ID: 1099296198

View in Genome Browser
Species Human (GRCh38)
Location 12:80830951-80830973
Sequence TTAATCAGTACAGCGTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099296198_1099296200 12 Left 1099296198 12:80830951-80830973 CCTCCTTACGCTGTACTGATTAA 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1099296200 12:80830986-80831008 TTGCCATCTCTAACACTATATGG 0: 1
1: 0
2: 0
3: 5
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099296198 Original CRISPR TTAATCAGTACAGCGTAAGG AGG (reversed) Intronic