ID: 1099296198

View in Genome Browser
Species Human (GRCh38)
Location 12:80830951-80830973
Sequence TTAATCAGTACAGCGTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099296198_1099296200 12 Left 1099296198 12:80830951-80830973 CCTCCTTACGCTGTACTGATTAA 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1099296200 12:80830986-80831008 TTGCCATCTCTAACACTATATGG 0: 1
1: 0
2: 0
3: 5
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099296198 Original CRISPR TTAATCAGTACAGCGTAAGG AGG (reversed) Intronic
906701873 1:47865363-47865385 TAAATCAGTACTGCGAGAGGTGG - Intronic
906837627 1:49100943-49100965 TTAATCAGTAAATGGTAGGGCGG + Intronic
921405451 1:214774676-214774698 TTAATGAGTTCTGCCTAAGGAGG - Intergenic
923212162 1:231813348-231813370 TTCATAAGCACAGCCTAAGGAGG + Intronic
924419188 1:243891646-243891668 GTAGCCAGTACAGAGTAAGGCGG - Intergenic
1071695927 10:87870974-87870996 GAAATCAGTACAGCCCAAGGGGG - Intronic
1077336571 11:2007631-2007653 TTATTCAGTGCAGCATAAAGTGG + Intergenic
1087229754 11:95647094-95647116 TTAAAGAGAACAGCCTAAGGAGG + Intergenic
1090525995 11:127537444-127537466 TGACTCAGTACAGAGTAAGCAGG - Intergenic
1091002075 11:131918135-131918157 ATAATCAGTCTTGCGTAAGGAGG + Intronic
1202819555 11_KI270721v1_random:62813-62835 TTATTCAGTGCAGCATAAAGTGG + Intergenic
1095513800 12:42983592-42983614 TAAAACCGTACAGCATAAGGAGG - Intergenic
1099228355 12:79995005-79995027 TAATTCAGTATAGCGTGAGGTGG - Intergenic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1108500364 13:51064931-51064953 ATAATCAGTAGAGGGTGAGGGGG - Intergenic
1109482872 13:62979305-62979327 TAAATCAATACAGAGTAAGGTGG - Intergenic
1119444343 14:74650815-74650837 TGAATCAGCACAGTGTATGGTGG + Intergenic
1130079673 15:80721714-80721736 TTCCTCTGTGCAGCGTAAGGTGG + Intronic
1156863437 18:41864339-41864361 TTTATCAGAGCTGCGTAAGGTGG + Intergenic
929317498 2:40497493-40497515 TAAATCAGTATTGGGTAAGGGGG + Intronic
935128428 2:100243481-100243503 TAAATCAGCACAGAGTAAGTAGG + Intergenic
935444317 2:103140072-103140094 TTAATCAGAACAGCTGCAGGAGG - Intergenic
939624663 2:144462057-144462079 TTCCTCTGTACAGGGTAAGGAGG + Intronic
1170583988 20:17720301-17720323 TTATTCACAACAGCATAAGGTGG + Intronic
1177165028 21:17591280-17591302 TTAATCATCACAGCCTCAGGGGG - Intronic
950828685 3:15852986-15853008 TAAATCAGTATCGCTTAAGGAGG + Intronic
978940518 4:114430674-114430696 TTTTTCAGTACAGTATAAGGAGG + Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
984219261 4:176953645-176953667 TTAATCAGTACAGTGGAGTGTGG - Intergenic
993395597 5:87383232-87383254 TTAAACAGAACAGCCTAAGTTGG - Intronic
1003906252 6:10702407-10702429 TTAATCAGTGGAGCGGAAGATGG + Exonic
1023401419 7:39794797-39794819 TTAAAAAGTACAGCTTAAGTTGG + Intergenic
1026254821 7:68701730-68701752 ATAATCAGTACAGTGTACCGTGG - Intergenic
1028295526 7:89125120-89125142 TTAATCTCTTCAGCTTAAGGGGG + Intronic
1047177045 8:122551694-122551716 TTAATGAGAAGAGCGTAAGCAGG + Intergenic
1051832160 9:21291796-21291818 TTCATCAGTATAGCCAAAGGTGG + Intergenic
1186844811 X:13520150-13520172 TTTGTCTGTACAGCGAAAGGTGG - Intergenic
1197101564 X:122662126-122662148 TTAATGAGTACTACGTAATGGGG + Intergenic
1198921470 X:141733340-141733362 TGAATCATTACAGCATAATGGGG - Intergenic