGTAGATTGAAGG - Intronic
1009909576 6:69909190-69909212 CTTTCTAAGGAAAAGAGGGTAGG + Intronic
1010715556 6:79225202-79225224 CTTTCTTAGGTGGAAACTGTGGG - Intronic
1011428499 6:87257634-87257656 CTTTTTCAGGTGCAGACTGTTGG - Exonic
1013015019 6:106153078-106153100 CTTTCTTGGGTGGAGATGGTTGG + Intergenic
1013358444 6:109369514-109369536 CTTTCTCATGTGAAATTTGTTGG - Intronic
1015846274 6:137523876-137523898 CTTTCTTAGCTGAAAACTGTAGG - Intergenic
1017083907 6:150695961-150695983 ATTTTTAAGGTAAAGATTCTAGG - Intronic
1017287925 6:152699244-152699266 CTTTCTTAGATGAAAAATGTGGG + Intronic
1017296744 6:152805056-152805078 CTTTCTAAACTGAAGAGTGAAGG + Intergenic
1025028750 7:55538751-55538773 CTTTCTAAGGGGAATGCTGTGGG + Intronic
1026537837 7:71254889-71254911 CTGTCTGAGGAGAAGATTCTGGG + Intronic
1026543412 7:71300315-71300337 CTTTCTAAGAGGAGGCTTGTTGG + Intronic
1028413420 7:90555326-90555348 CTTTCTACGCTGATGATAGTTGG - Intronic
1030735842 7:113047669-113047691 CTATCTATGGTGATGATGGTGGG - Intergenic
1034726638 7:153342205-153342227 ATGGCCAAGGTGAAGATTGTGGG + Intergenic
1035478181 7:159158558-159158580 TTTTCTAGGGTGAAGCTTGATGG + Intergenic
1036593564 8:10191913-10191935 TTTTCTTAGGTCACGATTGTGGG + Intronic
1037756547 8:21713766-21713788 CTTGTTAAGGTGCAGATTGCTGG - Intronic
1042050795 8:64703909-64703931 TTTTCTCAAGTGAATATTGTGGG + Intronic
1045934654 8:107664781-107664803 CTCTCTGAGGTGAAGTTTGAAGG + Intergenic
1046425970 8:114050100-114050122 CTTTTTGAGGTGAATATTTTGGG + Intergenic
1049953186 9:665683-665705 GTTTCTATGGGGAATATTGTTGG + Intronic
1049969521 9:809386-809408 CTTTCTAAGGAGAAAATTTATGG - Intergenic
1050354595 9:4770729-4770751 CTGTGTGAGGTGAAGATTGGAGG - Intergenic
1054450361 9:65400645-65400667 CTTTGAAATGTGAAGTTTGTGGG - Intergenic
1054900590 9:70364774-70364796 CTTTCAATGATGAAGATTCTAGG + Intergenic
1057806047 9:98220695-98220717 GTTTCTAATGTGAATATTCTAGG + Intronic
1059529460 9:115022550-115022572 CTTTCTAACATGTAGCTTGTTGG + Intronic
1187698441 X:21942562-21942584 ATTTCTTAGGTGAGGATGGTAGG + Intronic
1192098693 X:68240358-68240380 ATTTCTAAGGTTAAAATTTTTGG + Intronic
1193000088 X:76554033-76554055 CTTTTTAAGGTGCATATTATAGG - Intergenic
1193166509 X:78286770-78286792 CTTTTTAAGGTGAGTAATGTGGG + Intronic
1194081772 X:89475879-89475901 CTTGCTAAGATAAAGATTGTGGG + Intergenic
1195500949 X:105598428-105598450 CTTTCTAAGGGGTAGATTTTAGG + Intronic
1196266532 X:113654040-113654062 GTCTCTAATGTGAAGATTGATGG - Intergenic
1196550251 X:117016027-117016049 CTCCCTAACGTGAAGATTGCAGG - Intergenic
1196578526 X:117351131-117351153 CTTCCTCAGGTGCAGGTTGTTGG + Intergenic
1200434441 Y:3132069-3132091 CTTGCTAAGATAAAGATTGTGGG + Intergenic
1202012367 Y:20357644-20357666 TTTTCTAAGGTGTATGTTGTGGG + Intergenic
1202589663 Y:26469063-26469085 ATTTCTAATGTGAAGCTAGTAGG - Intergenic