ID: 1099307736

View in Genome Browser
Species Human (GRCh38)
Location 12:80979198-80979220
Sequence TAGAATAGTAAAGCTGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099307736 Original CRISPR TAGAATAGTAAAGCTGTACC AGG (reversed) Intronic
904550997 1:31317762-31317784 TGGAATAGTATAGGTGTATCTGG - Intronic
907607383 1:55831746-55831768 TAGAACAGTAGAGATGTACATGG - Intergenic
909116440 1:71543088-71543110 TAAAATAGTAAAACAGTTCCTGG - Intronic
911472557 1:98336180-98336202 TAGAAAATTAAATCTGTAGCTGG - Intergenic
912192669 1:107357881-107357903 TAGAATATTAAAGTTGCACTTGG + Intronic
918274820 1:182943792-182943814 TAGAATCAAATAGCTGTACCAGG + Intronic
918630997 1:186718417-186718439 TTGAATAGTAAAGCTGAATAAGG + Intergenic
920019132 1:202940644-202940666 TAAAAAAGTAAAGCTGTATTGGG + Intergenic
921321161 1:213940511-213940533 TAGAATAGTCAGGCTTTTCCTGG + Intergenic
921644769 1:217601449-217601471 ATTAGTAGTAAAGCTGTACCTGG + Intronic
1063888393 10:10603174-10603196 TACACTATTAAAGCTCTACCAGG - Intergenic
1064887836 10:20131698-20131720 TAGAATAATAAAACTGTAAGTGG - Intronic
1065130656 10:22616466-22616488 TTAAACAGTAGAGCTGTACCTGG + Intronic
1069252945 10:66294527-66294549 TAAAATAGAAAAGCTGAAACAGG + Intronic
1069273620 10:66562418-66562440 TGGAAAAGTAAAGCTGGACTTGG - Intronic
1069282095 10:66667771-66667793 TAGAATATTTAAGCTGTGCTGGG - Intronic
1069825303 10:71251390-71251412 TACAATAGAAACGCTGTACATGG + Intronic
1074437958 10:113450590-113450612 TAGTAGAGGAAAGCTGTCCCAGG - Intergenic
1077637237 11:3851598-3851620 TAGAATATTAAAGCTGCACTGGG + Intergenic
1078287693 11:9974476-9974498 TAGAATAGGAAATCTCTATCTGG - Intronic
1078752917 11:14181980-14182002 TAGAATTGTCAAGGGGTACCTGG + Intronic
1079151441 11:17903363-17903385 TAGAATACTAAAGCTGGCCTGGG + Intronic
1079594169 11:22221570-22221592 TACAATATAAAAGCTATACCTGG - Intronic
1087397129 11:97613496-97613518 TACAATAGAAAAGTTGTACAAGG - Intergenic
1088364064 11:109020383-109020405 TTGAAAAGTAAAGCTGGAACAGG - Intergenic
1092599893 12:10048885-10048907 TAGAATAGTAAATCCTTTCCAGG + Intronic
1093918217 12:24829804-24829826 AAGAAAAGAAAAGCTTTACCTGG + Exonic
1095342028 12:41101355-41101377 TATAATACTACAGTTGTACCTGG - Intergenic
1099307736 12:80979198-80979220 TAGAATAGTAAAGCTGTACCAGG - Intronic
1110359564 13:74609997-74610019 TAATACAGTAAATCTGTACCTGG + Intergenic
1116271072 14:42767455-42767477 AAAAATAGTAAAGCTCTACCAGG - Intergenic
1116298255 14:43140796-43140818 TAGAATAGTAATTCTGCTCCAGG - Intergenic
1116964492 14:51000097-51000119 TAGAATAGGGAAGCTATAACAGG + Intronic
1118411754 14:65486881-65486903 TAGAAAAGTAAAGCTTTCTCTGG - Intronic
1124063971 15:26322493-26322515 TATAATAAAAAAGCTGTACAAGG + Intergenic
1125243946 15:37612176-37612198 TAAAATGGTACAGCTGTTCCAGG - Intergenic
1126511915 15:49486866-49486888 TAGAATATTAAAACTGTAAGGGG + Exonic
1126536697 15:49774264-49774286 TGGAATAGTAGAGCTGTATGGGG + Intergenic
1126670498 15:51111293-51111315 TGGAATAGTAGAGCTGTCACTGG - Intergenic
1130196660 15:81785787-81785809 TAGAATACTAAAGCCCGACCTGG + Intergenic
1131352999 15:91718563-91718585 TACAATAGTAAAGCAGGAACAGG - Intergenic
1131355833 15:91745357-91745379 TAAAATAGTGAAACTGTACAAGG + Intergenic
1133253096 16:4497533-4497555 TATAATAGGAAGGCTCTACCAGG + Intronic
1135062314 16:19281303-19281325 TAGAATCCTAAAGCTGAACCTGG + Intergenic
1136739733 16:32506546-32506568 TAGAATAGTAAAGGGATACTTGG - Intergenic
1137219436 16:46432426-46432448 AAGAATAGTAAAACTTTACAGGG - Intergenic
1137644923 16:50065808-50065830 TAGAATAGTAACGCCGACCCGGG - Intergenic
1139743517 16:69055736-69055758 TTGAAAAGTAAAGCTGAGCCAGG + Intronic
1141417265 16:83885538-83885560 CAGAATAGTAAAGCTGCAGAAGG + Intergenic
1203013182 16_KI270728v1_random:320791-320813 TAGAATAGTAAAGGGATACTTGG + Intergenic
1203031517 16_KI270728v1_random:593950-593972 TAGAATAGTAAAGGGATACTTGG + Intergenic
1203040204 16_KI270728v1_random:740481-740503 TAGAATAGTAAAGGGATACTTGG - Intergenic
1144243782 17:13341600-13341622 AATAATAGTAAAGCTATACAAGG + Intergenic
1146024944 17:29311995-29312017 TAGAACAGAAAAGTTTTACCTGG + Intergenic
1147728679 17:42582862-42582884 CTGATTAGTAAAGCTGTACCTGG - Intronic
1148797698 17:50205010-50205032 TAGAAGAGCAGAGCTGTACCTGG - Intergenic
1153194917 18:2583822-2583844 TAGAATAGGAAAGGGGTAGCAGG + Intronic
1156100121 18:33583743-33583765 TAGACTTGTAGAGTTGTACCTGG + Intronic
1156412319 18:36842588-36842610 CAGAATAGTAAAACTGTGGCTGG - Intronic
1156541074 18:37911097-37911119 TAGAATAGGAAAGCTGAGCCTGG - Intergenic
1159511038 18:69399336-69399358 TGGAATAGACAAGCTGTGCCAGG + Intergenic
1159989959 18:74893386-74893408 CAGAATGGTGAAGCTGTCCCAGG - Intronic
1161872197 19:6878767-6878789 TACAATAATAAAACTGTGCCTGG - Intergenic
925996425 2:9297167-9297189 GAGAAAAGTCAAGCTGCACCAGG - Intronic
930464533 2:51730911-51730933 CAGGATTGTTAAGCTGTACCAGG + Intergenic
931276640 2:60749647-60749669 AAGAATAGGAAAGTTGTAGCTGG + Intergenic
931341735 2:61408478-61408500 TAGAATTGTAAAGCTGGAGGAGG - Intronic
931775167 2:65534137-65534159 TAGACTAGTAAAGAAGTCCCAGG + Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932830345 2:74983473-74983495 CATAATAATAAAGTTGTACCTGG - Intergenic
936619241 2:114077702-114077724 TAGAATACTAAAGCTGTAAACGG - Intergenic
939456913 2:142449282-142449304 TTGAATAATAATCCTGTACCTGG - Intergenic
942522345 2:176817649-176817671 TACCATAGTAAAACTATACCTGG - Intergenic
942644705 2:178097231-178097253 TAGTATAGTAAATTGGTACCAGG - Intronic
947683238 2:232055998-232056020 TAGAACAGTAAAGCTTTTCAAGG + Intronic
1172114705 20:32566778-32566800 GAGAAAAGTAAAGCAGAACCAGG - Intronic
1173580819 20:44145307-44145329 CTGAAAAGTAAAGCTGGACCAGG + Intronic
950589209 3:13923970-13923992 TAACACAGTAAATCTGTACCAGG + Intergenic
952141050 3:30479630-30479652 TAATATAGTAAATTTGTACCAGG + Intergenic
958732483 3:97973775-97973797 TAGAATAATATTGCTGTTCCCGG + Intergenic
958768965 3:98403345-98403367 TAGTATAGAAAAAATGTACCTGG + Intergenic
960775288 3:121243936-121243958 TAAAATATGAAAGCTGTTCCTGG - Intronic
962223654 3:133586027-133586049 TAGATTACTAAAGTTGTACGTGG + Intronic
962226317 3:133613154-133613176 TAAAATAGTTAAGCAGGACCAGG - Intronic
965956969 3:174382364-174382386 TTCATTAGTAAATCTGTACCAGG + Intergenic
966427338 3:179793381-179793403 TTCACTAGTAAAGCTGGACCTGG - Intergenic
968774288 4:2530493-2530515 TAAAATAATAAAGTTGGACCGGG + Intronic
974455665 4:62126794-62126816 TTGAATAGTAATTCTATACCTGG - Intergenic
977570659 4:98626223-98626245 TAGAATACATAAGATGTACCTGG - Intronic
977907709 4:102497697-102497719 TAGAATAGTAACACTGTAACTGG - Intergenic
978649991 4:110990662-110990684 ATAAATAGTAAAGCTGCACCTGG - Intergenic
979205869 4:118037294-118037316 TAGAATAGTTACCTTGTACCAGG + Intronic
980533139 4:134080314-134080336 TATAATAGCAAAGCTGTATAAGG - Intergenic
982309499 4:153970023-153970045 TCAAATAGTACAGCTGTGCCTGG + Intergenic
982512283 4:156298075-156298097 TGAAATAGTAAATCTGTAACAGG + Intergenic
984395046 4:179186969-179186991 TACAATACTAAAGCTTTACATGG + Intergenic
984452871 4:179925909-179925931 TAGAAGAGAAAAGCTAAACCAGG + Intergenic
987171408 5:15262222-15262244 TAGAATAATAAAACTGTATCAGG + Intergenic
988259390 5:28864346-28864368 TAGAATGGTAATGATGTACTAGG - Intergenic
990040046 5:51368957-51368979 AAGGAAAGTAAAGCTGTAACTGG - Intergenic
992509330 5:77417766-77417788 TAGAAGAGTAAAAGAGTACCAGG - Intronic
994702563 5:103155296-103155318 TAAAAATGTAAAGCTGTAACAGG - Intronic
997026345 5:130066612-130066634 TAGGTTAGTAAAGCTTTACTTGG + Intronic
999916033 5:156262226-156262248 TAAAATGGTATAGCTGTACAGGG - Intronic
1002669507 5:180855328-180855350 TAGGATGGCAAAGCAGTACCTGG - Intronic
1003958344 6:11186914-11186936 TAGAAAAGTAAAGCTGTTGAAGG - Intronic
1005714903 6:28537675-28537697 GAGAATAGTAAAACTGCTCCAGG - Intergenic
1007139812 6:39560525-39560547 TAGAAAAGCAAAGCTGGACAGGG - Intronic
1010363531 6:75022921-75022943 TATAATAGTATACCTGAACCTGG - Intergenic
1011751168 6:90456579-90456601 TAAAATAGTAGAGCTATGCCAGG + Intergenic
1013796726 6:113896692-113896714 TAGAAATGTAAAGTGGTACCTGG - Intergenic
1014079903 6:117273892-117273914 GAAAATAATAAATCTGTACCAGG - Intergenic
1019942222 7:4300579-4300601 TAGCAGAGTAAAGTTGTAGCTGG + Intergenic
1020408748 7:7866853-7866875 TAGGGTAGTAAAGCTGTACATGG + Intronic
1020550644 7:9599721-9599743 TAGAATAGTATAACTGTATGAGG - Intergenic
1022486303 7:30780938-30780960 AAGAATAGTAAAACTGTCCCGGG + Intronic
1024133420 7:46380922-46380944 TAGAATGGTAAATCTTTTCCAGG - Intergenic
1024918557 7:54531726-54531748 TACCATAGTATAGCTCTACCTGG + Intergenic
1025527235 7:61830207-61830229 TAGAATAGTAAAGGGATACTTGG - Intergenic
1033179459 7:139161440-139161462 TAGAACAGTAAATTTGTACTGGG + Intronic
1035703688 8:1657590-1657612 TAGAATTGTAAATCTCTACATGG - Intronic
1037487757 8:19364512-19364534 TGAAATAGTAAAGCTGTGCATGG + Intronic
1043626032 8:82259686-82259708 TAGTAAAATAAAGCTGTACAAGG - Intergenic
1045941875 8:107748549-107748571 TAGAAAAGGAAAGCTGATCCCGG - Intergenic
1048180021 8:132185872-132185894 TGGAATAGCAAAGCTTTACCAGG + Intronic
1048726256 8:137388297-137388319 TAGTATAGTAAATTGGTACCAGG - Intergenic
1051472401 9:17460312-17460334 TAGTATAGGAAAGCTGTAACAGG + Intronic
1051754771 9:20386949-20386971 TAGAATAGTAGAATTTTACCAGG - Intronic
1052782673 9:32796871-32796893 TAACATAGTAAATTTGTACCAGG - Intergenic
1054829956 9:69613423-69613445 TTCAAGAGGAAAGCTGTACCTGG - Intronic
1057747021 9:97760599-97760621 GATAATAATAGAGCTGTACCAGG - Intergenic
1188575421 X:31644065-31644087 TAGAATAATAAAGCTCTGCCAGG + Intronic
1190138012 X:47815089-47815111 GAGAAGAGTAAAGCTGTAAGCGG + Intergenic
1192859758 X:75054795-75054817 AGGAAAAATAAAGCTGTACCAGG - Intronic
1193862212 X:86683439-86683461 TAGCCTAGTAAAGCCGTATCTGG + Intronic