ID: 1099297372

View in Genome Browser
Species Human (GRCh38)
Location 12:80845447-80845469
Sequence AAATGTTACTTGGAGTATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099297372 Original CRISPR AAATGTTACTTGGAGTATTA TGG Intronic
902101177 1:13990828-13990850 AAATGTTAATTGTAGAATGAAGG + Intergenic
905681600 1:39876190-39876212 AAAAGTTACTTGGGGTATATAGG - Intronic
906022638 1:42644057-42644079 AACTTTTACTTGGTGTATTAGGG + Intronic
906215006 1:44033515-44033537 AAATTTTCCTTGGAGTGTTTAGG + Intergenic
907070617 1:51531310-51531332 AAATATTATTTGGACTATTGTGG + Intergenic
908725892 1:67176646-67176668 AAATTATACTTGAAGTTTTAGGG + Intronic
908957787 1:69655531-69655553 CAAAGTTACTAGGAGTCTTAGGG - Intronic
909211178 1:72826370-72826392 AAATATTAAATGGAGTATAAGGG + Intergenic
909643375 1:77890571-77890593 AAATTTCACTTGAAGTATTTAGG + Intronic
909896200 1:81072598-81072620 AAATTATAATTGGAATATTATGG + Intergenic
910359714 1:86403513-86403535 AAATTTTGCTTGCAGTTTTAGGG - Intergenic
910826895 1:91418730-91418752 AAAAATTACATGGTGTATTAGGG - Intergenic
911126053 1:94341975-94341997 AACTTTTACTGGGAGTATAACGG - Intergenic
911410000 1:97491930-97491952 AAATGTTACAGGGCTTATTATGG + Intronic
915965228 1:160301309-160301331 AAATGTTCATTGGAGCAGTATGG + Intronic
916463574 1:165049997-165050019 ATATGTTTCTTGGAGTTTGAGGG - Intergenic
916506743 1:165435104-165435126 AAATGTTCATTGGAGTATTTGGG + Intronic
916507133 1:165438273-165438295 AAATGCTAATTGGAGCATTTTGG + Intronic
917069952 1:171139746-171139768 AGATCTCACTAGGAGTATTATGG + Intronic
917557369 1:176103570-176103592 AAATGCTAATTGGAGCATTTTGG - Intronic
917664836 1:177215327-177215349 ATATGTTGCTTTGAGTAGTATGG + Intronic
919219681 1:194610474-194610496 CAATATTACTTGGTGTTTTAAGG - Intergenic
919493186 1:198230695-198230717 AAAAGCTACTTGGACTAATAAGG + Intronic
919517238 1:198540980-198541002 CAATGTTTCTTGGAAGATTAGGG - Intergenic
919727260 1:200892269-200892291 AAATCTTACTTCAAGAATTAAGG - Intronic
920836472 1:209515327-209515349 AAAAGTTAGTTGTATTATTAGGG - Intergenic
920907699 1:210187545-210187567 AACTGTTGCTTGGAGTAATGAGG - Intergenic
921654230 1:217715024-217715046 AAATGTTTCTTGCACTTTTAAGG - Intronic
922627275 1:227061297-227061319 AAATGTTATTATGATTATTAAGG - Intronic
923565254 1:235071621-235071643 AAATGTTCATTGGAGCATTACGG - Intergenic
923644209 1:235799599-235799621 AAATTTTAGTTGGAGAATTAAGG - Intronic
924223347 1:241900799-241900821 AAATGTTACTGGGTGAATAAAGG + Intergenic
924690506 1:246345534-246345556 AAATGCTCATTGGAGTATTTTGG - Intronic
924954941 1:248917088-248917110 AAATGTCAATTTGAGTCTTACGG + Exonic
1063946970 10:11186706-11186728 AAATGTTCATTGGAGCATTTTGG + Intronic
1064042702 10:11982115-11982137 AAATTTTAGTTAGAATATTAAGG + Intronic
1065057114 10:21857374-21857396 ACATGTTTCTTGGAATTTTAGGG + Intronic
1065592126 10:27274303-27274325 AAATGTTTCTTTGTGTACTATGG + Intergenic
1067358420 10:45553371-45553393 TAATCTTTCTTTGAGTATTATGG - Intronic
1068018962 10:51556556-51556578 AAATGTTCCTTGCAGCAATATGG + Intronic
1068956722 10:62825021-62825043 AAATGTCCCTTGGAGTCTTGGGG + Intronic
1069348245 10:67495393-67495415 AAATGCTTCTAGGAGTCTTAGGG - Intronic
1070353433 10:75615411-75615433 AAATGTTTATTGGAGCATTTTGG - Intronic
1071106794 10:82107194-82107216 AAATGTTCATTGGAGTATTTTGG - Intronic
1072064053 10:91848144-91848166 AAATGTTTATTGGAGCATTTTGG - Intronic
1072476498 10:95765647-95765669 AAATATTGTTTGGGGTATTATGG + Intronic
1072712574 10:97726305-97726327 AAATGATAGTTGGTGTATTCAGG + Intergenic
1075229256 10:120658993-120659015 AAATCTTTCTAGGAGAATTACGG - Intergenic
1076304288 10:129453014-129453036 CATTGTTACTTGAAATATTATGG - Intergenic
1078679080 11:13458637-13458659 TAAAGTTACTTTCAGTATTATGG + Intronic
1079782595 11:24626906-24626928 AAATGTCACATGGAGTAGCATGG - Intronic
1080188495 11:29519898-29519920 AAATGTTACAAGGGGGATTATGG + Intergenic
1080380851 11:31771031-31771053 AAATGTGACTTGGAATCTTTTGG - Intronic
1080483809 11:32683211-32683233 AAATGCTCATTGGAGTATTTTGG - Intronic
1086118062 11:83275450-83275472 AAATGTGCATTGGAGTATTTTGG + Intronic
1087420425 11:97918178-97918200 AAATGAAACTTGGAGAATGATGG - Intergenic
1088704834 11:112452676-112452698 AATTGTTCCTAGGAGTAATAAGG - Intergenic
1091101266 11:132875993-132876015 AAATGAAACTTGGAGAATGATGG + Intronic
1092058794 12:5530853-5530875 AAATGTTCATTGGAGCATTTTGG - Intergenic
1093817667 12:23569285-23569307 AAATGTTTCTTGAAGCACTACGG - Intronic
1096624084 12:52882757-52882779 AAATGATATTTGGAGTATATTGG - Intergenic
1097374253 12:58821811-58821833 CATTCTTACTGGGAGTATTAAGG - Intergenic
1098070089 12:66664543-66664565 ATATGTTTCTTGTTGTATTAAGG - Intronic
1098810096 12:75076768-75076790 AAATGTTACTTTCAGTATCTTGG + Intronic
1099297372 12:80845447-80845469 AAATGTTACTTGGAGTATTATGG + Intronic
1099333381 12:81321507-81321529 AAATGTTATTTTTAATATTATGG + Intronic
1099532794 12:83806362-83806384 AATTTTTACTTGAAATATTAAGG + Intergenic
1099842378 12:87982100-87982122 AAGTGATATTTGGAGTATTAAGG - Intronic
1100930617 12:99605038-99605060 AAAAGTTTCTTGGAGTATTTTGG - Intronic
1100956302 12:99912676-99912698 AAATTTTACTTTGAGTGTTAAGG + Intronic
1102273800 12:111563628-111563650 AAATGTTACTTGAAGAATACAGG + Intronic
1103509103 12:121462068-121462090 TAATGTTATTTGGAGTACTTTGG - Intronic
1105985148 13:25558673-25558695 AAATGTTACGTGTAGAATGATGG + Intronic
1106293508 13:28388666-28388688 AAATGTTAATAGGATTTTTATGG - Intronic
1106513374 13:30430931-30430953 AAATGTTAGGTAGAGAATTAAGG - Intergenic
1106874888 13:34060752-34060774 AAATGTTACTTTGTTTATTGTGG + Intergenic
1108338577 13:49473168-49473190 AAATTTTTCTTGGAATATGAAGG - Intronic
1108889333 13:55233582-55233604 AAATGTTACTGGGAATAAAAAGG + Intergenic
1109774348 13:67020409-67020431 AAATATTGCTTGGATTACTATGG - Intronic
1109902993 13:68797944-68797966 CAATGCTACTAGGATTATTATGG + Intergenic
1110211003 13:72972896-72972918 AAATATTACTTTCAGTTTTAAGG + Intronic
1111280216 13:86012882-86012904 AAGTGTGAATTGGAGTTTTAAGG + Intergenic
1111296449 13:86285105-86285127 AAATGTTATTTGTGGTAATATGG - Intergenic
1111681695 13:91449654-91449676 AAATGTTAATTGGATGTTTAAGG + Intronic
1111691625 13:91570358-91570380 AAATGTTCCTTGGCATATTTTGG + Intronic
1112796645 13:103064349-103064371 AAATGTAACTTGGAGCTTTTAGG + Intronic
1113285782 13:108847516-108847538 AAATGTTAATTAGAGCTTTATGG - Intronic
1114859096 14:26493003-26493025 AAATGTGACTTTGGGTATGAAGG + Intronic
1116579681 14:46623731-46623753 AAATGTTTCCTGGATTTTTATGG + Intergenic
1116749401 14:48864091-48864113 AAATTGTACTTGCATTATTATGG - Intergenic
1116815102 14:49576511-49576533 TAATGGTAATTGGTGTATTAGGG - Exonic
1116825304 14:49667932-49667954 AAATGTTAATGTGATTATTATGG - Intronic
1117314560 14:54561264-54561286 AAATGTTAATTGTAGTATATAGG - Intergenic
1118102245 14:62619753-62619775 AAATGTTACAAGGATTTTTATGG - Intergenic
1118552292 14:66967599-66967621 AAATGTTCACTGGAGTATTTTGG - Intronic
1119750122 14:77071336-77071358 AGATGTAACTTGGAGGATGATGG - Intergenic
1120090265 14:80323733-80323755 TGATGTTATTTGGAGTTTTATGG - Intronic
1120297169 14:82657029-82657051 AAATGTTACTTCAAGAATTGTGG + Intergenic
1120468335 14:84890455-84890477 AAAGTTTACGTGGAGTATCATGG + Intergenic
1120482725 14:85072392-85072414 AAATGTTCCTTGGATTATAATGG - Intergenic
1120708211 14:87766642-87766664 AAATGTTAGTTTGATTATTTAGG + Intergenic
1122013472 14:98773098-98773120 AAATGTTTCATGCAGTATTAGGG + Intergenic
1125598458 15:40902447-40902469 AAAAGCTACTTAGAGTAGTAGGG - Intronic
1126300742 15:47193352-47193374 AAATGCTAATTGGAGCATTTTGG + Intronic
1131965387 15:97836614-97836636 AAATCTTACTTGTGGTATGATGG - Intergenic
1132360400 15:101208142-101208164 AAATGGGATTTGGAGTATCAGGG + Intronic
1134437090 16:14269900-14269922 AAATGTTACTTGAATTATGCAGG - Intergenic
1135624801 16:23984946-23984968 AAATATTATTTGGGGTAATACGG + Intronic
1140336707 16:74113807-74113829 TAATGTTACTGGGAGTATCAAGG - Intergenic
1141235999 16:82217080-82217102 GAATTATATTTGGAGTATTAAGG + Intergenic
1143948066 17:10611561-10611583 AGATGGTACTTGGAGGATTGCGG - Intergenic
1143959356 17:10702051-10702073 AAATGTTAATTGGAGCATTTTGG + Intronic
1146155150 17:30517567-30517589 AAATGTTACTTCCAGTTTTGGGG + Intronic
1146394803 17:32456250-32456272 AAATGTTACTTGGAAGTTTTTGG + Intronic
1148621577 17:49038558-49038580 AAATGTTGCCTGGAGCATTCAGG + Intronic
1149177242 17:53887913-53887935 AAATGTTAATTGGAGCATTTTGG + Intergenic
1150045252 17:61906214-61906236 AAATGCTCATTGGAGCATTAAGG + Intronic
1153345879 18:4025304-4025326 AAATGCTCATTGGAGTATTTTGG - Intronic
1153549740 18:6249508-6249530 TAATGTTACTTGCAACATTATGG - Intronic
1153732859 18:8032613-8032635 AAAGTTTATTTGGAGAATTATGG + Intronic
1153968582 18:10204001-10204023 AAATGTTACTTTGTTTATTGTGG + Intergenic
1156140413 18:34101861-34101883 AAATTTTACTCTGAGTAATATGG - Intronic
1156865430 18:41884158-41884180 AAATATTACTTTAAGTTTTAAGG + Intergenic
1159113712 18:64089559-64089581 AAATGTCATTTGCAGAATTAAGG + Intergenic
1159169815 18:64751505-64751527 AAATGGCATTTGGAGTTTTAGGG - Intergenic
1163612140 19:18307258-18307280 AAATGTTACTTGGTGTTTTTTGG - Exonic
1166645831 19:44530957-44530979 AACTGTTACTTAGGGTATGAGGG + Intergenic
925329598 2:3048271-3048293 AAAGATAAATTGGAGTATTATGG + Intergenic
927764177 2:25789673-25789695 AAATGTTCATTGGAGCATTCTGG + Intronic
928032104 2:27789332-27789354 AAATGTTCATTGGAGTATATTGG - Intronic
929499594 2:42479025-42479047 AAATGCTCATTGGAGTATTTTGG - Intronic
930573433 2:53115197-53115219 AAATGTGATTTGGAGAATTTGGG - Intergenic
930595712 2:53385667-53385689 AAATTATACTTGAAGTTTTAGGG - Intergenic
931183494 2:59927224-59927246 AAATTTTTCTTGGGTTATTAAGG + Intergenic
931495656 2:62804378-62804400 AAATGGTACTGGGACTATTTGGG + Intronic
932033121 2:68210856-68210878 AAATGTTTTTTGGAGCATTTTGG + Intronic
936284562 2:111172322-111172344 AAATCTTAATCTGAGTATTAAGG + Intergenic
939038726 2:137163122-137163144 AAATGTTACTTGGCGGAATGGGG - Intronic
939257587 2:139764580-139764602 AAATGGTACTGGGAATATAATGG - Intergenic
940801646 2:158139496-158139518 AAATGTTATTTTGTGTATTTTGG - Intergenic
941465259 2:165818064-165818086 AAATGTTCCTTGTATTTTTAGGG + Intergenic
941580253 2:167288252-167288274 AAATGTTACATGGGGTTTTGTGG - Intergenic
942435681 2:175972399-175972421 AAATGGTCCTTGGAGCATTTTGG - Intronic
944025513 2:195161818-195161840 AAATGTTATTTGTAATCTTAAGG - Intergenic
944083270 2:195814249-195814271 AAATTATACTTTTAGTATTACGG + Intronic
945594384 2:211774012-211774034 AAATCTCACTTGGACTAGTACGG + Intronic
945613607 2:212038030-212038052 AAATGATACATGGAATGTTATGG - Intronic
945633486 2:212316222-212316244 TTCTGTTACTTGGAGTAGTATGG + Intronic
946972811 2:225114265-225114287 AAATGTTAATTGAATTATCATGG - Intergenic
946997258 2:225408237-225408259 ATATGTTAGTTGTAGTATGAAGG + Intronic
1169545151 20:6642443-6642465 AAATGTTAATTGTATTATTTAGG - Intergenic
1171844386 20:30256217-30256239 AAATTTTAATTTGAGTATTTTGG - Intergenic
1172210457 20:33194404-33194426 AAAGGTTACTAGGAGAATTCAGG - Intergenic
1172796544 20:37543435-37543457 AAATGTTACTTGCAGAATCTAGG + Intergenic
1173128916 20:40368565-40368587 CAAAGGTACTTGGGGTATTATGG - Intergenic
1173550017 20:43926349-43926371 AAATGTGACTTTGAGTTTGATGG + Intronic
1177021324 21:15862301-15862323 AAATGTTCATTGGAGTATCATGG + Intronic
1177166344 21:17609019-17609041 ATATTTTTCTTGAAGTATTAGGG + Exonic
1177826521 21:26090290-26090312 AAATGCTCATTGGAGTATTTTGG - Intronic
1178042893 21:28660401-28660423 AAATGTTAGCTGGAGGATTTGGG + Intergenic
1182909146 22:33966167-33966189 GAAGGTTACCTGGAGAATTAAGG + Intergenic
951605461 3:24429105-24429127 AAATGTAACTTATAGAATTAGGG - Intronic
952259790 3:31728921-31728943 AAATGCTCCTTGGAGTATTTTGG - Intronic
953543990 3:43848145-43848167 GAATGTTAATTGGAGTTTGATGG - Intergenic
953644169 3:44738635-44738657 AAATTTCATTTGGAGTTTTATGG - Intronic
955072763 3:55585465-55585487 GACTGTTAGTTGGATTATTATGG - Intronic
956680248 3:71772596-71772618 AAATGTTACTTGGAAAGTTGAGG + Exonic
956965719 3:74457542-74457564 AAATGTTATTTGTAGTATAGCGG + Intronic
957835268 3:85579638-85579660 AAATGTTACTAAAATTATTAAGG + Intronic
957980297 3:87500927-87500949 AAATGTTACTGCGAGTATAGAGG - Intergenic
959008526 3:101047794-101047816 AAATTTTACTTAGAATTTTAGGG - Intergenic
959388980 3:105749410-105749432 ATATATTCCTTAGAGTATTAAGG + Intronic
959437679 3:106337094-106337116 AAAACTTACTTGGACTCTTAAGG - Intergenic
959699595 3:109286242-109286264 AAATGTTCATTGGAGCATTTTGG - Intergenic
960948640 3:122984108-122984130 GAAGGTTACTCGGAGAATTATGG - Intronic
961425345 3:126841597-126841619 TAATGTTACTTTGAGTACTAAGG - Intronic
961919099 3:130407418-130407440 AAATATTACTTGCAGTAATGTGG + Intronic
961986040 3:131135985-131136007 TACTATTACATGGAGTATTATGG + Intronic
962191372 3:133314537-133314559 AAAAGTGACTTGGAGAATGAGGG - Intronic
962307804 3:134304250-134304272 AAATGTTAATTGGAGTTATCTGG - Intergenic
962719133 3:138156234-138156256 AAAGTTTACTTGGAGAAATAAGG - Intergenic
963425938 3:145123581-145123603 AAATTTTAATTGGAGGTTTACGG - Intergenic
964659960 3:159109355-159109377 AAGAGTTACTTGGAGCCTTAAGG + Intronic
965313305 3:167158877-167158899 AACTGTGGCTTGGAGTAGTATGG + Intergenic
965540975 3:169871100-169871122 AAATGTTTCTTGGACCATTCTGG - Intergenic
965748565 3:171952069-171952091 AAATGCTACTTGTAGAATTTAGG - Intergenic
966061749 3:175765608-175765630 AAATGTTTCTTTCAGTTTTAAGG + Intronic
966426018 3:179780255-179780277 AAAAGTTATTTGGATTATCAAGG + Intronic
967646710 3:191933256-191933278 AAAGGGGACTTGGAGAATTAAGG + Intergenic
970320409 4:14869971-14869993 AAATGTTAATTGTAGATTTAGGG + Intergenic
970503221 4:16700099-16700121 AAATGTTCATTGGAGCATTCTGG - Intronic
970885479 4:20983713-20983735 AACTTTTACTTTGAGTATTAAGG + Intronic
972202260 4:36727933-36727955 AAATATTACTTTGAGATTTATGG - Intergenic
972611104 4:40656459-40656481 AAATGTTCCTATGAGTATCAAGG + Intergenic
972658425 4:41089342-41089364 AAATGTTCATTGGAGCATTTTGG - Intronic
972664916 4:41156129-41156151 AAATGTTACTTGGTGGATAATGG - Intronic
973565716 4:52185122-52185144 AAATGATACTTGCATGATTAAGG + Intergenic
977090367 4:92666860-92666882 AAATGCTACTTGGAACAATAAGG + Intronic
978245769 4:106570869-106570891 AAATGTTAATTAGAATATGAGGG - Intergenic
978749905 4:112234268-112234290 AAATGTTCATTGGAGAATTCTGG - Intronic
981463377 4:145037171-145037193 TGATGTTACCTGGAGTATGAAGG - Intronic
982145845 4:152390594-152390616 AAATTTTATTTTGAGAATTATGG - Intronic
983132587 4:164040702-164040724 AAATAATATTTTGAGTATTAAGG - Intronic
983835859 4:172383089-172383111 AAGTGTTACTTTGACTATTCTGG + Intronic
983945369 4:173580518-173580540 AAATGTGCCTTAGATTATTATGG - Intergenic
983980602 4:173991126-173991148 AAATGTTGTTTGGAATAATACGG - Intergenic
984226522 4:177042123-177042145 AAATGTTTTTTGGAGTGTGATGG - Intergenic
984346521 4:178534870-178534892 AAATGTAACTTGGCCTATTGAGG + Intergenic
985240819 4:187929459-187929481 TGATGTTACTAGGAGGATTATGG + Intergenic
985919665 5:2960327-2960349 AAATGTTATATGAAGTTTTATGG + Intergenic
986318225 5:6605576-6605598 AAATGTTACGTGGAGGTTTCAGG - Intronic
986819663 5:11451513-11451535 AAATGCTCCTTGGAGCATTTTGG + Intronic
986914244 5:12597556-12597578 AGCTGTTACTTGTAGTAATAGGG - Intergenic
988908330 5:35813116-35813138 AAAAGTTAATTTGAGGATTAAGG - Intronic
989311891 5:40028755-40028777 AAATGTTAATGGAAGTATTAAGG + Intergenic
990119475 5:52432227-52432249 AAATGATATTTGGAGAATTTCGG + Intergenic
990420207 5:55624420-55624442 AAAAGTAACATGGAGTAATACGG - Intergenic
990461237 5:56033150-56033172 CAATTTGACTTGAAGTATTAAGG - Intergenic
990811769 5:59733598-59733620 AAATGTTACTTTAAGTAATCTGG + Intronic
991606924 5:68411975-68411997 AAATGTTCCTTGAAATATTCTGG - Intergenic
991650319 5:68845975-68845997 AAATGTTCATTGGAGCATTTTGG - Intergenic
992417675 5:76567299-76567321 AAATGTTCCTTGGAGCATTTCGG + Intronic
992920361 5:81510464-81510486 AAATTTTACTTGGAGTAGGCTGG + Intronic
993063152 5:83065621-83065643 AAATGTTCATTGGAGCATTTTGG + Intronic
994222195 5:97208732-97208754 TTATGTTACTAGGAGGATTATGG + Intergenic
994851600 5:105061073-105061095 AAATATTATTTGGAGGAATAGGG + Intergenic
995084982 5:108097862-108097884 AAATGTTATTCAGAGAATTATGG - Intronic
995305061 5:110636094-110636116 AAATGTCATTTGCAGTAATATGG + Intronic
995940582 5:117577953-117577975 AAATGTTGTTAGGATTATTATGG + Intergenic
996169822 5:120275639-120275661 AAAAATTACTTAGAGTAGTATGG - Intergenic
996385450 5:122905526-122905548 AAATGTTCACTGGAGTATTTCGG + Intronic
996634589 5:125674679-125674701 AAATGCTCATTGGAGTATTTTGG - Intergenic
997011858 5:129887922-129887944 AAAATTCACTTGGTGTATTAAGG + Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
999484869 5:151985381-151985403 TTATGTTCCTAGGAGTATTATGG + Intergenic
1000217659 5:159178678-159178700 AAATGCTTATTGGAGTATTTTGG + Intronic
1000272496 5:159699717-159699739 AAATGATATTTGGGGTACTAGGG + Intergenic
1001864963 5:175095848-175095870 AAAAATTACTTGGGGCATTATGG + Intergenic
1005284115 6:24306054-24306076 AAATGCTACTTGAAATATGAGGG + Intronic
1005289613 6:24366305-24366327 AATTGTAACTTGGAGAAATACGG - Intergenic
1005659402 6:27980084-27980106 AAATGTTACTTGACATATTTTGG - Intergenic
1005659541 6:27982253-27982275 AAATGTTACTTGACATATTTTGG + Intergenic
1008182404 6:48347788-48347810 AAATGTTACTTTGTGTGTTGTGG + Intergenic
1008589174 6:52976100-52976122 AAATCTTCATTGGAGTATTTTGG - Intergenic
1010184353 6:73125634-73125656 AAAGTTCACTTGGTGTATTAAGG + Intronic
1010446236 6:75951696-75951718 AAATGATACTGGGAGTATAAAGG + Intronic
1011786648 6:90854037-90854059 AAATCTTAATTGGGGTATAAAGG - Intergenic
1012538710 6:100333046-100333068 AATTGTTACTTGGATTTTTAAGG - Intergenic
1012696684 6:102392500-102392522 ATATGATTCTTGGTGTATTAAGG - Intergenic
1013700427 6:112762167-112762189 AGATGTTGCCTTGAGTATTATGG - Intergenic
1014846634 6:126285686-126285708 AAATGTTCCTTAGAATATAAGGG - Intergenic
1014903563 6:126999288-126999310 AAATGTTACTGACAGAATTAAGG + Intergenic
1015350655 6:132214563-132214585 AAATGTTTCTTGCAGCATTCTGG + Intergenic
1016268910 6:142265499-142265521 AAATGTTTCTAGGAATATTGAGG + Intergenic
1016659054 6:146554940-146554962 AAATGTTACCTCCAGTCTTATGG + Exonic
1017902330 6:158729143-158729165 AAGTGTTAATTGAAGCATTATGG - Intronic
1018829452 6:167432006-167432028 AAATGATCATTGGAGTATTTTGG - Intergenic
1020565525 7:9789657-9789679 TAATGTTCCTTGGAGAATGAAGG + Intergenic
1020904654 7:14050411-14050433 AAATGTTATGTAGAGAATTAAGG + Intergenic
1021750950 7:23799159-23799181 ACATATTACTTTGAGTAGTATGG - Intronic
1022552772 7:31257273-31257295 AAATGTTTCTTAGAGAATCAAGG + Intergenic
1023563761 7:41503063-41503085 AGATGTTAATTGCAGCATTATGG - Intergenic
1026266925 7:68803355-68803377 AAATGTTACCTGCAGCTTTAAGG - Intergenic
1028740207 7:94266043-94266065 AAATGTTACTAGTAGCTTTAAGG + Intergenic
1029143960 7:98432637-98432659 AAATGTTAATTGTAGAATTCAGG + Intergenic
1030490940 7:110233562-110233584 AAAGGTTACGTGGAATATGATGG - Intergenic
1030545178 7:110885247-110885269 AAATGTTCATTGGAGTATTTTGG - Intronic
1030692518 7:112550740-112550762 AAATGTGGCTTGGGGAATTAGGG - Intergenic
1030794883 7:113775757-113775779 AGATGTTACTTGCAATAGTAAGG - Intergenic
1031998943 7:128252231-128252253 AAATGTTTCTTGGACTATCTGGG - Intronic
1033624799 7:143098865-143098887 AAATTTTATCTGTAGTATTATGG - Intergenic
1037574725 8:20191003-20191025 AAAGGATACTTGGAGTTTCAAGG + Intergenic
1037713232 8:21372556-21372578 AAAAGTGACTTGCAGCATTAAGG + Intergenic
1040464691 8:47683657-47683679 AAATGCTCTTTGGAGTATTTTGG - Intronic
1042112380 8:65394447-65394469 AAATATTAATTTAAGTATTATGG + Intergenic
1042580823 8:70277571-70277593 TAATGTTAATAGCAGTATTAAGG + Intronic
1043385269 8:79742190-79742212 AAATGTTACTTGGGGAACTCGGG - Intergenic
1044643176 8:94407430-94407452 AAATCTTACTTGGCGTATATGGG + Exonic
1045122189 8:99050045-99050067 AAATTATACTTTGAGTTTTAGGG + Intronic
1046543568 8:115618556-115618578 AAATGTTATTTTAAGTATTAGGG - Intronic
1047800870 8:128308393-128308415 ATATGTTACTTATATTATTATGG + Intergenic
1050251495 9:3749571-3749593 GAATGTTACCTGGGGTATTTAGG - Intergenic
1051103514 9:13550508-13550530 AATTGTTATTTGGAATATTTAGG + Intergenic
1051500806 9:17775803-17775825 AGATGTGACTTGGAGTACTGTGG + Intronic
1052321056 9:27168053-27168075 AAATGTTCATTGGAGCATTTTGG + Intronic
1052394060 9:27916261-27916283 AAATGTTTCTCGGAGGATGATGG - Intergenic
1052716066 9:32118799-32118821 AAACGTTACCTAAAGTATTAGGG + Intergenic
1054958371 9:70939504-70939526 AACTGTTCCTTGAAGCATTAAGG - Intronic
1055763119 9:79631463-79631485 AAATATTACTTGTATTACTAAGG + Intronic
1058358847 9:104117723-104117745 AAATGCTCATTGGAGTATTTTGG + Intronic
1058808711 9:108618175-108618197 AAATGTGATTTAGTGTATTAAGG - Intergenic
1059113961 9:111584094-111584116 ACATCTTACTTGGGGTAATACGG - Intronic
1059145419 9:111895863-111895885 AAATGTCACTTTGGGTAGTAAGG - Intergenic
1059203170 9:112437855-112437877 GAATTTTACTTTGAGTCTTATGG + Intronic
1185800953 X:3010239-3010261 AAAGGTCACTCAGAGTATTAGGG + Intronic
1186726156 X:12361302-12361324 AAATTTCAGTTGGAATATTAAGG + Intronic
1187956839 X:24527443-24527465 AAATATTAGTTGGATTTTTATGG - Intronic
1193506010 X:82346246-82346268 AAATGTTTTTTGTAATATTATGG - Intergenic
1193652922 X:84160667-84160689 AAATGATTCTTGGATTTTTAGGG - Intronic
1193751057 X:85344181-85344203 ACATGTGACAAGGAGTATTATGG - Intronic
1194316922 X:92388833-92388855 AAAGGTTATTTTGAGCATTATGG + Intronic
1194402424 X:93455309-93455331 AAAAATTACTTTTAGTATTATGG + Intergenic
1194996135 X:100593356-100593378 AAATGTTTCCTGGAGTTTAAGGG + Intronic
1195497302 X:105551722-105551744 AAATGTAACCTGGATAATTAGGG - Intronic
1196183046 X:112715921-112715943 CATTTTTACTTGGAGTAATAGGG + Intergenic
1196366384 X:114928853-114928875 AAATGTTACTTTGTTTGTTATGG + Intergenic
1196899735 X:120370977-120370999 AAATGGTACTTGGCAAATTATGG + Intronic
1197295590 X:124715506-124715528 AGTGGTTACTTGGATTATTATGG + Intronic
1197408336 X:126084012-126084034 TACTGATACTTGGAGTATCATGG - Intergenic
1197688086 X:129465425-129465447 AAATGTTAATTGGAGAATCTAGG + Intronic
1198842702 X:140876171-140876193 AAATGTTCATTGGAGCATTTTGG - Intergenic
1199220437 X:145310424-145310446 AATTGGTACTTGGAGTAGTAGGG - Intergenic
1200625098 Y:5502153-5502175 AAAGGTTATTTTGAGCATTATGG + Intronic
1201263838 Y:12186953-12186975 AAATTTTACTTTAAGTTTTATGG - Intergenic
1201903027 Y:19062851-19062873 AAATAAGACTTGGAGTCTTAAGG + Intergenic