ID: 1099296198 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:80830951-80830973 |
| Sequence | TTAATCAGTACAGCGTAAGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 39 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 37} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1099296198_1099296200 | 12 | Left | 1099296198 | 12:80830951-80830973 | CCTCCTTACGCTGTACTGATTAA | 0: 1 1: 0 2: 0 3: 1 4: 37 |
||
| Right | 1099296200 | 12:80830986-80831008 | TTGCCATCTCTAACACTATATGG | 0: 1 1: 0 2: 0 3: 5 4: 120 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1099296198 | Original CRISPR | TTAATCAGTACAGCGTAAGG AGG (reversed) | Intronic | ||