ID: 1099285585

View in Genome Browser
Species Human (GRCh38)
Location 12:80710675-80710697
Sequence ACGCAGTGACTACTATCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 20}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099285585_1099285587 -7 Left 1099285585 12:80710675-80710697 CCTGGCGATAGTAGTCACTGCGT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1099285587 12:80710691-80710713 ACTGCGTTTTCTGAGTATATGGG 0: 1
1: 0
2: 1
3: 22
4: 120
1099285585_1099285586 -8 Left 1099285585 12:80710675-80710697 CCTGGCGATAGTAGTCACTGCGT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1099285586 12:80710690-80710712 CACTGCGTTTTCTGAGTATATGG 0: 1
1: 0
2: 1
3: 20
4: 112
1099285585_1099285588 27 Left 1099285585 12:80710675-80710697 CCTGGCGATAGTAGTCACTGCGT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1099285588 12:80710725-80710747 TCTTCTGAAACAAATTTAAAAGG 0: 1
1: 0
2: 3
3: 71
4: 682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099285585 Original CRISPR ACGCAGTGACTACTATCGCC AGG (reversed) Intergenic
915702753 1:157811700-157811722 ATGCAGTGACTACTGCCCCCAGG - Intronic
919844053 1:201629734-201629756 ATGCAGTGACTCCCATAGCCTGG - Intronic
919997218 1:202763907-202763929 ACCCAGTGACTACTATGTACTGG + Intronic
922150849 1:223002833-223002855 ACGGCGTGACTACCATCACCGGG + Exonic
1099285585 12:80710675-80710697 ACGCAGTGACTACTATCGCCAGG - Intergenic
1105063173 12:133172661-133172683 AGGCAATGACTCCTATTGCCTGG + Intronic
1117733441 14:58746482-58746504 ATGCAGTGACAACTACCTCCTGG - Intergenic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1130668491 15:85890045-85890067 ACACAGGGACTATTATAGCCTGG - Intergenic
1148505938 17:48127217-48127239 AGGCAGTGCCTAATATCCCCTGG - Intergenic
1161231990 19:3179026-3179048 ACGCTGGGTCTACTATTGCCTGG + Exonic
928620644 2:33084481-33084503 GCCCAGTGACTGCTATCACCCGG - Intronic
1181009378 22:20031662-20031684 ACACAGTGACCACCATGGCCAGG + Intronic
958166082 3:89879208-89879230 ATGAAGTGACTACTGTGGCCTGG - Intergenic
992647291 5:78823291-78823313 TCCCAGTGACTACTTTGGCCTGG + Intronic
999434772 5:151554740-151554762 ACAAAGTGACTACTATTTCCAGG - Intronic
1034833090 7:154326922-154326944 ACCCAGTGAATACTATTTCCAGG - Intronic
1185818032 X:3174398-3174420 ACACAGTGGATACTATTGCCTGG + Intergenic
1187749310 X:22444513-22444535 CAGCAGAGACTACTAACGCCGGG + Intergenic
1188546747 X:31315827-31315849 ACTCAGTGGCTACTATATCCTGG + Intronic
1196388430 X:115185178-115185200 ACTGAGTGCCTACTATTGCCAGG + Intronic