ID: 1099296510

View in Genome Browser
Species Human (GRCh38)
Location 12:80834745-80834767
Sequence ACAGAAGACACTGATACATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099296510_1099296511 24 Left 1099296510 12:80834745-80834767 CCATATGTATCAGTGTCTTCTGT 0: 1
1: 0
2: 1
3: 26
4: 272
Right 1099296511 12:80834792-80834814 AACAAGATATAAATCCATTATGG 0: 1
1: 0
2: 1
3: 26
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099296510 Original CRISPR ACAGAAGACACTGATACATA TGG (reversed) Intronic
901357992 1:8668746-8668768 ACAGAAAAGACAGATCCATAGGG + Intronic
910151149 1:84148433-84148455 ACATGAGAGACAGATACATAAGG - Intronic
911708347 1:101040760-101040782 ACTGAAGCCACTGAGACAGAGGG + Intergenic
914044851 1:144082788-144082810 ACAGAGGACAGTGATACACTAGG + Intergenic
914133259 1:144877898-144877920 ACAGAGGACAGTGATACACTAGG - Intergenic
915947541 1:160164592-160164614 AGAGAAGACACCGAAATATATGG - Intronic
918370740 1:183859083-183859105 ACAGAAGAAACTGGTAGATGGGG - Intronic
918419403 1:184348708-184348730 GCAGAACCCACTGATACAGAGGG + Intergenic
919194421 1:194264580-194264602 CCAGATGACACTGATGCAAAAGG - Intergenic
919331325 1:196175896-196175918 AAAAAAGACAATGAAACATATGG - Intergenic
921415041 1:214876290-214876312 ACAGGAGACACAAATGCATAAGG + Intergenic
924230947 1:241961202-241961224 AAAGAAGACATTGACACACAGGG - Intergenic
1063703539 10:8409010-8409032 ACAGAATTCACTGAATCATATGG - Intergenic
1065009424 10:21408077-21408099 ACAGCTGACCCTGATACAGAAGG - Intergenic
1065067926 10:21990653-21990675 ACAGAAGAGACTCCTATATAAGG + Intronic
1066956975 10:42182470-42182492 ACAGAAGACAGTGATACACTAGG + Intergenic
1069050498 10:63787444-63787466 AAAGAAGACATTTATGCATATGG - Intergenic
1070896761 10:79989741-79989763 ACACAACACACTGAAACATATGG + Intergenic
1071182051 10:82997787-82997809 ATTGAAGAGACTGAGACATAAGG + Intergenic
1073053515 10:100684574-100684596 ACAGCAGAAACTGAGACAAATGG + Intergenic
1074958009 10:118411335-118411357 AGAGAAGACACAGACACAGAAGG - Intergenic
1075654373 10:124151698-124151720 ACAGAAGACCCTGATGGAAACGG + Intergenic
1078558516 11:12351012-12351034 AGAGAAGACACAGACACACAGGG - Intronic
1081238973 11:40680050-40680072 ACAGATCACACTGATACAAGAGG - Intronic
1081461549 11:43276937-43276959 AGAGAAAACACAGACACATAAGG + Intergenic
1082857195 11:57818517-57818539 GGAAAGGACACTGATACATAAGG - Exonic
1084109885 11:67007251-67007273 CCAGAAGACACTCATCCCTAAGG + Exonic
1086767210 11:90711207-90711229 ACAGGACACACAGATATATAGGG - Intergenic
1087112525 11:94486172-94486194 ACAAAAGACACTATTATATATGG + Intronic
1087201070 11:95345292-95345314 ACAGAAGACATTGTTAGAGAGGG - Intergenic
1087238849 11:95752654-95752676 ACTGAAGAGACTGAGACAGAGGG + Intergenic
1087573317 11:99959081-99959103 ACAGAAGACACAGAGGCAAAGGG - Intronic
1087887184 11:103494716-103494738 ACAGCTGACCCTGATACAGAAGG + Intergenic
1088095727 11:106099218-106099240 AGAGAAGATATTCATACATATGG - Intergenic
1088358587 11:108968379-108968401 ACAGAGGACACAGACACACAGGG + Intergenic
1089931791 11:122320298-122320320 TCAGAAGACACTGAAACAAAAGG + Intergenic
1089998645 11:122933332-122933354 ATATAACACACTGATGCATATGG + Intronic
1090192718 11:124785954-124785976 TCAGAAGACACTGAAAATTATGG + Intronic
1093557484 12:20493283-20493305 GCAGAACACACAGATACAGAGGG - Intronic
1095126452 12:38483944-38483966 AGAAATGACACTGATAAATAAGG - Intergenic
1095455890 12:42385308-42385330 AAAGAAAACAATGATACAAATGG - Intronic
1096446612 12:51698576-51698598 ACAGAAGAGACAGAAAAATATGG - Intronic
1096759818 12:53831850-53831872 AAAGAAGAAACTGACACCTATGG + Intergenic
1097932063 12:65198886-65198908 GCAGAACACACGGATACAGAGGG + Intronic
1098869057 12:75796336-75796358 AGTGGAGACCCTGATACATAAGG - Intergenic
1099139373 12:78952286-78952308 ACAGCAGACACTGATGCAGGTGG + Intronic
1099296510 12:80834745-80834767 ACAGAAGACACTGATACATATGG - Intronic
1099572174 12:84336548-84336570 CCTGAAGACACTGATACAACTGG + Intergenic
1100150092 12:91726107-91726129 ACAGATTACACTGGTTCATAGGG - Intergenic
1101763678 12:107679821-107679843 ACAGATGACACTGAGCTATAGGG + Intergenic
1103221468 12:119249514-119249536 ACAGAAGAAAATGAGACAGATGG + Intergenic
1104361964 12:128141761-128141783 ACAGAACCTACTCATACATAAGG + Intergenic
1104459354 12:128942133-128942155 TCAGAAGCCACTGAGACATCAGG + Intronic
1104469443 12:129017953-129017975 ACAGCTGACCCTGATACAGAAGG + Intergenic
1104476857 12:129077629-129077651 ACACAAGACACACATGCATACGG + Intronic
1107517025 13:41139213-41139235 TCAAAAGACACTGATACAAAAGG + Intergenic
1107585980 13:41848744-41848766 ACAGAACAGACTAATACACAGGG + Intronic
1109653333 13:65356693-65356715 ACATAACACACAGATACAGAGGG + Intergenic
1110184285 13:72655306-72655328 ACAGAAAAGACAGAGACATAGGG - Intergenic
1111436263 13:88212419-88212441 ACACAAGACACTTATGCAAAAGG - Intergenic
1114576663 14:23720800-23720822 ACAGAACAGACTAATACATGTGG - Intergenic
1116746669 14:48829340-48829362 AAAGAAGACATTGATTCCTAAGG - Intergenic
1117129327 14:52669195-52669217 ACAGAAGACACTAATACAAATGG + Intronic
1117666189 14:58058825-58058847 ACAGAACCCACGGATACAGACGG + Intronic
1119572296 14:75685873-75685895 CCAGAAGATTCTGATACAGATGG - Intronic
1120784125 14:88515177-88515199 ACAGAAGTCAATGATATTTAGGG + Intronic
1122927365 14:104911588-104911610 ACAGAAGATACAAAAACATAAGG + Intergenic
1202936135 14_KI270725v1_random:89306-89328 ACAGAGGACAGTGATACACTAGG - Intergenic
1123837217 15:24207596-24207618 AGAGAAGACACAGATTCAGATGG - Intergenic
1123846424 15:24307384-24307406 AGAGAAGACACAGATTCAGATGG - Intergenic
1123865430 15:24514442-24514464 AGAGAAGACACAGATTCAGATGG - Intergenic
1124238393 15:28009144-28009166 ACAGAAGTCACAGAAACATAAGG + Intronic
1125901108 15:43348538-43348560 ACGGAACACACATATACATATGG + Intronic
1126510626 15:49468541-49468563 AAAAAACACAATGATACATATGG - Intronic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1127974383 15:63986374-63986396 ACATAAGTCACTGATTCAAATGG + Intronic
1128340413 15:66818745-66818767 ACAGAAAACTCTGATACAACTGG - Intergenic
1130098597 15:80874748-80874770 ACAGAAGACAGTGACAGACAGGG + Intronic
1131090177 15:89618591-89618613 ACGGAATACACAGATACATAAGG - Intronic
1131309916 15:91280838-91280860 ACACAAGAAACTGATAGAAACGG - Intronic
1131935088 15:97495086-97495108 TCAGAAGATAGTGATACAGAGGG + Intergenic
1133124022 16:3633155-3633177 ACAGAAAACAGTAATAAATATGG - Intronic
1134437548 16:14275161-14275183 ACAAAAGATACTGAAACAAATGG + Intergenic
1134784572 16:16930054-16930076 ACAGAAAACACTGATGGAGATGG + Intergenic
1136070719 16:27785328-27785350 ACAGGAGACACTGATTTAAAAGG - Intergenic
1139898161 16:70304998-70305020 AAAGTAGACACTGAAATATATGG - Intronic
1140295346 16:73704529-73704551 ACATAAGACACTGCTACCAATGG + Intergenic
1140864413 16:79047543-79047565 CCACAGGACACTGATACACATGG - Intronic
1141062991 16:80892169-80892191 TCTGAAGACACAGATACATCTGG - Intergenic
1144098739 17:11925212-11925234 ATAGCAGACACTGAAACAAAAGG + Intronic
1146241439 17:31231779-31231801 ATAGAACTCACTGATACAGAGGG + Intronic
1148720017 17:49745114-49745136 ACAGAACCCACAGATACAGAGGG + Intronic
1149707349 17:58706808-58706830 GCAGAAGCCAGTGATAGATAAGG - Intronic
1150654144 17:67028714-67028736 ACAGATGAGACTGACGCATAAGG + Intronic
1155778676 18:29801954-29801976 AGAGAAAACACTGATAAATTGGG + Intergenic
1156773841 18:40763355-40763377 ACAGAAGATGCTGAAACACAGGG - Intergenic
1157076583 18:44473803-44473825 GCAGAAGACACTGAGGCATCTGG - Intergenic
1157163134 18:45333160-45333182 CCAGAAGATACTGATGCATTTGG - Intronic
1158022658 18:52861430-52861452 ACAGAAGAAACTGATTCTTGTGG + Intronic
1158781187 18:60653895-60653917 ACTGGAGACACTGAGACAGAAGG + Intergenic
1159785692 18:72711952-72711974 ACTGAAGAGTATGATACATATGG + Intergenic
1159949404 18:74470526-74470548 ACAAAAAACTCTAATACATATGG - Intergenic
1160755639 19:755593-755615 ACAGGAGACACAGATAAATATGG + Intronic
1161850430 19:6735407-6735429 GCAGAAGACCCGGATACAGAGGG - Intronic
1163418099 19:17198868-17198890 ACAGAAGACACAGACACTGAGGG - Intronic
1164052009 19:21591927-21591949 AAAGAAGACACTGGGACCTAGGG - Intergenic
1202684409 1_KI270712v1_random:36192-36214 ACAGAGGACAGTGATACACTAGG + Intergenic
924978561 2:199342-199364 TCACAAGACACAGATACATATGG - Intergenic
926820424 2:16845843-16845865 ACAGTAGACACCGAGACTTAAGG - Intergenic
927443838 2:23140429-23140451 ACAAAAGACAATGATTCATGGGG + Intergenic
928396686 2:30948038-30948060 ACAGGATACATGGATACATATGG + Intronic
928698928 2:33879334-33879356 ACAGAATCCACAGATACAAAGGG - Intergenic
928736483 2:34297060-34297082 ACAGGAGATACTAAGACATAAGG + Intergenic
928919949 2:36516484-36516506 AGAGATGACACTGATAGAGAGGG - Intronic
929840648 2:45459161-45459183 ACAGAAGAATCAGATACACAAGG + Intronic
930740737 2:54830463-54830485 AGAGAAGACCCTGTGACATAGGG + Intronic
933989413 2:87623155-87623177 CCAGAAGACTCTGATGCATGTGG + Intergenic
934247309 2:90318654-90318676 ACAGAGGACAGTGATACACTAGG - Intergenic
934262016 2:91483949-91483971 ACAGAGGACAGTGATACACTAGG + Intergenic
934305057 2:91814935-91814957 ACAGAGGACAGTGATACACTAGG + Intergenic
934328200 2:92037813-92037835 ACAGAGGACAGTGATACACTAGG - Intergenic
934466580 2:94268350-94268372 ACAGAGGACAGTGATACACTAGG - Intergenic
935233185 2:101117035-101117057 ACTGAAGACACAGACACACAGGG + Intronic
935876994 2:107519770-107519792 ATAGAAGAAAATGATACAGATGG - Intergenic
936304429 2:111327671-111327693 CCAGAAGACTCTGATGCATGTGG - Intergenic
936432383 2:112475582-112475604 ACGGTAGACACTGAGACATGTGG + Intergenic
939347967 2:140992497-140992519 ACAGAGGAAGCTGATATATAGGG + Intronic
940152966 2:150623250-150623272 AGAGAAGAGAGTGATACATAGGG + Intergenic
940256944 2:151741264-151741286 ACAGAACCCACAGATACAAAGGG + Intergenic
940734903 2:157439766-157439788 CCATAATACACTGATACCTAGGG + Intronic
945276637 2:207994392-207994414 ACAGATGACAGTGATGCAGAGGG + Intronic
945395899 2:209317110-209317132 ATAGATAACACTGAAACATAAGG - Intergenic
945829438 2:214765051-214765073 ACAGTAGTCACTGGCACATATGG + Intronic
945842808 2:214908212-214908234 ACAGAAGACACTTTTTCACAGGG + Intergenic
947328592 2:229004373-229004395 ACTGAAGAAACCAATACATAGGG + Intronic
947401077 2:229732202-229732224 ACAGCTGACGCTGATACAGAAGG + Intergenic
948574569 2:238941387-238941409 CCAGAAGACAGTGATATACAGGG + Intergenic
1169447824 20:5687292-5687314 ACACAAGACACAGACACAAAAGG - Intergenic
1170447458 20:16443293-16443315 AAAGAAAACACTGGTACAGAAGG + Intronic
1171072966 20:22092882-22092904 ACAGAAGACAGGGAAACATTGGG - Intergenic
1171083283 20:22210677-22210699 ACAGAAAAAAATGATACAGAAGG - Intergenic
1172134018 20:32675215-32675237 ACAGAAGACACAGAGACCCAAGG - Intergenic
1172829398 20:37820468-37820490 CCAGAAGACACAGATTGATATGG + Intronic
1173305906 20:41849135-41849157 ACATAAGACATAGATACAGAAGG - Intergenic
1173393091 20:42652646-42652668 ACTGAAGACATTGATGCCTATGG + Intronic
1174697616 20:52576280-52576302 ACCTAAGAAACTAATACATATGG - Intergenic
1174821942 20:53733926-53733948 AAAGAAGACACAGATCCACAGGG + Intergenic
1176954288 21:15082784-15082806 AGACAGGACACTGATACACATGG + Intergenic
1176985461 21:15431143-15431165 AAAGAAGACCCTGCTACATGGGG - Intergenic
1177696472 21:24579506-24579528 CAAGAAGACACTCATAAATATGG + Intergenic
1178237953 21:30865024-30865046 ACCTAGGACACTGATACAGAAGG + Intergenic
1179169168 21:38959431-38959453 AGAGAAGACACAGACACAGAGGG + Intergenic
1179338894 21:40485563-40485585 ACAGAAGGAACTAATACAGAAGG + Intronic
1179392466 21:41006479-41006501 ACATAATACACTGAGACATGCGG + Intergenic
1180280484 22:10688986-10689008 ACAGAGGACAGTGATACACTAGG - Intergenic
1180587706 22:16907522-16907544 ACAGAGGACAGTGATACACTAGG - Intergenic
1180943147 22:19673339-19673361 AGAGAAAATACTGATACATCAGG - Intergenic
1181866575 22:25861936-25861958 ATAGAACCCACAGATACATATGG - Intronic
1183761262 22:39820822-39820844 AGAGAAAACACTGAAACAAATGG + Intronic
1184424063 22:44398866-44398888 ACAGCAGACAGTGATAAACAGGG + Intergenic
949117717 3:348156-348178 ATAGAACACACTGATAAAAAAGG + Intronic
949576198 3:5341171-5341193 ACAGAAGTCATTGATTGATAGGG - Intergenic
950298520 3:11853126-11853148 CCAGAAGACACTGAGAGAGAAGG - Intergenic
951055177 3:18139171-18139193 ACAGAAGACATTGGGACATCAGG + Intronic
953188012 3:40656113-40656135 ACAGAAGACAGGGATGCTTAAGG - Intergenic
954343621 3:49976843-49976865 ACTGAAGACATTGATACACATGG + Intronic
955034143 3:55249888-55249910 TGAGAACACACTGACACATAGGG - Intergenic
955745242 3:62134155-62134177 ACAGCAGAGGCTGCTACATATGG + Intronic
957282883 3:78176360-78176382 ACGGAAAATACTGATATATATGG - Intergenic
957560295 3:81812966-81812988 ACAGAAGACCCTGCTAAATGCGG - Intergenic
958720717 3:97839589-97839611 TCAGAAAACACTGTTACATTGGG - Intronic
958812417 3:98876874-98876896 CCAGAAAACACTGATAGGTAGGG + Intronic
960375169 3:116891941-116891963 ACTGAAGAAACTGAGACATAGGG - Intronic
961081110 3:124029165-124029187 AGAGAAGACAGAGACACATAGGG - Intergenic
962489004 3:135872675-135872697 CCTGAAGACACTTAAACATAAGG + Intergenic
964331371 3:155607009-155607031 AAAGCAGACACTGTTACACATGG - Intronic
964405902 3:156349066-156349088 ACAGAGGAAACTGAGACACAGGG + Intronic
964822649 3:160790146-160790168 GCAGAACACACAGATACAGAGGG + Intronic
965666398 3:171098196-171098218 AGGGAAGACACTAATACCTAAGG + Intronic
968052069 3:195661725-195661747 ACAGAAGACACAGATCCAGAGGG - Intergenic
968103743 3:195986613-195986635 ACAGAAGACACAGATCCAGAGGG + Intergenic
968302045 3:197624206-197624228 ACAGAAGACACAGATCCAGAGGG + Intergenic
969049821 4:4364810-4364832 CCACAGGACACTGATACACAAGG - Intronic
970056077 4:11973298-11973320 AGAGAGGACATTGATACATCAGG - Intergenic
970140628 4:12978269-12978291 ACATAAGACACTGTTAGATGTGG - Intergenic
970174047 4:13320192-13320214 AAAGAAGACACTGAAAGAGAAGG - Intergenic
970808621 4:20064921-20064943 CAAGAAGCCACTGAAACATAGGG - Intergenic
971037917 4:22715274-22715296 AAAGAAGACACAGAGACACAAGG + Intergenic
972027276 4:34398730-34398752 ACAGAAGACACAGTCACATTAGG + Intergenic
973665590 4:53155523-53155545 ACAGAACAGACTAAGACATAGGG + Intronic
974386967 4:61213943-61213965 ACAGAAGGCAATGATGCATCTGG - Intronic
974675585 4:65084500-65084522 AAAGAACACACGGACACATAGGG - Intergenic
974943586 4:68498565-68498587 ACAGAATACACTGAAACAAGAGG - Intergenic
975225131 4:71863060-71863082 ACAGAAAACAATTATACTTATGG + Intergenic
975707858 4:77128561-77128583 ACAGCTGACGCTGATACAAAAGG - Intergenic
976512327 4:85925763-85925785 ACAGTAGCCACTCATCCATAGGG - Intronic
976670553 4:87647983-87648005 AGAGAAGACACAGATAAATATGG - Intergenic
976774016 4:88687246-88687268 ACAGAAGAAGCTGATACCTGGGG + Exonic
978844977 4:113262558-113262580 ACAGAAGCTACTGATACAGAGGG - Intronic
978911107 4:114065112-114065134 AAATAAGACACTGACACAAAAGG + Intergenic
978951224 4:114561768-114561790 ACAGCTGACCCTGATACAGAAGG - Intergenic
978985511 4:115007482-115007504 ACAGAAGGTAATGATACATGTGG + Intronic
981425127 4:144594297-144594319 ACAGAAAGCACTGAAAAATAAGG + Intergenic
982258827 4:153475623-153475645 GCAGAAGTCACAGATACAGAGGG - Intronic
982532913 4:156570166-156570188 ACAGAAGAAAAGGACACATAAGG - Intergenic
982778820 4:159468840-159468862 CCAGAAGTCAATGGTACATATGG - Intergenic
984045043 4:174786450-174786472 ACAGAAGACATTTACACAAAAGG - Intronic
984181470 4:176488191-176488213 ACAAAAGATACTGATACAACTGG + Intergenic
984788691 4:183593273-183593295 ACAAAAGAAAATAATACATATGG + Intergenic
984878916 4:184393386-184393408 AAAGAAGACAGTGATATTTATGG - Intronic
985038601 4:185866077-185866099 ACAGAAAACACTCTTAAATATGG - Intronic
985498267 5:223451-223473 ACAGAAGACACAGATCCAGAGGG - Intronic
986558921 5:9041020-9041042 ACAGAAGACTCTGACATATGAGG + Exonic
988059040 5:26142704-26142726 ATACAAGACACTGACAGATATGG + Intergenic
988471053 5:31539023-31539045 ACAGAACCCACGGATACAGAGGG - Intronic
988974069 5:36498016-36498038 GCAGAACCCACAGATACATAGGG + Intergenic
989069446 5:37495350-37495372 ACAGATGGCACTGTTACAAAGGG + Intronic
990197286 5:53332823-53332845 AGAAAAGACAGTGACACATAAGG - Intergenic
990440702 5:55842195-55842217 ACAGAAGAGACAGACACAGAGGG - Intergenic
992368527 5:76118259-76118281 AGAGAAGACACAGAGACAAAAGG - Intronic
992792189 5:80223481-80223503 ACAGAATCCACGGATACAGAGGG + Intronic
994579017 5:101614820-101614842 ACAGCAGACAATGACACTTACGG - Intergenic
995463849 5:112430550-112430572 ACAGAACCCACTAATACATAGGG - Intergenic
995882642 5:116860144-116860166 ACAGTAGACACTGGTTCGTAAGG + Intergenic
996139380 5:119887431-119887453 ACAGAATTTACTGATAGATAGGG - Intergenic
996461951 5:123755158-123755180 ACAGAACACACTGTTAGAAACGG - Intergenic
999843733 5:155456058-155456080 ACAAAGGACCCTGATACAAATGG + Intergenic
1000005835 5:157184184-157184206 ACAGAGGACAATGAGAGATAAGG + Intronic
1000100028 5:158007458-158007480 ACAGCTGACCCTGATACAGAGGG + Intergenic
1001773945 5:174314873-174314895 GGAGAGGACACTGGTACATATGG + Intergenic
1001902117 5:175441008-175441030 ACAGCAGAAACTGATAGATAAGG - Exonic
1003097618 6:3154942-3154964 ACATTAGACACTAAAACATAAGG + Intronic
1004029823 6:11855949-11855971 ACAGAAGACACTAGTAGATAGGG + Intergenic
1006571356 6:35007722-35007744 TCTGAAGACAGTGATACATGTGG + Intronic
1007009116 6:38397781-38397803 TCACAAGACAGTGATAGATAGGG + Intronic
1009031998 6:58070433-58070455 ACAGAAGACAAGGAAGCATAGGG - Intergenic
1010957680 6:82108760-82108782 ACACAACACACCGAAACATATGG + Intergenic
1012582253 6:100883099-100883121 ACAGAAGCCATGGATACAGAGGG - Intergenic
1014487995 6:122024334-122024356 ACAGAACTCACAGATACAGAGGG + Intergenic
1014599790 6:123396682-123396704 TCAGAAGACATTGAAACATTTGG - Intronic
1014815181 6:125927787-125927809 ACTGAGGACACTGTGACATATGG - Intronic
1021383827 7:20003335-20003357 ACAAAAGAAACTGATACTTAAGG - Intergenic
1023279930 7:38558969-38558991 ACAGGAAACAGTGAGACATAAGG + Intronic
1023728411 7:43167292-43167314 AGAGAAGACACAGAGACATAGGG - Intronic
1028287342 7:89018861-89018883 AGAGAAGACACACATAAATAAGG - Intronic
1032281921 7:130510626-130510648 ACAGAAGACACTTACATATAAGG + Intronic
1032556486 7:132841366-132841388 TCAGAAGACACTTTTACAAATGG + Intronic
1032756566 7:134896558-134896580 AGAGAAGACACATATACAGAAGG - Intronic
1034430657 7:151039681-151039703 ACAGAAGACACTGGGCCACAGGG - Intronic
1035240345 7:157524956-157524978 ACAGAAGAGACAGAGACAGAGGG + Intergenic
1036125050 8:6054939-6054961 GGAAAAGACACCGATACATAGGG + Intergenic
1036533824 8:9624982-9625004 GCAGAACCCACAGATACATAGGG + Intronic
1036630393 8:10509745-10509767 ACAGAAGAAATTGATACATTGGG - Intergenic
1037179051 8:15982582-15982604 CCAGAAGGCACTTATAAATATGG - Intergenic
1037791000 8:21941640-21941662 ACAGAACCCACAGATACAGAAGG + Intronic
1037829442 8:22179146-22179168 ACAGGAGACACTGATAGATTGGG + Intronic
1038510230 8:28127184-28127206 ACAGAGGACACTGCTGCACAAGG - Intronic
1038893916 8:31759251-31759273 ACAGAAAACACTGATAAAATAGG - Intronic
1039139410 8:34368754-34368776 AGAGAAGACTCTGAAAGATAAGG - Intergenic
1040392230 8:46960011-46960033 ACAGAAAAAACAGATAAATACGG + Intergenic
1040430061 8:47331134-47331156 AAAGAAGATACAGATACAGATGG - Intronic
1042203578 8:66305592-66305614 ACTGAGGAAACTGAAACATAGGG - Intergenic
1042982486 8:74546213-74546235 AAAAAAGACAATGAAACATAAGG + Intergenic
1043962725 8:86435733-86435755 ACAGAATACAATGAGACAAATGG - Intronic
1044198419 8:89405310-89405332 AAATAAGACACTCTTACATATGG - Intergenic
1044569849 8:93705345-93705367 ATAGAGGACACTGATATATTAGG - Intronic
1044765594 8:95570213-95570235 ACAGAACATACTAAAACATATGG - Intergenic
1045380733 8:101622207-101622229 TCAGAAGACAATGATATTTAAGG + Intronic
1046690782 8:117282197-117282219 AAAGAAGACACACAGACATAGGG - Intergenic
1053292786 9:36892961-36892983 ACAGAAGACACTGTTAACTTTGG + Intronic
1053696628 9:40645123-40645145 ACAGAGGACAGTGATACACTAGG - Intergenic
1053943048 9:43275333-43275355 ACAGAGGACAGTGATACACTAGG - Intergenic
1054307878 9:63444351-63444373 ACAGAGGACAGTGATACACTAGG - Intergenic
1054406605 9:64768353-64768375 ACAGAGGACAGTGATACACTAGG - Intergenic
1054440235 9:65253826-65253848 ACAGAGGACAGTGATACACTAGG - Intergenic
1054490170 9:65768113-65768135 ACAGAGGACAGTGATACACTAGG + Intergenic
1055185181 9:73442644-73442666 ACAGAGGACATTGAAACATAAGG + Intergenic
1055395126 9:75866001-75866023 AGAGAATAAACTGGTACATAAGG - Intergenic
1055852672 9:80651111-80651133 AGAGCAAACACTGAGACATACGG + Intergenic
1056886768 9:90450321-90450343 ACAGAAAACACTGATAATAAGGG + Intergenic
1062441659 9:136572451-136572473 ACATAAGACACTGATGAATGAGG + Intergenic
1202779079 9_KI270717v1_random:18783-18805 ACAGAGGACAGTGATACACTAGG - Intergenic
1203586145 Un_KI270747v1:5192-5214 ACAGAGGACAGTGATACACTAGG - Intergenic
1186299643 X:8185899-8185921 ACAGAAGATACAGCTATATAAGG + Intergenic
1188179515 X:27036776-27036798 GAAGAAGACACTGAAACATTTGG + Intergenic
1188713404 X:33430482-33430504 TCAGAACAGACTAATACATATGG - Intergenic
1189316410 X:40060048-40060070 GCAGAAGACAATGATAAAGAGGG + Intronic
1190184786 X:48224155-48224177 ACCGAAGACAGTGTTACATGTGG - Intronic
1190416557 X:50185655-50185677 CCAGAAGACACTGAAATAGATGG + Intergenic
1190417014 X:50190210-50190232 AGAGAAGACACTGGGACATTGGG + Intergenic
1192253301 X:69432156-69432178 ACAGAGTATACTGATATATAGGG + Intergenic
1192862390 X:75089675-75089697 ACAGAAAACAGTTACACATATGG + Intronic
1195862174 X:109394233-109394255 AGAGAAGCCAGTGATAGATAGGG - Intronic
1196164414 X:112522731-112522753 ACTGAAGACTGTGATACATTAGG + Intergenic
1197227737 X:123971067-123971089 TCAGAAGAAACTGAAGCATAGGG + Intronic
1199875537 X:151925057-151925079 ACAGAATAGACTGAGGCATAAGG - Exonic
1199920389 X:152396408-152396430 ACAGATGACATTGTTACAAAAGG + Intronic
1201194359 Y:11477057-11477079 ACAGAGGACAGTGATACACTAGG - Intergenic
1201965102 Y:19724167-19724189 AGAGAATACACAGACACATAAGG + Intronic
1201990906 Y:20024223-20024245 ACAGAAGAGGCTGAAGCATAGGG - Intergenic