ID: 1099283485

View in Genome Browser
Species Human (GRCh38)
Location 12:80684212-80684234
Sequence AAACCTCCTGCACTTCACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 6, 2: 15, 3: 33, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099283485_1099283486 -6 Left 1099283485 12:80684212-80684234 CCGCGGTGAAGTGCAGGAGGTTT 0: 1
1: 6
2: 15
3: 33
4: 139
Right 1099283486 12:80684229-80684251 AGGTTTTAGAGATGAGCTTGAGG 0: 1
1: 29
2: 100
3: 122
4: 401
1099283485_1099283489 17 Left 1099283485 12:80684212-80684234 CCGCGGTGAAGTGCAGGAGGTTT 0: 1
1: 6
2: 15
3: 33
4: 139
Right 1099283489 12:80684252-80684274 AGGCGGTGTTTGATTTACATAGG 0: 5
1: 98
2: 368
3: 477
4: 425
1099283485_1099283487 -3 Left 1099283485 12:80684212-80684234 CCGCGGTGAAGTGCAGGAGGTTT 0: 1
1: 6
2: 15
3: 33
4: 139
Right 1099283487 12:80684232-80684254 TTTTAGAGATGAGCTTGAGGAGG 0: 1
1: 90
2: 106
3: 114
4: 430
1099283485_1099283490 18 Left 1099283485 12:80684212-80684234 CCGCGGTGAAGTGCAGGAGGTTT 0: 1
1: 6
2: 15
3: 33
4: 139
Right 1099283490 12:80684253-80684275 GGCGGTGTTTGATTTACATAGGG 0: 4
1: 94
2: 364
3: 473
4: 363
1099283485_1099283488 0 Left 1099283485 12:80684212-80684234 CCGCGGTGAAGTGCAGGAGGTTT 0: 1
1: 6
2: 15
3: 33
4: 139
Right 1099283488 12:80684235-80684257 TAGAGATGAGCTTGAGGAGGCGG 0: 1
1: 51
2: 66
3: 107
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099283485 Original CRISPR AAACCTCCTGCACTTCACCG CGG (reversed) Intergenic
903801577 1:25972597-25972619 TAACCTCCTGCCCTTCATAGGGG + Exonic
906516624 1:46442917-46442939 CAACCTCCTGGACTTTCCCGCGG + Intergenic
911976390 1:104502246-104502268 AAACCTCACGCATTTCACCATGG - Intergenic
914430256 1:147614140-147614162 AAACCTCCTAGACTTAACTGGGG - Intronic
916101207 1:161394783-161394805 AAACCCCCTGAATTTCACCACGG - Intergenic
923804103 1:237239372-237239394 AAACCCCGTGCATTTCACCATGG - Intronic
1063821968 10:9846371-9846393 AAACCCCCTGCATTTCACTGCGG - Intergenic
1063827279 10:9911773-9911795 AAACCCCCTGCAATTCACCAGGG + Intergenic
1064122998 10:12635472-12635494 AGAGCTCCTGCACTGCGCCGTGG - Intronic
1064803111 10:19098844-19098866 AAACCCCCTGCATTTCGCCATGG - Intronic
1069755051 10:70769380-70769402 AAACCACCTGCATTTCACCATGG + Intergenic
1074072995 10:110092140-110092162 AAACCTCCTGCTTTCCACAGTGG - Intronic
1075978323 10:126716117-126716139 AAACTTGCTGCATTTCACCACGG + Intergenic
1076264314 10:129097930-129097952 AATCCAGCTGCACCTCACCGGGG - Intergenic
1077260684 11:1618155-1618177 GAACCGCCTGATCTTCACCGTGG - Intergenic
1079160669 11:17990409-17990431 CAACCTCCTGGACTTCATCAGGG + Intronic
1084842822 11:71870436-71870458 AAACCTGCTGCACTTGACATTGG + Intronic
1085590125 11:77752511-77752533 AAACCCCTTGCATTTCACCATGG + Intronic
1087136856 11:94729944-94729966 AGACCTTCTGCACTACACCAGGG + Intronic
1088952522 11:114586146-114586168 AAATCTCCTGCACTTCACTGTGG + Intronic
1090265357 11:125350090-125350112 ACACGTCCTGCACTCCACAGAGG + Intronic
1091363102 11:134993799-134993821 AAACCTCCTACATTTCACCACGG - Intergenic
1093519124 12:20027467-20027489 AAACCTCGTGCACTTCACTGTGG + Intergenic
1097252337 12:57642811-57642833 AAACTCCCTGCATTTCACTGTGG + Intergenic
1097964404 12:65563526-65563548 AAACCTCCAGCACTTCATGGTGG + Intergenic
1098010274 12:66043655-66043677 AAACCTTCTGCATTTCACTACGG - Intergenic
1098720246 12:73888607-73888629 AAACCTCCTGCACTTCATGGTGG - Intergenic
1099283485 12:80684212-80684234 AAACCTCCTGCACTTCACCGCGG - Intergenic
1100603377 12:96131294-96131316 AAATTTCCTGCATTTCACCATGG - Intergenic
1102980669 12:117238431-117238453 AACCCCCCTGCATTTCACCGTGG + Intronic
1103236587 12:119378022-119378044 AAACCCCGTGCATTTCACCATGG - Intronic
1104330069 12:127836430-127836452 GAACCATCTGCACTTCACCATGG - Intergenic
1105943284 13:25170141-25170163 GAGCCTCCTGCGCTTGACCGAGG + Exonic
1106364843 13:29068635-29068657 AAACTTCCTGGACTTCAACTGGG - Intronic
1108606145 13:52040502-52040524 AAACTTCCTGCTCTTTACCGAGG + Intronic
1109271585 13:60261645-60261667 AAACCCCATGCATTTCACCAGGG - Intergenic
1110017362 13:70424432-70424454 AAACCTTCTGCGTTTCACCATGG - Intergenic
1110928753 13:81188303-81188325 AAACTTCTTGCATTTCACAGAGG - Intergenic
1111373748 13:87352040-87352062 AAAGCCCCTGCACTTCCCCCTGG - Intergenic
1114196912 14:20486219-20486241 AAACTTCCTGCATTTCACTGTGG + Intergenic
1116346527 14:43802064-43802086 AAACCCCTTGCATTTCACTGTGG + Intergenic
1121262156 14:92574212-92574234 AAACCTCCTGCACTTCACCATGG - Intronic
1122827827 14:104379776-104379798 AAATCTACTGCACTCCACTGGGG - Intergenic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1129876569 15:78979342-78979364 AAACCTCCAGCCCTTGACAGTGG - Intronic
1133385625 16:5367921-5367943 ACACCTCATGCACTTGACCTTGG + Intergenic
1133870368 16:9680314-9680336 AAACCTCCTGCACTTCACCACGG + Intergenic
1134129098 16:11636382-11636404 AAACCTTCTGCATTCCACTGCGG - Intergenic
1138727167 16:59152518-59152540 AAACCCCGTGCACTTCACCATGG - Intergenic
1138963176 16:62051605-62051627 AAACCCCCTGCATTTCACCATGG - Intergenic
1140533981 16:75692230-75692252 AAACCTTCTGCATTTCTCTGTGG + Intronic
1142194839 16:88734591-88734613 AAACCCCGTGCACTTCCCCGGGG - Intronic
1142814720 17:2416179-2416201 AAAGCGCCTTCACTTCCCCGTGG - Exonic
1143373423 17:6454287-6454309 AAACCAGCTGCACCTCTCCGTGG + Exonic
1143877069 17:9999882-9999904 AAACCTCCTGCAATTTCCCAAGG - Intronic
1144413439 17:15023060-15023082 AAACATCCCGCACTGCACTGTGG - Intergenic
1146294916 17:31641936-31641958 AAACCTTCTGCATTTCACCACGG + Intergenic
1147769104 17:42855635-42855657 AAACCACCTGCACTTCTCAGGGG + Intronic
1149062924 17:52445450-52445472 AAACCTTCTGCATTTCACTGTGG + Intergenic
1152324429 17:79627364-79627386 AACTCTCCTCTACTTCACCGGGG - Intergenic
1152407331 17:80105114-80105136 GAACCGCCTCCACTTCACGGTGG + Intergenic
1153015154 18:576653-576675 AAACCCCCTGCATTTAACCACGG + Intergenic
1153143650 18:2003018-2003040 AAAACCCCTGCATTTCACCATGG + Intergenic
1153271917 18:3330873-3330895 AAACCTCCTGCATTTCACCGCGG + Intergenic
1157480560 18:48051027-48051049 AAACCTCCTGCTGGTCACCTAGG + Intronic
1160013096 18:75121382-75121404 AAGCCTCCTGCAGTTCAGCGAGG - Intergenic
1160114687 18:76066433-76066455 AAACCCCTTGCATTTCACCAGGG - Intergenic
1162386839 19:10365098-10365120 ATACCTCCTGCACTTTCCCCTGG + Intronic
1162454384 19:10774270-10774292 ATAGCTACTGCACTTCACCTGGG + Intronic
1164087230 19:21913906-21913928 AAACCTCCTGCATTTCACCATGG + Intergenic
1165784032 19:38450565-38450587 AAGCCCCCTGCATTTCACCATGG - Intronic
1166255910 19:41604407-41604429 AAACCTTCTGCATTTCACTATGG - Intronic
1166653371 19:44592176-44592198 AAAACCCCTGCATTTCACCATGG + Intergenic
1166654922 19:44603979-44604001 AAACCTCCTGCACTTCACCATGG - Intergenic
1168192600 19:54750642-54750664 ATACCTCCTGGACTGCACCTGGG + Intronic
1168196934 19:54781918-54781940 ACACCTCCTGGACTGCACCTGGG + Intronic
1168202728 19:54828356-54828378 ACACCTCCTGGACTGCACCTGGG + Intronic
1168375943 19:55879361-55879383 AAACCCTCTGCATTTCACCATGG - Intronic
1168540546 19:57206166-57206188 AAACCTTCTGCTCTTCTCCTTGG - Intronic
925735739 2:6962098-6962120 AAACCCCCTGCATTTCACCGTGG - Intronic
925947521 2:8879618-8879640 AAACACCCTGCACTGCACAGGGG - Intronic
926017497 2:9467702-9467724 AAACCTTCTGTACTGCACCTGGG - Exonic
926490602 2:13522092-13522114 AAACCCCTTGCATTTCACCATGG - Intergenic
927286554 2:21362989-21363011 AAAACCCCTGCATTTCACTGTGG - Intergenic
929780373 2:44953259-44953281 AAACCACCAGCACTTCCCAGTGG + Intergenic
932727494 2:74192044-74192066 AAACCTTCTGCATTTCACCGTGG + Intergenic
933094175 2:78157362-78157384 AAACCCCGTGCATTTCACCAGGG + Intergenic
934663300 2:96154422-96154444 CACCCTCCTGCCCTTCTCCGGGG - Intergenic
934734770 2:96684421-96684443 CAACCTCCTCCACTTCACTCGGG + Intergenic
936626571 2:114155406-114155428 AACCCCCCTGCACTTCACCACGG + Intergenic
936771576 2:115920141-115920163 AAACCCCATGCACTCCACCACGG - Intergenic
937358399 2:121212521-121212543 AAGCCACCTGCACTGCACTGCGG - Intergenic
938010595 2:127825800-127825822 AAACCTTCTGCACTTCACTGTGG + Intergenic
943358871 2:186894367-186894389 AAACCCCCTGCATTTCACTGTGG - Intergenic
943961626 2:194271720-194271742 AAACCCCCTGTACTTCACCCAGG - Intergenic
945262443 2:207856446-207856468 AAATCTCCTGTGCTTCACCTAGG + Intronic
946528459 2:220545272-220545294 AAACATGCTGCACTTCGCCCTGG - Intergenic
947490892 2:230593690-230593712 AAACCTTCTGGACTCCACAGAGG - Intergenic
948068316 2:235099262-235099284 AATCCCCCTGCATTTCACCTCGG + Intergenic
1169782959 20:9328915-9328937 AAACTTTCTGCATTTCACTGCGG - Intronic
1170686735 20:18576154-18576176 CAACTTCCTGCACTTCACTCAGG - Intronic
1171506861 20:25643851-25643873 AAATCCCCTGCATTTCACCATGG - Intergenic
1174317734 20:49715419-49715441 TAACCTCCTCCATTTTACCGAGG - Intergenic
1175723163 20:61299870-61299892 AAGCCGCCAGCACTTCCCCGGGG + Intronic
1181232676 22:21431044-21431066 ACACCTCATGCACTTCTCCCTGG + Intronic
1181245975 22:21503812-21503834 ACACCTCATGCACTTCTCCCTGG - Intergenic
1183189347 22:36311815-36311837 AAGCCTGCGGCACTCCACCGCGG - Intronic
1184112923 22:42405744-42405766 AGCCCTCCTGGACTTCACAGTGG + Intronic
1184579149 22:45401685-45401707 AAACCGCCTGTACTTCACTGTGG + Intronic
949801804 3:7912301-7912323 AAACCTTCTACACTTCACTGCGG + Intergenic
950424642 3:12918489-12918511 GAACCTCCTGCACGTCATCTGGG - Intronic
953605736 3:44412051-44412073 AAACATCCTGCACTTCTGGGTGG - Intergenic
958037774 3:88190366-88190388 AAACCCCCTGCATTTCACCACGG + Intergenic
958628168 3:96653651-96653673 AAAACTCTTCCACTTCACCAGGG + Intergenic
960109335 3:113830024-113830046 CAACCTTCTGCATTTCACCATGG - Intronic
960790357 3:121423500-121423522 AAGCCTCTTTCACTTCACTGTGG - Exonic
960842300 3:121972376-121972398 AAACCCCATGCACTTCACCACGG + Intergenic
964069148 3:152610924-152610946 AAACTTCGTGCATTTCACCATGG + Intergenic
966901501 3:184489999-184490021 AGACATCCTGCATTTCCCCGTGG + Intronic
968806768 4:2778612-2778634 AAACCTCTTTCACTTCACAGTGG - Intergenic
970548551 4:17155446-17155468 ACATCTCCTGCACTTCAACCAGG - Intergenic
972586243 4:40439017-40439039 AAACCACCTCCCCTTCCCCGTGG - Intronic
972665020 4:41157195-41157217 ACACCTGCTGCATTTCCCCGAGG + Intronic
972683303 4:41327783-41327805 AAACCTCTTACACTTCACCGGGG - Intergenic
973658148 4:53072725-53072747 AAACTCACTGCATTTCACCGTGG + Intronic
974262563 4:59543683-59543705 AAACCTCCAGCCCTTTACCAGGG - Intergenic
976732167 4:88273978-88274000 AAGCCTCCTGCACTTCACCATGG + Intronic
977555283 4:98482010-98482032 AAACCTCATAGACTTCACCCAGG - Exonic
980306402 4:131065677-131065699 ACACCTCCTGCACTGCAGCCTGG + Intergenic
981419664 4:144534679-144534701 AAACCCCCTGCATTTCACCATGG + Intergenic
985288006 4:188356744-188356766 AAAACTCCTGCTCTTCAGCCGGG - Intergenic
985345595 4:189001589-189001611 AAACCCTGTGCACTCCACCGTGG + Intergenic
989572554 5:42958132-42958154 TAAGCTCCTGCACCTCACTGGGG - Intergenic
989582741 5:43048183-43048205 TAACCTCCTGCACCTCACTGAGG - Intergenic
990438973 5:55824715-55824737 AAACCCTGTGCACTTCACCATGG - Intergenic
995881687 5:116850814-116850836 AAACCTCCTGCTCTTTGCCATGG - Intergenic
996277653 5:121686855-121686877 AGACCCCCTGCATTTCACCAAGG + Intergenic
998665237 5:144289261-144289283 AAGCCTACTGCATTTCACCCTGG + Intronic
1002699983 5:181116906-181116928 ACACCCCCTGCATTTCACTGTGG + Intergenic
1009599963 6:65786319-65786341 AAACCTCCAGCACTGAACAGAGG - Intergenic
1010769143 6:79808538-79808560 AAACCTCATACACTTCCCCTTGG - Intergenic
1013039430 6:106418877-106418899 AAACCCCGTGCACTTTACCATGG - Intergenic
1015807015 6:137119930-137119952 AATCATCCTGCTCTTCCCCGTGG + Intergenic
1016609740 6:145975015-145975037 AAACATCCTGCAATGCACAGGGG - Intergenic
1017925440 6:158908230-158908252 AAACCTCCTGCGCTTCACTGTGG + Intronic
1021210828 7:17849688-17849710 CAACCTCCTCCAATTCACCAAGG + Intronic
1021794117 7:24236368-24236390 AAACTTTCTGCATTTCACCATGG - Intergenic
1022259032 7:28686179-28686201 AAACCTCATGGACATCACTGAGG - Intronic
1024690544 7:51796868-51796890 AAACCCCTTGCATTTCACTGCGG + Intergenic
1024969452 7:55054963-55054985 CACCCTCCTGCCCTTCACTGGGG + Intronic
1026117552 7:67508816-67508838 AAACCTCCTGCATTTCACCCTGG - Intergenic
1026211631 7:68311104-68311126 AAACCCCGTGCATTTCACCATGG - Intergenic
1026687591 7:72524659-72524681 CAACCTCCTGCACTTCAGCCTGG - Intergenic
1027187941 7:75982862-75982884 ACACGTCCTGGACTACACCGTGG - Intronic
1033667917 7:143460973-143460995 AAACCCCCTACATTTCACTGTGG - Intergenic
1033737715 7:144239710-144239732 ATATCTGTTGCACTTCACCGGGG - Intergenic
1033745341 7:144311247-144311269 ATATCTGTTGCACTTCACCGGGG + Intergenic
1035454833 7:159001255-159001277 GGACCTCGTGCACGTCACCGAGG + Intergenic
1035916098 8:3624870-3624892 AAACCTCCTGCAAATCAAAGAGG - Intronic
1036044764 8:5127349-5127371 AAACCTCCTGTACTTCATCGTGG + Intergenic
1036129740 8:6097956-6097978 AAAACTCCTGCACTTCACCATGG - Intergenic
1036835124 8:12057625-12057647 AAACCTGCTGCACTTGACATTGG - Intergenic
1036856967 8:12304189-12304211 AAACCTGCTGCACTTGACATTGG - Intergenic
1037385430 8:18335201-18335223 TAAGCTCCTGCACTTCAGCCTGG - Intergenic
1037408172 8:18565916-18565938 AAACATCCTACAATTCACAGAGG + Intronic
1038339008 8:26668627-26668649 AAACCCCCTGCATTTCACCGAGG + Intergenic
1038381170 8:27095808-27095830 AAACCTCCTGCACTTAACATCGG + Intergenic
1041826345 8:62099877-62099899 AAATCCCCTGCATTTCACCATGG - Intergenic
1043993865 8:86788684-86788706 ATACCTCCTTCACCTCACCCTGG - Intergenic
1044003229 8:86910867-86910889 AAACCTCCTGCACTTCACTGGGG - Intronic
1045644140 8:104283809-104283831 AAACCACGTGCATTTCACCATGG + Intergenic
1047175597 8:122537696-122537718 CAGCCTCCTGAACTTCACCATGG + Intergenic
1047286067 8:123488230-123488252 AAAACCCCTGCATTTCACCACGG + Intergenic
1047445477 8:124915384-124915406 AAACCCCCTGCATTTCACCGTGG + Intergenic
1048817690 8:138349129-138349151 AAACCCCCTTCAGTTCACCTGGG + Intronic
1048987872 8:139744998-139745020 TCACCTCCTGCACATCCCCGGGG - Intronic
1049347524 8:142146709-142146731 AAACCTCCTGCCCCTCCCCAAGG - Intergenic
1051770957 9:20579125-20579147 AATCCTCCTGCACTTCAGCCTGG - Intronic
1052371111 9:27665448-27665470 AAAACTCCTGCACTTCGCCATGG + Intergenic
1055510710 9:76993278-76993300 AAACCTCCTGCCCTTCACCGTGG - Intergenic
1057829562 9:98396234-98396256 GACCCGCCTGCACTTCACAGAGG - Intronic
1061144658 9:128790667-128790689 GAACCCCCAGCCCTTCACCGTGG - Intronic
1062259011 9:135648701-135648723 AAACCTCGTGCATTTCACCAAGG - Intergenic
1062409270 9:136414308-136414330 ACACCTCCTACCCTTCATCGGGG - Intronic
1186165450 X:6822024-6822046 AAACTGCCTGCATTTCACCACGG + Intergenic
1188159732 X:26784608-26784630 AAACCCCGTGCACTTCACCATGG - Intergenic
1188849693 X:35116447-35116469 AAACCCCCTGCATTTCACCATGG + Intergenic
1189033677 X:37474768-37474790 AAAACCCCTGCATTTCACTGTGG + Intronic
1189426566 X:40907014-40907036 AAAGCTCCTGCACTCCAGCCCGG + Intergenic
1193686789 X:84586693-84586715 AAACGCCCTGCATTTCACCGTGG - Intergenic
1194232234 X:91338807-91338829 AAACCCCATGCATTTCACCATGG - Intergenic
1194616500 X:96110300-96110322 AAACACCCTGCATTTCACTGGGG - Intergenic
1194668867 X:96706228-96706250 CACCCTCCTGCATTTCACCTGGG + Intronic
1197804115 X:130383113-130383135 AAACCTCCTGGTCTCCACAGTGG - Intergenic