ID: 1099293092

View in Genome Browser
Species Human (GRCh38)
Location 12:80796500-80796522
Sequence CTATGGGAATATATTAAAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099293088_1099293092 24 Left 1099293088 12:80796453-80796475 CCAGTGAATGATATTTTCTGAAA 0: 1
1: 0
2: 3
3: 27
4: 382
Right 1099293092 12:80796500-80796522 CTATGGGAATATATTAAAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099293092 Original CRISPR CTATGGGAATATATTAAAGT TGG Exonic
904703200 1:32371150-32371172 CTATGGGCACATTTTAAAGCTGG - Intronic
905627221 1:39497218-39497240 CTCTGTGGATATATTAAAGCAGG + Intronic
909795247 1:79727390-79727412 ATAATGGAATATATTAAAATAGG - Intergenic
911505767 1:98748707-98748729 CTAATGGAAAAAATTAAAGTTGG + Intronic
913361758 1:117988893-117988915 CTATGGGAAAATATTGATTTAGG + Intronic
916838531 1:168575750-168575772 AAATGGGAAGATATTTAAGTTGG + Intergenic
916925140 1:169511314-169511336 CTATGAGAATATATGAACTTGGG + Intergenic
917044627 1:170845473-170845495 ATATGAGAATGTATTAAAGATGG - Intergenic
917327695 1:173850150-173850172 CTAAGGGAATTTTATAAAGTAGG - Intronic
919407057 1:197198434-197198456 ATATGGGGATATATTAAACTGGG + Intronic
919709678 1:200713264-200713286 ATATGGCAATATATAAAAGTAGG + Intergenic
921429251 1:215044707-215044729 TTATGGGAACATATAAAAGTTGG + Intronic
921521657 1:216163271-216163293 AAATGGGAATATATTAGAATAGG - Intronic
924896715 1:248345738-248345760 CTCTGTAAATATATTAAAGTTGG - Intergenic
1064205107 10:13316721-13316743 CTTTGGGAATATCTTAAATAAGG - Intergenic
1065937662 10:30535107-30535129 ATATGGGAAGATATCAGAGTGGG + Intergenic
1067367665 10:45649523-45649545 CAATAGGAAAATATTAAACTTGG + Intronic
1068174828 10:53444880-53444902 ATATGGGAAAGTATTAAAGATGG + Intergenic
1071784997 10:88889241-88889263 CTATGGGGAGATCTTAAAATTGG + Intronic
1073794048 10:106968861-106968883 CTATGGGAAAGTCTTAATGTAGG + Intronic
1073965611 10:108985772-108985794 CTGTGGGTATATATTGATGTTGG + Intergenic
1075306401 10:121371600-121371622 CTAGGGGCATATATTACATTTGG + Intergenic
1076780578 10:132722194-132722216 AATTGGGAATCTATTAAAGTTGG - Intronic
1077389064 11:2291043-2291065 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389086 11:2291150-2291172 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389097 11:2291206-2291228 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389150 11:2291477-2291499 CTCTGTGAATATACTAAAGCGGG - Intergenic
1077389247 11:2291960-2291982 CTCTGTGAATATACTAAAGCGGG - Intergenic
1077389291 11:2292174-2292196 CTCTGTGAATATACTAAAGCGGG - Intergenic
1077389324 11:2292338-2292360 CTCTGCGAATATACTAAAGCGGG - Intergenic
1077389357 11:2292504-2292526 CTCTGTGAATATACTGAAGTAGG - Intergenic
1077389367 11:2292560-2292582 CTCTGTGAATATACTAAAGCGGG - Intergenic
1079872582 11:25818529-25818551 TGATGGGAAAATATTCAAGTTGG + Intergenic
1080220038 11:29892146-29892168 TTTTGGTAAAATATTAAAGTGGG + Intergenic
1080783448 11:35452779-35452801 CTATGGGAACACATAAAAATAGG - Intronic
1082682261 11:56189552-56189574 TTATGGAAAAATACTAAAGTTGG - Intergenic
1085542685 11:77287237-77287259 CAATGGGAAAAAACTAAAGTTGG - Exonic
1086600311 11:88625278-88625300 CTATGGAAATAAGTTGAAGTGGG - Intronic
1086837715 11:91645950-91645972 TAATGGGAGTAGATTAAAGTGGG - Intergenic
1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG + Intronic
1089438056 11:118488304-118488326 CTATGGGAATATAAAGGAGTGGG - Intronic
1089956013 11:122571982-122572004 ATTTGGCAATATATTAAAATAGG - Intergenic
1090200837 11:124854794-124854816 CTATAGAAATATAGTAAAATTGG - Intergenic
1094072038 12:26427464-26427486 ATATGAGAAAATATTAAATTGGG - Intronic
1094348097 12:29493893-29493915 TTATGGGAATATATTAAACCTGG + Intronic
1094408130 12:30140596-30140618 CTATGTCTTTATATTAAAGTGGG - Intergenic
1095381107 12:41593580-41593602 TTATAGAAAAATATTAAAGTTGG - Intergenic
1095503730 12:42869281-42869303 CTATGGGACTTTAATACAGTGGG + Intergenic
1098317899 12:69211388-69211410 CTAAGAAAATATATTCAAGTGGG + Intergenic
1098328137 12:69323768-69323790 CTATGTGAATATATTCGAGATGG + Intergenic
1098480012 12:70946737-70946759 TTCTGGGAACATATTAAAGTAGG - Intergenic
1098657363 12:73049938-73049960 ATATGGGACTATATTAAACTAGG - Intergenic
1098696362 12:73561433-73561455 GTATGGAAATATTTTAAAGGAGG + Intergenic
1099203117 12:79698534-79698556 CTATGGACATGCATTAAAGTTGG - Intergenic
1099293092 12:80796500-80796522 CTATGGGAATATATTAAAGTTGG + Exonic
1099755079 12:86835589-86835611 CTTTGGGAAAATGTAAAAGTGGG + Intronic
1100777659 12:97990226-97990248 CCATGGGAACTTTTTAAAGTTGG - Intergenic
1102011411 12:109621208-109621230 CTCTGGGAAAGTATTTAAGTAGG - Intergenic
1107001821 13:35555974-35555996 CTATAGGTATATATTAAATGCGG + Intronic
1107007516 13:35630953-35630975 CAATGGGAATATGTTAGAGGGGG - Intronic
1107716062 13:43200421-43200443 CTGTTGAAGTATATTAAAGTAGG - Intergenic
1109255613 13:60077356-60077378 ATTTGGGAATATCTTATAGTTGG - Intronic
1109789078 13:67224796-67224818 TTATTGTAATATATTAAATTCGG - Intronic
1109965753 13:69692539-69692561 ATATTGGCATATATTAAAGAGGG + Intergenic
1110755751 13:79171964-79171986 CTATGGAAATAAAAAAAAGTGGG - Intergenic
1111243037 13:85500931-85500953 ATAGGGAAATCTATTAAAGTGGG + Intergenic
1111297116 13:86294324-86294346 ATATGGCACTAGATTAAAGTTGG + Intergenic
1111640858 13:90968049-90968071 CTATGGAAATATGTTCATGTTGG - Intergenic
1114610690 14:24038102-24038124 TTATGTCCATATATTAAAGTTGG + Intergenic
1114684141 14:24512422-24512444 CAATGGGCTAATATTAAAGTAGG + Intergenic
1116739688 14:48738580-48738602 CTATGGCCATAAATTAAAATGGG + Intergenic
1118677810 14:68207314-68207336 CTGTGGGAATGAATTAAAATTGG - Intronic
1119978134 14:79048722-79048744 CTATGGCAATTTCTTAAAATAGG + Intronic
1120536086 14:85697581-85697603 ATATGGAAATGTATTACAGTTGG + Intergenic
1121205186 14:92158876-92158898 CTCTGGTAATATGTTAAAATTGG - Intronic
1121619759 14:95337930-95337952 CTATGGGAAGATGTAAAGGTGGG - Intergenic
1124413251 15:29453978-29454000 CTAAGGGTTTATATTAAAATCGG - Intronic
1126480667 15:49116232-49116254 AAATGGGATTATATTAAACTAGG + Intronic
1127578105 15:60312262-60312284 TTAAGGGAATATATCAAATTTGG + Intergenic
1129078676 15:73020522-73020544 CCATGTGACTATATTAAAGATGG + Intergenic
1132446117 15:101920436-101920458 CTATGAGAAAATTTAAAAGTGGG - Intergenic
1134806546 16:17130752-17130774 CTATGGGAACAGGTTATAGTGGG - Intronic
1145924570 17:28636516-28636538 CTCTGGGATTATTTTGAAGTAGG - Intronic
1153591579 18:6679552-6679574 ATATTGGAAGATATAAAAGTTGG + Intergenic
1155135052 18:22982667-22982689 CTATGTGTATATATCCAAGTGGG + Intronic
1155835601 18:30579864-30579886 CTATGGTCATATATAAAAGTAGG - Intergenic
1156657557 18:39307267-39307289 CAATGGGAATATAATTATGTGGG + Intergenic
1160132588 18:76241013-76241035 CTATGAAACTATATTAAAATTGG + Intergenic
1160454501 18:78991090-78991112 CTATGAGAATAGATGAAAATAGG + Intronic
1161568019 19:5014030-5014052 CTGTGGGAAGATATGGAAGTCGG + Intronic
1164057790 19:21636793-21636815 CTATGGGCATAGATACAAGTAGG - Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1165981331 19:39726828-39726850 CTATGGGAATCTGTTATAGGAGG - Intergenic
1166023200 19:40052449-40052471 CTATGGAAATTTATCAATGTGGG - Intronic
926926649 2:17994539-17994561 CCATAGGAATAGATTAAAGAGGG - Intronic
929092680 2:38235209-38235231 TTATGAGAATATATTATATTTGG - Intergenic
931713540 2:65010296-65010318 TCATGGGGATATATTCAAGTAGG - Intronic
932723366 2:74156766-74156788 CTCTGTGAACATTTTAAAGTAGG + Intronic
933240487 2:79915796-79915818 CTATCAGAATTTATTTAAGTTGG + Intronic
937199868 2:120194240-120194262 ATATGGGCAAATATAAAAGTAGG + Intergenic
937564582 2:123268670-123268692 GTATGTCAATATTTTAAAGTTGG + Intergenic
938734162 2:134171344-134171366 CTGTGTGTATATATTAATGTAGG + Intronic
942267716 2:174245035-174245057 AAATGGGACTATATTAAAATGGG - Intronic
942435199 2:175964171-175964193 TTATGGGAATATGTTAAGTTAGG - Intronic
942902736 2:181142052-181142074 CTATGGGAATATAATTCTGTGGG - Intergenic
945141514 2:206691449-206691471 CTATGGGAATATAGAAATTTGGG + Intronic
945397680 2:209340246-209340268 CTAATGGAATGTTTTAAAGTAGG - Intergenic
945503651 2:210610548-210610570 CTATGAGAATATAGTAGAATAGG + Intronic
945849968 2:214993564-214993586 CTATTTGAATATAATTAAGTGGG + Intronic
948989405 2:241545010-241545032 CGATGGGAATACATTAAAAAAGG - Intergenic
1170015342 20:11775153-11775175 CTATGGTAATAGACTAGAGTTGG + Intergenic
1170648597 20:18218550-18218572 TTATGTGAATATTTTAAGGTGGG - Intergenic
1173722240 20:45269467-45269489 CCATGGGAATACAGTAAAGAGGG + Intergenic
1177298371 21:19206489-19206511 CTGTGGCAATTTATTAAAATAGG + Intergenic
1183154384 22:36063829-36063851 TTATGGGAACATTTTAAAGATGG - Intergenic
949254160 3:2025203-2025225 GTATTTGAATATATTAAACTGGG + Intergenic
951589704 3:24250261-24250283 CTATGAGAAGATCTCAAAGTTGG - Intronic
952116918 3:30193595-30193617 TTATTGGAATTTATTACAGTTGG + Intergenic
952686646 3:36157435-36157457 GTATAGTAATATATTAGAGTTGG + Intergenic
953086600 3:39674396-39674418 AGATGTGATTATATTAAAGTAGG - Intergenic
955268745 3:57475081-57475103 ATATGGGAAAATATTTAAATTGG + Intronic
955763162 3:62311155-62311177 CTAGTGGAATATATTTAAGTTGG - Intergenic
955851381 3:63223733-63223755 CTATGGGAATATAGAAGAGGGGG - Intergenic
956149044 3:66222061-66222083 TTAGGGGAATATATGGAAGTAGG + Intronic
956282296 3:67570461-67570483 CTATGGGAATATGTTAGTCTTGG + Intronic
960648308 3:119915439-119915461 CTTTGGGAATATAATGTAGTTGG - Intronic
962781567 3:138723598-138723620 CCATGAAAATTTATTAAAGTTGG - Intronic
963173859 3:142278718-142278740 CTATGGAAATATTTTAATCTTGG - Intergenic
963552846 3:146745997-146746019 TTATGGGAATATTTTAAACAAGG + Intergenic
964114026 3:153116739-153116761 CCATTGGAATATGTTTAAGTGGG - Intergenic
964591902 3:158374070-158374092 CTATGTGCATATAATAAAGTTGG - Intronic
972435458 4:39029795-39029817 ATATGGGACTATATTAAATGAGG + Intronic
974571800 4:63661290-63661312 CTATGTAAATATGTTAAAATGGG - Intergenic
974816236 4:67007475-67007497 CAATGGGAATTTGATAAAGTCGG - Intergenic
977024773 4:91803821-91803843 CTATGGCAATTTCTTAAAATAGG - Intergenic
978628107 4:110710867-110710889 CTAAGGGAATTTATCAAACTAGG + Intergenic
979076775 4:116280910-116280932 GTGTGGGAATGTAGTAAAGTAGG + Intergenic
979318218 4:119292280-119292302 CTATGCAAATATATGAAACTAGG - Intronic
979834670 4:125349657-125349679 CTATTGGTATATTTAAAAGTGGG - Intronic
980508363 4:133753596-133753618 CTATGTTATTATATTAAAGTGGG + Intergenic
980575087 4:134676912-134676934 ATTTAGGAATATGTTAAAGTAGG - Intergenic
980599606 4:135004206-135004228 CTATGATAATGTATTAAAGAGGG + Intergenic
980778800 4:137469902-137469924 CTATGAGAATATATTCAAAATGG - Intergenic
981873369 4:149512871-149512893 CTATGTGAATATAACAAAGAGGG + Intergenic
981903988 4:149898640-149898662 CTATAGATATATTTTAAAGTAGG + Intergenic
984094609 4:175419015-175419037 ATATGGGAATATTTAAAAATTGG - Intergenic
984428979 4:179624435-179624457 TTATGGGAATATTTTATAGGTGG - Intergenic
986223190 5:5788825-5788847 CTAGGGCAATATTTTAAATTTGG - Intergenic
988726898 5:33935600-33935622 CTCTCAGAATACATTAAAGTAGG + Intergenic
991512047 5:67389077-67389099 CTTTGGATATATACTAAAGTGGG + Intergenic
992317131 5:75567540-75567562 TTATAGCAGTATATTAAAGTTGG - Intronic
993527192 5:88979866-88979888 CTATAGCAATATATTATAATGGG + Intergenic
995478733 5:112574031-112574053 CTACTGGAATTTATTAAAGCTGG + Intergenic
999116381 5:149167822-149167844 CTATGGGAACCAATGAAAGTAGG + Intronic
1000431777 5:161161313-161161335 CTATGGGAATATTTGCAAATTGG + Intergenic
1001067349 5:168546959-168546981 GTATAGGAATATCTTAAAATAGG + Intergenic
1003298071 6:4851950-4851972 CTATAGAAATAAATAAAAGTAGG - Intronic
1003767385 6:9254559-9254581 TCATGGGAATAAATTAAAATGGG - Intergenic
1008492975 6:52105121-52105143 CTATGGAATTATACTAAACTTGG - Intergenic
1010814211 6:80337648-80337670 CTATGAGAATATATTTTATTTGG - Intronic
1011023454 6:82839941-82839963 CTATGGTAATGAATTAGAGTTGG + Intergenic
1013382010 6:109582847-109582869 CTATGGAAATTTCTTAAACTAGG - Intronic
1014127785 6:117796263-117796285 CTATGCAAATCTAGTAAAGTTGG + Intergenic
1014708164 6:124773746-124773768 CTATGGAAAAATAATAGAGTGGG + Intronic
1018184440 6:161253861-161253883 GTATGGGAATAGATTAATTTTGG - Intronic
1018579103 6:165292311-165292333 CTTTGGGAAAATAATAAAGCAGG + Intronic
1020899232 7:13983586-13983608 CTATGGCAACATTTTAAAATTGG + Intronic
1021013233 7:15497804-15497826 CTATAGGAATATCTTAGAGATGG - Intronic
1021049482 7:15965691-15965713 CTATGTGATTATAATAAAGATGG + Intergenic
1021173567 7:17423841-17423863 CTTTGGAATTATTTTAAAGTAGG - Intergenic
1023561761 7:41481379-41481401 CTATGAGAATAAATGCAAGTAGG + Intergenic
1026712900 7:72758384-72758406 CAATGGGAACATAATAAATTAGG - Intronic
1027702882 7:81490660-81490682 ATATGAAAATATATTAATGTAGG + Intergenic
1027742542 7:82029095-82029117 CTATGGCAATTTCTTAAAATAGG - Intronic
1028016643 7:85722904-85722926 CTATAGGATTATATTCAAGGAGG - Intergenic
1030172808 7:106621161-106621183 CTATGGTAATTTCTTAAAATAGG + Intergenic
1030822238 7:114108562-114108584 GTTTGGGAATGTATTAAAATGGG + Intronic
1030841832 7:114363285-114363307 TTATGGGCATATAGTATAGTAGG - Intronic
1031622895 7:123956941-123956963 CTATGGAAATACATTAAAATTGG - Intronic
1032286873 7:130544895-130544917 TTATGGTAATATATTGATGTTGG + Intronic
1033164467 7:139027706-139027728 CTATGGGAATATATTTATAATGG + Intronic
1033272964 7:139949397-139949419 TTATGGGATTTTATTAAACTAGG + Intronic
1039417099 8:37404861-37404883 CTTGGGCAATATATTTAAGTTGG + Intergenic
1039652806 8:39360829-39360851 CTGTGGCAATATCTTAAAATAGG - Intergenic
1041148163 8:54901948-54901970 CTATGAAAAAAGATTAAAGTAGG + Intergenic
1042385867 8:68173874-68173896 CTTTGGAAATAAATGAAAGTTGG + Intronic
1043044002 8:75298109-75298131 GTATGAAAATATATTAAGGTAGG + Intergenic
1043316575 8:78929739-78929761 ATATTGGCATAAATTAAAGTAGG + Intergenic
1045005431 8:97913144-97913166 CTTTGTGAATATATTGAATTGGG + Intronic
1046307887 8:112394423-112394445 GTATGGGAATATATTGAGCTGGG - Intronic
1046392066 8:113587558-113587580 CCATGTGAATATATGAAAGGAGG + Intergenic
1046679881 8:117156882-117156904 CTCTGGGATTAGCTTAAAGTGGG + Intronic
1046898490 8:119498729-119498751 ATATGGGAATATATATAAATGGG + Intergenic
1048191761 8:132296118-132296140 AAATTGGAACATATTAAAGTAGG - Intronic
1052559964 9:30072521-30072543 ATAAGGAAATATATCAAAGTAGG + Intergenic
1052571365 9:30228345-30228367 TTATGAAAATATATTAAAATAGG + Intergenic
1054841270 9:69743742-69743764 CTATGGACAAAGATTAAAGTAGG + Intronic
1055522754 9:77098183-77098205 CTAAGGAAAGATTTTAAAGTAGG + Intergenic
1059543822 9:115156409-115156431 CTATTGGAGAAAATTAAAGTTGG + Intronic
1060458940 9:123830005-123830027 TTATTGGAATAAATTCAAGTAGG - Intronic
1062669660 9:137700453-137700475 CTTAGACAATATATTAAAGTGGG + Intronic
1186866263 X:13723711-13723733 ATTTGGGAATAGATTAAACTGGG + Intronic
1187847845 X:23559343-23559365 GTATGGGAATGTCTTAAATTGGG - Intergenic
1188211275 X:27428127-27428149 CTGTAAGAATCTATTAAAGTAGG + Intergenic
1188373873 X:29403689-29403711 ATATGGTAATAAATTAGAGTTGG - Intronic
1189180067 X:38995444-38995466 TCATGGGAATATATTAAACATGG + Intergenic
1190383346 X:49860978-49861000 ATATGGGAATATGTAGAAGTAGG - Intergenic
1192299981 X:69890468-69890490 GTATAGTAATATAGTAAAGTTGG - Intronic
1193680223 X:84509633-84509655 CTATGTGAATAGACCAAAGTAGG + Intergenic
1194995385 X:100586563-100586585 CTTTGGGACTAAATGAAAGTGGG - Intronic
1196839226 X:119843013-119843035 TTATGAGAATCCATTAAAGTGGG - Intronic
1198080422 X:133234565-133234587 ATATGGGAAAACATTAGAGTTGG + Intergenic
1198992168 X:142527023-142527045 CTATGTAAATTTATTAGAGTAGG + Intergenic
1199455753 X:148026479-148026501 CTATGGGAGAAAAGTAAAGTAGG - Intronic