ID: 1099309261

View in Genome Browser
Species Human (GRCh38)
Location 12:80997169-80997191
Sequence GTGCTTACCTAAGATTATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 713
Summary {0: 1, 1: 0, 2: 2, 3: 94, 4: 616}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099309261 Original CRISPR GTGCTTACCTAAGATTATAA TGG Intronic
901365155 1:8741145-8741167 GTGGTTCCATGAGATTATAATGG - Intronic
902369445 1:15996575-15996597 GTGGTCCCATAAGATTATAATGG - Intergenic
903076674 1:20774543-20774565 GTGGTCCCTTAAGATTATAATGG + Intronic
903851350 1:26308336-26308358 CGGCTTGCATAAGATTATAAAGG + Intronic
904491384 1:30861849-30861871 GTGATCTCATAAGATTATAAGGG + Intergenic
906433716 1:45777210-45777232 GTGGTCCCGTAAGATTATAAAGG + Intergenic
906446759 1:45906255-45906277 GTGATCCCATAAGATTATAAAGG + Intronic
906547570 1:46631506-46631528 GTGGTCCCATAAGATTATAATGG - Intergenic
906771059 1:48484540-48484562 GTGCTTATCTGAGAATATAAAGG - Intergenic
906796977 1:48705052-48705074 GTGGTCCCATAAGATTATAATGG - Intronic
906920241 1:50056391-50056413 GAGGTCCCCTAAGATTATAATGG + Intronic
907500169 1:54873189-54873211 GTGGTCTCATAAGATTATAATGG + Intronic
908500284 1:64736576-64736598 GTGGTCCCATAAGATTATAATGG + Intergenic
909221838 1:72973483-72973505 GTGGTTCCATAAGATTACAATGG + Intergenic
909473881 1:76060536-76060558 GTGGCTCCATAAGATTATAATGG + Intergenic
910667159 1:89738344-89738366 GTGGTCCCATAAGATTATAATGG - Intronic
910994137 1:93086103-93086125 GTGGTCCCATAAGATTATAATGG - Intronic
911061781 1:93754584-93754606 GTGGTCCCATAAGATTATAATGG + Intronic
911135455 1:94434581-94434603 GTGGTCCCATAAGATTATAATGG - Intronic
911211253 1:95140367-95140389 GTGGTCTCATAAGATTATAATGG - Intronic
911297890 1:96139925-96139947 GTACATTCCTAAGAATATAAGGG + Intergenic
911327503 1:96485622-96485644 GTGGTCCCATAAGATTATAATGG + Intergenic
912539417 1:110402028-110402050 GTGGTCCCGTAAGATTATAATGG + Intronic
912885737 1:113471803-113471825 GTGGTCCCATAAGATTATAATGG - Intronic
914789467 1:150864241-150864263 GTGGTCCCATAAGATTATAATGG - Intronic
915369870 1:155339934-155339956 GTGATCCCGTAAGATTATAATGG - Intronic
915621320 1:157086771-157086793 GTGGTCCCATAAGATTATAATGG + Intergenic
917402131 1:174661763-174661785 GTGGTCCCATAAGATTATAATGG + Intronic
918278439 1:182978444-182978466 GTGGTCTCATAAGATTATAATGG - Intergenic
919002598 1:191852759-191852781 GTGGTCCCATAAGATTATAATGG - Intergenic
919014262 1:192010225-192010247 GTGGTTCCATAAGATTAAAATGG - Intergenic
919119962 1:193326980-193327002 GTGTTCCCATAAGATTATAATGG + Intergenic
919966977 1:202537405-202537427 GTGGTTGCATAAGACTATAATGG - Intronic
920153421 1:203928366-203928388 GTGGTTCCATAAGATTAGAACGG - Intergenic
920967113 1:210710568-210710590 GTGGTTCCATAAGATTATAATGG - Intronic
921479369 1:215646482-215646504 GTGGTTCCATAAGATTATAATGG + Intronic
921695967 1:218210519-218210541 GTGGTCCCATAAGATTATAATGG - Intergenic
923168892 1:231394730-231394752 GTACTTACCTGAGATAATTAAGG + Intronic
923925546 1:238623097-238623119 GTGGTCCCATAAGATTATAATGG + Intergenic
924359099 1:243217156-243217178 GTGGTACCATAAGATTATAATGG - Intronic
1062851989 10:751098-751120 GTGCTTAGCTAAGATGGAAAAGG - Intergenic
1063763498 10:9109135-9109157 GTGGTCTCATAAGATTATAATGG - Intergenic
1064234263 10:13559456-13559478 GTGGTCCCATAAGATTATAATGG - Intergenic
1064920277 10:20509264-20509286 GTGTTCCCATAAGATTATAATGG + Intergenic
1065063921 10:21939461-21939483 GTGGTTCCCTAAAATTATAATGG + Intronic
1065194218 10:23246633-23246655 GTGGTCCCATAAGATTATAATGG + Intergenic
1065763336 10:29003787-29003809 GTGGTTCCATAAGATTGTAATGG + Intergenic
1066169996 10:32832083-32832105 GTGATTCCGTAAGATTGTAAAGG - Intronic
1066178910 10:32940558-32940580 GTGGTCCCATAAGATTATAACGG - Intronic
1066433717 10:35377076-35377098 GTGGTCCCATAAGATTATAATGG + Intronic
1067826276 10:49575829-49575851 GTGGTCCCATAAGATTATAATGG - Intergenic
1068285734 10:54932037-54932059 GTGATTCCATAAGATAATAATGG + Intronic
1068546442 10:58351902-58351924 GTGGTCACATAAAATTATAATGG - Intronic
1068638279 10:59372299-59372321 GTGGTTCCATAAGATTATAATGG - Intergenic
1068742655 10:60491999-60492021 GTGGTCCCATAAGATTATAATGG + Intronic
1069207155 10:65704975-65704997 GTGGTTCCATAAGATTATAATGG - Intergenic
1069211281 10:65762578-65762600 GTGGTTCCATAAGATTATAATGG - Intergenic
1069224062 10:65919659-65919681 ATGCTTTCTTAACATTATAAAGG - Exonic
1069443714 10:68453565-68453587 GTGGTCCCATAAGATTATAATGG + Intronic
1070470106 10:76770424-76770446 GTGATTCCATAAGATTATAGTGG + Intergenic
1071356627 10:84802956-84802978 GTGGTCCCATAAGATTATAATGG + Intergenic
1071446825 10:85756172-85756194 GTGCTTAGTTAAGATGAAAAGGG - Intronic
1071892250 10:90023082-90023104 GTGGTTCCATAAGATTATAATGG - Intergenic
1071952624 10:90722546-90722568 GTGGTCCCATAAGATTATAATGG - Intergenic
1071959366 10:90794949-90794971 GTGGTTCCATAAGATTATGATGG - Intronic
1072289853 10:93953897-93953919 GTGGTCCCATAAGATTATAATGG + Intronic
1072386152 10:94930358-94930380 GTTGTTCCATAAGATTATAATGG - Intergenic
1072931841 10:99671530-99671552 GTGGTCCCATAAGATTATAATGG - Intronic
1072998049 10:100264029-100264051 GTGGTCCCATAAGATTATAATGG + Intronic
1073032909 10:100542175-100542197 GTGCTCCCATAAGATTATGATGG - Intronic
1073866118 10:107806126-107806148 GTGCTTATCTAGGATTACACAGG - Intergenic
1073961612 10:108937364-108937386 GTGGTCCCATAAGATTATAATGG + Intergenic
1073992740 10:109281779-109281801 GTGGTTCCATAATATTATAATGG - Intergenic
1075163682 10:120046873-120046895 GTGGTCCCATAAGATTATAATGG - Intergenic
1077614774 11:3666921-3666943 ATGCTTACCTGAGTTAATAAAGG + Intronic
1077966843 11:7143424-7143446 GTGGTGTCATAAGATTATAATGG + Intergenic
1078411211 11:11120636-11120658 GTGGTTCCATAAGATTACAATGG + Intergenic
1078623606 11:12932625-12932647 GTGCTCCCATAAGATGATAATGG + Intronic
1078749680 11:14148981-14149003 GTGGTCCCTTAAGATTATAATGG + Intronic
1079118930 11:17663705-17663727 GTGGTCCCATAAGATTATAATGG - Intergenic
1079593002 11:22204209-22204231 GTGCTTATCTATGACTATACTGG + Intronic
1079721639 11:23822252-23822274 GTGCCTAGCTAAGATCTTAAGGG + Intergenic
1080480629 11:32645840-32645862 GTGGTCCCATAAGATTATAATGG - Intronic
1081004253 11:37714574-37714596 GTGGATCCATAAGATTATAATGG - Intergenic
1081071816 11:38619598-38619620 GTGGTTCCATAAAATTATAATGG + Intergenic
1081071908 11:38621321-38621343 GTGGTTCCATAAAATTATAATGG - Intergenic
1084344119 11:68532586-68532608 GTGCTCCCATAAGATTATAATGG + Intronic
1085084812 11:73659966-73659988 GTGGTTCCATAAGATTATAATGG + Intronic
1085180379 11:74530376-74530398 GTGATTCCATAAGATTATAATGG + Intronic
1085191360 11:74626798-74626820 GTGGTCTCGTAAGATTATAATGG + Intronic
1087114081 11:94504952-94504974 GTGATCTCATAAGATTATAATGG + Intergenic
1087317951 11:96626383-96626405 TTGATTAGCTAAGATTACAATGG - Intergenic
1087324351 11:96702608-96702630 GTGCTGTCCTAAGATGAGAAAGG + Intergenic
1087345657 11:96967854-96967876 GTGATCACATAAGATTGTAATGG - Intergenic
1087438129 11:98149067-98149089 GTGGTCTCCTAAGATTATAATGG - Intergenic
1087494165 11:98867838-98867860 GTGCTTTGCTCAGAGTATAATGG - Intergenic
1087872005 11:103306612-103306634 GTGCTTGCTTAAAATTATAAAGG - Intronic
1088198266 11:107299906-107299928 GTGGTTTCATAAGATTATAATGG - Intergenic
1088744072 11:112790477-112790499 GTGGTCTCATAAGATTATAATGG - Intergenic
1088944633 11:114496777-114496799 GTGGTCTCTTAAGATTATAATGG + Intergenic
1089123398 11:116158846-116158868 GTGATTCCGTAAGACTATAATGG + Intergenic
1089476061 11:118763457-118763479 GTGTTCCCATAAGATTATAATGG - Intronic
1089651149 11:119914081-119914103 GTCCTGAGCTCAGATTATAAAGG + Intergenic
1090153645 11:124412963-124412985 GTAGTCCCCTAAGATTATAATGG - Intergenic
1090218335 11:124991672-124991694 GAGCTAACCTAAGAATATAGTGG + Intronic
1090704202 11:129321745-129321767 TTGCCTACCTATGATTAGAAAGG - Intergenic
1090784870 11:130040373-130040395 GTGGTCACGTAAGATTATAGAGG + Intergenic
1091210963 11:133859950-133859972 GTGCTTAGTTAAGATGAAAAAGG - Intergenic
1091767026 12:3128057-3128079 GTGGTCCCCTAAGATTACAACGG - Intronic
1092786495 12:12031677-12031699 GTGGTCCCATAAGATTATAATGG - Intergenic
1093008292 12:14076275-14076297 GTGGTCACATAACATTATAACGG + Intergenic
1093104355 12:15068001-15068023 GTGGTCCCATAAGATTATAATGG + Intergenic
1093439086 12:19172294-19172316 GTAGTCCCCTAAGATTATAATGG - Intronic
1093574559 12:20711970-20711992 GAGCTTACATAAGAGTAAAATGG + Intronic
1093956372 12:25223990-25224012 GTGGTCCCATAAGATTATAATGG + Intronic
1095054581 12:37583952-37583974 GTGCTTAGTTAAGATGAAAAAGG + Intergenic
1095197465 12:39337761-39337783 GTGGTTTCATAAGATTATAGTGG + Intronic
1096452869 12:51759085-51759107 GTGATACCATAAGATTATAATGG + Intronic
1097790386 12:63809263-63809285 GTGGTCCCATAAGATTATAATGG + Exonic
1098351455 12:69566083-69566105 GTGGTTCCCTGAGATTACAAGGG - Intronic
1099309261 12:80997169-80997191 GTGCTTACCTAAGATTATAATGG + Intronic
1099322153 12:81163300-81163322 GTGGTCCCATAAGATTATAATGG + Intronic
1099704059 12:86128176-86128198 GTGATCCCATAAGATTATAATGG - Intronic
1100012882 12:89974862-89974884 GTAGTTCCATAAGATTATAATGG - Intergenic
1100338228 12:93653340-93653362 GTGATCGCATAAGATTATAATGG + Intergenic
1100419855 12:94422455-94422477 GTGGTACCATAAGATTATAATGG - Intronic
1100456975 12:94761670-94761692 GTGGCTCCTTAAGATTATAATGG + Intergenic
1100625919 12:96331972-96331994 GTGGTCTCATAAGATTATAATGG + Intronic
1100692557 12:97054024-97054046 GTGGTCCCATAAGATTATAATGG + Intergenic
1100705101 12:97192067-97192089 GTGGTTCCATAAGATGATAATGG + Intergenic
1100967254 12:100026523-100026545 GTGGTCCCATAAGATTATAATGG - Intergenic
1101555219 12:105802612-105802634 GTGGTCCCATAAGATTATAATGG + Intergenic
1101637777 12:106560308-106560330 GTGGTTCCATAAGATTATGATGG - Intronic
1102939477 12:116926589-116926611 GTGCTTGCCTAAAAAAATAATGG - Intronic
1103178706 12:118888703-118888725 GTGGTTCCGTAAGATTATAATGG - Intergenic
1104115284 12:125743953-125743975 GTGGTCCCCTAAGATTATAGTGG + Intergenic
1104194638 12:126522507-126522529 GTGCTCCCATAAGATTATAATGG - Intergenic
1104204395 12:126623370-126623392 GTGGTCCCATAAGATTATAATGG - Intergenic
1104521357 12:129478394-129478416 GTGGTTCCGTAAGGTTATAATGG - Intronic
1105374221 13:19828918-19828940 GTGGTCCCCTAAGAGTATAATGG + Intronic
1105760175 13:23507005-23507027 GTGGTCCCATAAGATTATAATGG + Intergenic
1106232893 13:27835102-27835124 GTGGTCTCATAAGATTATAATGG + Intergenic
1106425202 13:29622053-29622075 GTGGTTCCATAAGATAATAATGG - Intergenic
1106806329 13:33311353-33311375 GTGTTTCCATAAGATTATAATGG - Intronic
1107747733 13:43529598-43529620 GTGCTTACTTAAGATACAAAAGG + Intronic
1108077236 13:46693996-46694018 CTGTTTACCTGAGATTATCATGG + Intronic
1108583393 13:51846302-51846324 GTGGTTCCTTAAGATTATAATGG + Intergenic
1109454150 13:62561529-62561551 GTGGTCCCTTAAGATTATAAAGG + Intergenic
1109547832 13:63850174-63850196 GTGGTTCCATAAGATTGTAATGG - Intergenic
1109897910 13:68718505-68718527 GTGGTTACATAAGGTTATAATGG + Intergenic
1109966374 13:69703176-69703198 GTGGTCCCATAAGATTATAATGG + Intronic
1110435506 13:75473933-75473955 ATTCTAACCTAAAATTATAATGG + Intronic
1110717137 13:78718816-78718838 ATGGTCCCCTAAGATTATAATGG - Intergenic
1110994933 13:82095652-82095674 CTGCTCCCATAAGATTATAATGG - Intergenic
1111591887 13:90358368-90358390 GTGGTTCCATAAGATTATACTGG + Intergenic
1111961706 13:94818192-94818214 CTGGTTCCCTAAGGTTATAAAGG + Intergenic
1112470521 13:99684376-99684398 GTGCTCCCATAAGATTATACTGG - Intronic
1112514011 13:100036348-100036370 GTGGTCGCATAAGATTATAATGG - Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1113740014 13:112705091-112705113 ATGGTTACCTAATATTTTAATGG - Intronic
1114214954 14:20650245-20650267 GTGGTCCCATAAGATTATAATGG + Intergenic
1114382157 14:22218492-22218514 GTGCTCCCATAATATTATAATGG - Intergenic
1114463863 14:22906438-22906460 GTGGTCCCATAAGATTATAACGG + Intronic
1115272828 14:31573207-31573229 GTGGTGACATAAGATTATAATGG - Intronic
1115375126 14:32666041-32666063 GTGTTTACTTAAAATTCTAATGG - Intronic
1115659665 14:35480253-35480275 GTGGTCCCATAAGATTATAATGG + Intergenic
1116020690 14:39456619-39456641 GTGGTCCCATAAGATTATAATGG + Intergenic
1116700916 14:48240763-48240785 GTGGTCCCATAAGATTATAATGG - Intergenic
1117184395 14:53226071-53226093 GAGCTTCCTTAAGATTATTAGGG + Intergenic
1117863306 14:60116458-60116480 GTGGTTTCATAAGATTATTATGG + Intronic
1117886091 14:60364488-60364510 CTGCTTACCTAAAACTATATGGG + Intergenic
1118505453 14:66406139-66406161 TTGCTTTCCTAAAATTATATAGG + Intergenic
1118856034 14:69623294-69623316 GTGGTTCCATAAGATTATAATGG + Intronic
1119374282 14:74176673-74176695 GTGGTCCCATAAGATTATAATGG - Intronic
1120408097 14:84114868-84114890 GTGATGCCATAAGATTATAATGG - Intergenic
1120634213 14:86931172-86931194 GTGGTCCCGTAAGATTATAATGG + Intergenic
1122147522 14:99700516-99700538 GTGGTCCCGTAAGATTATAATGG + Intronic
1122559892 14:102605450-102605472 GTGGTCCCATAAGATTATAATGG + Intronic
1124163531 15:27296585-27296607 GTGGTCCCATAAGATTATAATGG + Intronic
1125064635 15:35467945-35467967 GTGTTTCCGTAAGATTATAATGG - Intronic
1125115915 15:36091523-36091545 GTGCTTATTAAAGATTTTAAGGG + Intergenic
1125322618 15:38504865-38504887 GTGGTCCCTTAAGATTATAATGG - Intronic
1125436792 15:39654410-39654432 GTGGTCCCATAAGATTATAATGG - Intronic
1125519818 15:40341479-40341501 GTGGTCCCATAAGATTATAATGG + Intergenic
1126329732 15:47519363-47519385 GTGGTTGCATGAGATTATAACGG - Intronic
1126402750 15:48290621-48290643 GTGGTCCCATAAGATTATAATGG - Intronic
1126624301 15:50671478-50671500 GTGGTCCCATAAGATTATAATGG + Intronic
1126702044 15:51377237-51377259 GTGATTTCATAAGATTACAATGG - Intronic
1126880885 15:53095712-53095734 GTGGTTCCATAAGATTATAATGG + Intergenic
1126947467 15:53838410-53838432 GTGCTTACCATAGATTTTTATGG + Intergenic
1127191424 15:56534864-56534886 GTGGTCCCATAAGATTATAATGG + Intergenic
1127550711 15:60035442-60035464 GTGGTACCATAAGATTATAATGG + Intronic
1127692482 15:61411612-61411634 GTGGTTCCATAAGATTATAATGG - Intergenic
1128310195 15:66626145-66626167 GTGGTTCTATAAGATTATAATGG + Intronic
1129983758 15:79897674-79897696 GTGGTCCCTTAAGATTATAATGG - Intronic
1130021645 15:80236473-80236495 GTGGTCCCGTAAGATTATAATGG + Intergenic
1130156223 15:81352353-81352375 GTGGTTCCATAAGATTATATTGG + Intronic
1130165263 15:81449583-81449605 GTGATCCCATAAGATTATAATGG + Intergenic
1131006055 15:88979504-88979526 GTGGTCCCATAAGATTATAATGG + Intergenic
1131362295 15:91803841-91803863 GAGCCTACCTAACATGATAAAGG - Intergenic
1131889767 15:96960117-96960139 GTGCTTTGCTAAGATTAAATAGG + Intergenic
1132165496 15:99584157-99584179 GTGGTCACATAAGATTATAATGG - Intronic
1136371274 16:29837767-29837789 GTGGTCCCGTAAGATTATAATGG - Intronic
1136619596 16:31419250-31419272 GTGGTCTCCTAAAATTATAACGG + Intronic
1137516371 16:49148137-49148159 GGGCTTATCTAAGATCACAAAGG + Intergenic
1138242802 16:55441942-55441964 GTGGTCCCATAAGATTATAACGG + Intronic
1138308618 16:56003726-56003748 GTGGTTTCATAAGATTCTAATGG - Intergenic
1138610657 16:58121182-58121204 GTCATTGCCTAATATTATAAAGG + Intronic
1138695631 16:58810545-58810567 GTGGTCCCCTAAGATTATAATGG + Intergenic
1138984308 16:62308562-62308584 GTGGTTATGTAAGATTATAATGG + Intergenic
1139080577 16:63514209-63514231 GTGGTCCCATAAGATTATAATGG - Intergenic
1139289240 16:65842085-65842107 GTGATCTCATAAGATTATAAAGG + Intergenic
1139297179 16:65911254-65911276 GTGGTCACATAAGATTATTATGG + Intergenic
1139387365 16:66581363-66581385 GTGCTTACCTAAAAATACCAGGG + Intronic
1139808901 16:69595524-69595546 GTGCTTAGTTAAGATTTAAAAGG - Intronic
1140326603 16:74010272-74010294 GTGGTTCCATAAGATTATAATGG + Intergenic
1140573161 16:76132199-76132221 GTGGTTCCATAAGATTATAATGG + Intergenic
1141544013 16:84751080-84751102 GTGGTCCCATAAGATTATAATGG + Intronic
1143228311 17:5327473-5327495 GTGGTTACATGAGATTATAGGGG - Intronic
1143353069 17:6303533-6303555 TTTCTCACCTAAGATTATAGAGG - Intergenic
1143943129 17:10563974-10563996 GTGGTCCCATAAGATTATAACGG - Intergenic
1144255844 17:13466323-13466345 GTGCTCACATAAAATTACAAAGG - Intergenic
1145375250 17:22341374-22341396 GTGCTTAGTTAAGATGAAAAAGG + Intergenic
1146078105 17:29751666-29751688 GTGGTCCCATAAGATTATAATGG - Intronic
1146643356 17:34557842-34557864 GTGGTCCCATAAGATTATAATGG + Intergenic
1146703069 17:34979109-34979131 GTGGTCCCATAAGATTATAATGG - Intronic
1146813115 17:35919627-35919649 GTGGTTCCATAAGAGTATAATGG - Intronic
1149261601 17:54886215-54886237 GTGGTCCCTTAAGATTATAATGG - Intergenic
1149508352 17:57215071-57215093 GTGCTTAGTTAAGATGAAAAAGG - Intergenic
1150029142 17:61713046-61713068 GTGGTCCCATAAGATTATAATGG + Intronic
1150955316 17:69852623-69852645 GTGGTTTTCTAAGATTATAATGG + Intergenic
1151008534 17:70465557-70465579 GTGGTCTCATAAGATTATAATGG - Intergenic
1152056321 17:78030546-78030568 GTGGTTCCGTAAGATTATAATGG - Intronic
1153213336 18:2792215-2792237 GTGGTCCCATAAGATTATAATGG + Intronic
1153281744 18:3421033-3421055 GTGGTCCCATAAGATTATAAGGG + Intronic
1153953914 18:10080155-10080177 GTGGTGCCATAAGATTATAATGG - Intergenic
1153955673 18:10093629-10093651 GTGGTCCCATAAGATTATAATGG + Intergenic
1154286326 18:13060544-13060566 GTGATCCCATAAGATTATAATGG - Intronic
1155439662 18:25848830-25848852 GTGGTCACATAAGATTATGATGG + Intergenic
1155623854 18:27812407-27812429 GCAATTACATAAGATTATAATGG - Intergenic
1155702609 18:28766500-28766522 GGGCTGACCTATGATTCTAATGG + Intergenic
1156249737 18:35341241-35341263 GTGCTCCCATAAGATTATAATGG + Intronic
1156405723 18:36781017-36781039 GTGGTCCCATAAGATTATAATGG - Intronic
1156771050 18:40726176-40726198 GTGGTCCCATAAGATTATAATGG - Intergenic
1157052378 18:44181651-44181673 GTGATCCCCTAGGATTATAATGG - Intergenic
1157106659 18:44780382-44780404 TTGGGTACCTAAGATTTTAATGG + Intronic
1158158602 18:54454190-54454212 GTATTTCCATAAGATTATAATGG - Intergenic
1158200836 18:54938576-54938598 GAGCTTACATCAGGTTATAATGG - Intronic
1158358580 18:56647441-56647463 TTCCTTACCTCAGATTATCATGG + Intronic
1159485605 18:69052640-69052662 GTGGTCCCATAAGATTATAATGG - Intronic
1159705163 18:71677176-71677198 GTGGTTTCATAAGATTATGATGG + Intergenic
1159865142 18:73694810-73694832 GTAGTTCCATAAGATTATAATGG + Intergenic
1162231427 19:9270339-9270361 GTGGTTCCGTAAGATTTTAAGGG + Intergenic
1164675676 19:30099016-30099038 GTGATTCCATAAGATTATAATGG + Intergenic
1164963709 19:32460673-32460695 GTGGATTCGTAAGATTATAATGG - Intronic
1165684854 19:37811026-37811048 GTGGTCCCATAAGATTATAATGG - Intronic
1167820571 19:51923891-51923913 GTGGTCCCTTAAGATTATAATGG + Intronic
924973169 2:149912-149934 GTGCTTAGTTAAGATGAAAAAGG + Intergenic
927013719 2:18933724-18933746 GTGCTTACCACAACTTATAATGG + Intergenic
927160980 2:20260975-20260997 GTGGTCCCATAAGATTATAATGG + Intronic
927237655 2:20889546-20889568 GTGGTTACCTATGACTATAACGG + Intergenic
927585752 2:24302901-24302923 GTGGTCCCATAAGATTATAATGG + Intronic
928152815 2:28847439-28847461 GTGTTCCCCTAAGATTATAATGG + Intronic
928981831 2:37144032-37144054 GTGGTCCCATAAGATTATAATGG + Intronic
929219239 2:39446369-39446391 GTGGTCCCATAAGATTATAATGG + Intergenic
929240112 2:39645602-39645624 GTGGTCCCATAAGATTATAATGG - Intergenic
929407066 2:41654794-41654816 GTTTTTACTTTAGATTATAATGG - Intergenic
929621859 2:43363345-43363367 GTGGTCCCATAAGATTATAATGG - Intronic
930181441 2:48362782-48362804 GTGGTCCCCTAAGATTATAATGG + Intronic
930525032 2:52518126-52518148 GTGGTGCCATAAGATTATAATGG - Intergenic
931324821 2:61209467-61209489 GTGGTCCCATAAGATTATAATGG + Intronic
931337589 2:61363626-61363648 GTGTTCCCGTAAGATTATAATGG - Intronic
931963725 2:67509638-67509660 GTGGTCCCATAAGATTATAATGG + Intergenic
932031565 2:68191637-68191659 GTGGTTCCGTAAGATTATAATGG - Intronic
932118081 2:69071486-69071508 GTGGTCCCCTAAGGTTATAATGG - Intronic
932516599 2:72357382-72357404 GTGGTCCCATAAGATTATAATGG + Intronic
932587328 2:73039229-73039251 GTGGTTCCATAAGATGATAATGG - Intronic
932850760 2:75182541-75182563 GTGCTTCCATGAGTTTATAATGG + Intronic
933120762 2:78534579-78534601 GTGGTCCCATAAGATTATAATGG - Intergenic
933410135 2:81915270-81915292 GTGGTTCCGTAAGATTATAATGG - Intergenic
933977614 2:87524211-87524233 GTGGTCCCATAAGATTATAATGG + Intergenic
935716268 2:105941962-105941984 GTGGTCTCATAAGATTATAATGG - Intergenic
935838008 2:107076276-107076298 GTGGTCCCATAAGATTATAATGG - Intergenic
935866261 2:107390905-107390927 GTGGTCCCATAAGATTATAATGG + Intergenic
935877933 2:107532318-107532340 GTGTTTACCTAATATTTTAAAGG - Intergenic
935953953 2:108356023-108356045 GTGGTTCCATAAGATTATAATGG - Intergenic
936316213 2:111426595-111426617 GTGGTCCCATAAGATTATAATGG - Intergenic
936339587 2:111619039-111619061 GTGGCTCCCTCAGATTATAAAGG + Intergenic
936697909 2:114973104-114973126 GTGGTTGCATAAGATTATAATGG + Intronic
936933681 2:117816854-117816876 GTGGCTCCATAAGATTATAACGG - Intronic
937431058 2:121838663-121838685 GTGCTCCCATAAGGTTATAATGG + Intergenic
937588690 2:123588015-123588037 GTGCTTAATTAAGATGAAAAAGG - Intergenic
937725572 2:125161104-125161126 GTGGTTCCATAAGATTTTAATGG + Intergenic
938397182 2:130960130-130960152 GTGGTCCCCTAAGATTATAATGG + Intronic
938886981 2:135659935-135659957 GTGGCCCCCTAAGATTATAAAGG - Intronic
938901934 2:135805737-135805759 GTGGTCCCATAAGATTATAATGG + Intronic
939037682 2:137151862-137151884 GTGGTCCCATAAGATTATAATGG - Intronic
939808328 2:146802626-146802648 GTGGTCCCATAAGATTATAATGG - Intergenic
940066087 2:149631688-149631710 GTGGCTCCCTAAGATTAAAATGG - Intergenic
940136523 2:150442618-150442640 GTGGTTCCACAAGATTATAATGG + Intergenic
940191874 2:151049586-151049608 GTGGTTTCAGAAGATTATAACGG + Intergenic
940236610 2:151517820-151517842 GTGGTCCCATAAGATTATAATGG - Intronic
941133879 2:161688859-161688881 GTGGTTCCATAAGATTATAATGG + Intronic
941549400 2:166896140-166896162 GTGGTCCCCTAAGAATATAACGG + Intronic
941735687 2:168973412-168973434 GTGGTTCCATAAGATTATAATGG - Intronic
942765738 2:179454235-179454257 GTGGTCCCATAAGATTATAAAGG + Intronic
942803300 2:179900917-179900939 GTGGTCCCATAAGATTATAACGG - Intergenic
942819141 2:180090229-180090251 GTGGTCTCATAAGATTATAACGG + Intergenic
943143793 2:184016905-184016927 GTGGTTCCATAAGATTATAGTGG - Intergenic
943227367 2:185195233-185195255 GTGGTTATATAAAATTATAATGG + Intergenic
943404104 2:187457717-187457739 GTGATCCCCTAAGTTTATAATGG - Intergenic
943462262 2:188183913-188183935 GTGGTCCCATAAGATTATAATGG - Intergenic
943665940 2:190608481-190608503 GTGCTTAGTTAAGATGAAAAAGG + Intergenic
943741900 2:191418994-191419016 GTGGTCCCCTAAGATTGTAATGG + Intronic
944516718 2:200519910-200519932 GTGGTCCCATAAGATTATAATGG - Intronic
944704501 2:202275521-202275543 GTGCTTAGTTAAGATAAAAAAGG - Intronic
944879452 2:203996914-203996936 GTGGTAACATAAGATTATAAAGG - Intergenic
945758024 2:213874678-213874700 ATGGTTTCATAAGATTATAATGG - Intronic
945867008 2:215187541-215187563 GTGGTACCATAAGATTATAATGG - Intergenic
946001705 2:216487766-216487788 GTGGTCCCTTAAGATTATAATGG + Intergenic
946087140 2:217185526-217185548 GTGGTCTCATAAGATTATAATGG - Intergenic
946385066 2:219378683-219378705 GTGGTCCCGTAAGATTATAATGG + Intronic
946508965 2:220334207-220334229 GTTCTTACCTAAGACTACCAAGG - Intergenic
946740636 2:222797764-222797786 GTGGTCCCGTAAGATTATAATGG + Intergenic
1169458204 20:5771568-5771590 GTGCTTAGTTAAGATGAAAAAGG - Intronic
1170120320 20:12904385-12904407 GTGGTCCCATAAGATTATAATGG + Intergenic
1170619609 20:17984370-17984392 GTGGTCCCATAAGATTATAATGG + Intronic
1170773323 20:19352879-19352901 GTGGTCCCATAAGATTATAATGG + Intronic
1170828443 20:19818233-19818255 GTGGTGCCATAAGATTATAATGG - Intergenic
1170855145 20:20045692-20045714 GTGCTTAGTTAAGATTTTAGTGG + Intronic
1171308389 20:24125667-24125689 GTGCTTACCTAAATATATATGGG + Intergenic
1171527673 20:25828349-25828371 GTGCTTAGTTAAGATGAAAAAGG - Intronic
1171549153 20:26027535-26027557 GTGCTTAGTTAAGATGAAAAAGG + Intergenic
1172492619 20:35352578-35352600 GTGGTCCCATAAGATTATAATGG + Intronic
1172568466 20:35950447-35950469 GTGGTCCCATAAGATTATAATGG + Intergenic
1172892579 20:38277443-38277465 GTGGTCCCGTAAGATTATAATGG - Intronic
1175392685 20:58637035-58637057 GGCCTTAACTAAGATTATCATGG + Intergenic
1177226399 21:18262554-18262576 GTGGTCCCATAAGATTATAATGG - Intronic
1177455147 21:21328126-21328148 GTGGTTCCATAAGATTATAATGG + Intronic
1177589279 21:23141511-23141533 GTGAGTGCCTGAGATTATAAGGG - Intergenic
1177599789 21:23295893-23295915 GAGCTTATTTAACATTATAAAGG - Intergenic
1178075056 21:29007626-29007648 GTGATGCCATAAGATTATAATGG - Intronic
1178402252 21:32297016-32297038 GTGGTCACATAAGATTATAATGG - Intronic
1181994613 22:26866568-26866590 GTGGTCTCCTAAGATTATAATGG + Intergenic
1182017070 22:27049599-27049621 GTGGTCCCATAAGATTATAATGG + Intergenic
1182286152 22:29248898-29248920 GTGGTCTCATAAGATTATAATGG - Intronic
1182675690 22:32037409-32037431 GTGATCTCATAAGATTATAATGG + Intergenic
1182980261 22:34663433-34663455 GTGGTCCCATAAGATTATAATGG - Intergenic
1183561530 22:38578295-38578317 GTGGTCCCATAAGATTATAATGG - Intronic
1183578480 22:38707403-38707425 GTGCTCACCTGAGACTACAATGG - Intronic
1183593081 22:38793076-38793098 GTGGTGCCCTAAGGTTATAATGG - Intronic
949132193 3:517036-517058 GTGGTTTCATAAGATTATAATGG + Intergenic
949252198 3:1999016-1999038 GTAGTCTCCTAAGATTATAATGG - Intergenic
949337263 3:2989058-2989080 GTGCTTTGCTAAGAGCATAAAGG - Intronic
950370540 3:12525964-12525986 GTGGTCCCATAAGATTATAACGG - Intronic
950759511 3:15208102-15208124 GTGGTCCCCTAAGATTATAATGG - Intronic
950761846 3:15237358-15237380 GTGGTTCCATAAGATTATAATGG - Intronic
951960681 3:28315693-28315715 GTGGTTCCATAAGATGATAATGG + Intronic
952675389 3:36023776-36023798 GTGGTCCCATAAGATTATAATGG + Intergenic
952787387 3:37168735-37168757 GTGGTCCCATAAGATTATAATGG + Intronic
953066538 3:39477338-39477360 GTGGTCCCATAAGATTATAATGG + Intronic
953247773 3:41211237-41211259 GTGGTCTCATAAGATTATAATGG - Intronic
953678803 3:45024381-45024403 ATGCTTCCATAAGATTATAATGG - Intronic
953889373 3:46740233-46740255 GTGGTCCCATAAGATTATAATGG - Intronic
954345099 3:49990436-49990458 ATGGTTCCATAAGATTATAATGG - Intronic
954841182 3:53513248-53513270 GTGGTCCCATAAGATTATAATGG + Intronic
954924845 3:54224542-54224564 GTGGTCTCATAAGATTATAATGG - Intronic
955607101 3:60716862-60716884 GTGGTCCCTTAAGATTATAATGG - Intronic
955640337 3:61076076-61076098 ATGATTACCTAAGGTTATAAAGG + Intronic
956352828 3:68356664-68356686 ATGATTTCCCAAGATTATAAAGG + Intronic
956508820 3:69972808-69972830 GTGGTCACATAAGATTACAATGG + Intergenic
956721447 3:72121459-72121481 GTGGTCCCATAAGATTATAATGG - Intergenic
956955158 3:74330047-74330069 GTGGTCCCATAAGATTATAATGG + Intronic
957342183 3:78915212-78915234 AGACTTACCTAAGATTATGAAGG + Intronic
958605572 3:96354548-96354570 GTGTTTACCTTAAACTATAATGG - Intergenic
958932524 3:100222836-100222858 GTGCTTACCTAAGATGGAAAAGG - Intergenic
958982617 3:100740909-100740931 GTGGTCTCATAAGATTATAATGG + Intronic
959060052 3:101608415-101608437 GTGGTCTCATAAGATTATAATGG + Intergenic
959243715 3:103834725-103834747 GAGCATACCTAACATGATAAAGG + Intergenic
959396895 3:105851845-105851867 GTGCTTTCATAAGATTATAATGG + Intronic
959470099 3:106739404-106739426 GTGGATACCTAATAATATAAAGG + Intergenic
959657798 3:108829652-108829674 GTGGTCCCTTAAGATTATAATGG + Intronic
960126934 3:114009565-114009587 GTGGTCCCATAAGATTATAATGG - Intronic
960135906 3:114104536-114104558 GTGGTCTCATAAGATTATAATGG + Intergenic
960222070 3:115124927-115124949 GTGTTTACCTATGTTTATTAGGG - Intronic
960621398 3:119640064-119640086 GTGGTCCCATAAGATTATAATGG + Intronic
962028874 3:131577829-131577851 GTACTCCCATAAGATTATAATGG - Intronic
962469339 3:135691834-135691856 GTGGTCCCATAAGATTATAATGG - Intergenic
963024400 3:140904458-140904480 GTGGTTCCATAAGATTATAATGG - Intergenic
963377080 3:144481291-144481313 GTGATCTCATAAGATTATAATGG + Intergenic
964383052 3:156117759-156117781 GTGGTCCCATAAGATTATAATGG - Intronic
964423074 3:156524873-156524895 GTGATCCCATAAGATTATAATGG + Intronic
964780666 3:160334029-160334051 GTGGTCCCATAAGATTATAATGG - Intronic
965120755 3:164552952-164552974 GTGGTCTCATAAGATTATAATGG - Intergenic
965378076 3:167951681-167951703 GTCTTTGCTTAAGATTATAAGGG - Intergenic
965718864 3:171638426-171638448 GTGGTCCCGTAAGATTATAATGG - Intronic
965807883 3:172560689-172560711 GTGGTCCCATAAGATTATAATGG + Intergenic
966025093 3:175269492-175269514 GCGGTCACGTAAGATTATAACGG - Intronic
966062874 3:175781334-175781356 GTGGTCTCATAAGATTATAATGG + Intronic
968723399 4:2225031-2225053 GTGGTCCCATAAGATTATAATGG - Intronic
970098919 4:12498111-12498133 GTGGTCCCATAAGATTATAATGG - Intergenic
970186371 4:13458665-13458687 GTGGTCCCATAAGATTATAATGG + Intronic
970550973 4:17180763-17180785 GTGGTTCCATAAGATTATAATGG + Intergenic
971056967 4:22924093-22924115 GTGGTTCTATAAGATTATAATGG - Intergenic
971700941 4:29974782-29974804 GTGCCTATTTAAAATTATAAAGG + Intergenic
972061556 4:34880412-34880434 CTGCTGAGCTAAGAGTATAATGG - Intergenic
972811517 4:42592846-42592868 GTGGTCCCATAAGATTATAATGG - Intronic
972926600 4:44016194-44016216 GTGGTCCCATAAGATTATAATGG + Intergenic
973561959 4:52145718-52145740 GTGGTCCCATAAGATTATAATGG + Intergenic
973762562 4:54132864-54132886 GTGATACCATAAGATTATAATGG - Intronic
974139706 4:57869868-57869890 GTGATTCCATAAGATTATAATGG + Intergenic
975478116 4:74845804-74845826 GTGGTCCCATAAGATTATAATGG + Intergenic
975545133 4:75552745-75552767 GTGGTTCCATAAGATTATAATGG - Intergenic
975663810 4:76713782-76713804 GTGGTTCCATAAGATTATAATGG - Intronic
976636533 4:87291953-87291975 GTGGTCCCATAAGATTATAATGG + Intergenic
976807817 4:89067732-89067754 GTTCTTACCTAAGAACATGAAGG + Intronic
976834380 4:89354031-89354053 GTGCTCTCATTAGATTATAATGG - Intergenic
977158671 4:93606673-93606695 ATGTTTACATAAAATTATAATGG - Intronic
977202345 4:94132005-94132027 GTGGTCTCATAAGATTATAACGG + Intergenic
977402620 4:96552562-96552584 GTGGTGTCATAAGATTATAATGG - Intergenic
978121668 4:105087006-105087028 GTGGTCTCATAAGATTATAATGG - Intergenic
978172556 4:105690723-105690745 GTGCTTACTTTAGATATTAAAGG + Intronic
978292289 4:107155861-107155883 GTGGTACCATAAGATTATAATGG + Intronic
978509378 4:109499597-109499619 GTGGTCCCATAAGATTATAATGG + Intronic
978554762 4:109968148-109968170 GTGATTCCGTAAGATGATAATGG - Intronic
979271532 4:118767980-118768002 GTAGTTACCTAAGGTTAAAAGGG + Intronic
979337623 4:119481676-119481698 TTGCTTACCTAAGAGTGTACTGG + Intergenic
979506828 4:121508118-121508140 GTGGTCTCATAAGATTATAATGG - Intergenic
979718070 4:123865800-123865822 ATGGTTTCTTAAGATTATAATGG + Intergenic
979928083 4:126592931-126592953 CTGGTTCCTTAAGATTATAATGG - Intergenic
980077238 4:128306673-128306695 GTGGTTCCATAAGAGTATAATGG - Intergenic
980158071 4:129130683-129130705 GTGGTCCCATAAGATTATAATGG + Intergenic
980199052 4:129630663-129630685 GTGGTCTCATAAGATTATAATGG + Intergenic
980236107 4:130108874-130108896 GTGCTAACCCAAGACCATAAAGG - Intergenic
980578671 4:134719159-134719181 GTGGTCCCATAAGATTATAAAGG + Intergenic
980597042 4:134967496-134967518 GTTCTTACCCAAGATTACTAAGG + Intergenic
980693393 4:136325456-136325478 TTGATCACATAAGATTATAATGG - Intergenic
981125543 4:141102086-141102108 GTGGTCCCATAAGATTATAACGG - Intronic
981202811 4:142001668-142001690 GTGGTTTCATAAGATTATAATGG - Intergenic
981502299 4:145465116-145465138 GGTCTCACATAAGATTATAATGG - Intergenic
981798898 4:148633430-148633452 GTGATCCCATAAGATTATAATGG - Intergenic
982027942 4:151270710-151270732 TTGGTTCCATAAGATTATAATGG - Intronic
982052670 4:151517663-151517685 GTGGTCCCCTAAGATTATAATGG + Intronic
982225589 4:153163145-153163167 TTGCTTCTCTAAAATTATAATGG + Intronic
982345733 4:154355715-154355737 GTGGTCCCATAAGATTATAATGG + Intronic
982583251 4:157205898-157205920 GTGATTCCATAAAATTATAATGG - Intronic
983054706 4:163087907-163087929 GTGGTCCCATAAGATTATAATGG + Intergenic
983393065 4:167159110-167159132 CAACTTACCTCAGATTATAAAGG - Intronic
983422297 4:167534394-167534416 GTGGTTTCCAAAGATTATAATGG + Intergenic
983438446 4:167748555-167748577 GTGCTAACCTAAAACTATCAAGG + Intergenic
983474876 4:168201683-168201705 GTGGTCCCATAAGATTATAATGG - Intergenic
983483396 4:168303546-168303568 GTGATCCCATAAGATTATAATGG + Intronic
984070148 4:175100970-175100992 GTGTTGACATAATATTATAAGGG - Intergenic
984264570 4:177481756-177481778 GTGATCCCATAAGATTATAATGG + Intergenic
984571122 4:181395677-181395699 TTACTTGCCCAAGATTATAAAGG + Intergenic
984773822 4:183462934-183462956 GTGGTCCCATAAGATTATAATGG - Intergenic
985235966 4:187874761-187874783 GTGTTTCCGTAATATTATAATGG - Intergenic
986228579 5:5840642-5840664 GTGGTTTCATAAGATTGTAATGG - Intergenic
986862377 5:11942492-11942514 GTGGTTCCATAAGATTATAACGG + Intergenic
986876951 5:12122848-12122870 GTGGTCCCATAAGATTATAATGG + Intergenic
987720248 5:21624111-21624133 GTGGGTGCATAAGATTATAAGGG + Intergenic
987725015 5:21686868-21686890 ATGGTTCCGTAAGATTATAATGG + Intergenic
987743935 5:21946674-21946696 GTGGTCCCATAAGATTATAATGG + Intronic
987767727 5:22256286-22256308 GTGGTCCCATAAGATTATAAAGG + Intronic
987844812 5:23269533-23269555 GTGGTTCCATAAGATTATAATGG + Intergenic
987857172 5:23435452-23435474 GTGGTCCCCTAAGATTATAATGG + Intergenic
987868836 5:23584623-23584645 GTGCTTAACTTAGATAATTATGG - Intergenic
988387771 5:30588976-30588998 GTGGTTCCATAAGATTATAATGG - Intergenic
988661517 5:33275199-33275221 GTGGTTCCATAAAATTATAATGG - Intergenic
988677972 5:33453574-33453596 GTGCTTGCCTTAGAAAATAAAGG + Intronic
988831210 5:34989100-34989122 GTGGTCCCATAAGATTATAATGG + Intergenic
989037483 5:37190727-37190749 GTGCACCCATAAGATTATAATGG + Intronic
989766720 5:45094583-45094605 GTGGTCCCATAAGATTATAATGG + Intergenic
989785831 5:45328179-45328201 GTGCTTAGTTAAGATGAAAAAGG - Intronic
990053121 5:51533105-51533127 GTGGTCCCATAAGATTATAATGG + Intergenic
990104748 5:52245065-52245087 GTCTTTACCTATGATTGTAAAGG - Intergenic
990480808 5:56208860-56208882 GTGGTTCCATAAGATTATGATGG - Intronic
990569869 5:57067486-57067508 GTGCTTAACTAAGATAGAAAAGG + Intergenic
990822575 5:59859090-59859112 ATACTTACTAAAGATTATAATGG - Intronic
990862167 5:60339019-60339041 GTGCTTAGCTAAGATAAAAAAGG - Intronic
990987162 5:61651417-61651439 GTGCTTACATCAGAATGTAAAGG - Intronic
991452235 5:66764510-66764532 GTGGTCCCATAAGATTATAATGG + Intronic
991583027 5:68176096-68176118 GTGGTCCCATAAGATTATAATGG + Intergenic
991677969 5:69107642-69107664 GTGGTGCCATAAGATTATAATGG - Intronic
991764133 5:69956813-69956835 GTGGTCCCATAAGATTATAATGG + Intergenic
991783192 5:70161334-70161356 GTGGTCCCATAAGATTATAATGG - Intergenic
991843365 5:70831885-70831907 GTGGTCCCATAAGATTATAATGG + Intergenic
991875635 5:71161661-71161683 GTGGTCCCATAAGATTATAATGG - Intergenic
992353954 5:75960369-75960391 GTGGTCTCATAAGATTATAATGG + Intergenic
992671532 5:79065851-79065873 GTGGTCCCGTAAGATTATAATGG - Intronic
992705903 5:79391936-79391958 GTGGTCCCATAAGATTATAAGGG + Intronic
993025325 5:82638704-82638726 GTGTTTAAGGAAGATTATAAGGG - Intergenic
993093403 5:83453961-83453983 GTGGTCTCATAAGATTATAATGG - Intergenic
993194651 5:84725381-84725403 GTGGTTCTATAAGATTATAATGG + Intergenic
994174023 5:96691172-96691194 GTGGTCCCATAAGATTATAATGG - Intronic
994455646 5:100003660-100003682 GTGGTCCCGTAAGATTATAATGG + Intergenic
994760978 5:103853729-103853751 TTGCATCCCTAAGATTATAGAGG + Intergenic
994859470 5:105169778-105169800 ATGCTTATCTAAGATTTTAAAGG + Intergenic
995412248 5:111871776-111871798 GTGGTGCCATAAGATTATAATGG - Intronic
995757137 5:115518462-115518484 GTGGTCCTCTAAGATTATAATGG + Intergenic
995900225 5:117056898-117056920 GTGGTCCCATAAGATTATAACGG + Intergenic
996269358 5:121584260-121584282 GTGGTCCCATAAGATTATAATGG + Intergenic
996504131 5:124250347-124250369 GTGGTTCCATAAAATTATAACGG - Intergenic
997047450 5:130335381-130335403 GTGGTCCCATAAGATTATAATGG - Intergenic
997344235 5:133174618-133174640 GTGGTCCCATAAGATTATAATGG + Intergenic
997504847 5:134409016-134409038 GGGCTTACCTATGTTTCTAAGGG + Intronic
997646480 5:135485482-135485504 GTGGTCCCATAAGATTATAAGGG - Intergenic
997873443 5:137525944-137525966 GTGGTCCCATAAGATTATAATGG + Intronic
998212671 5:140212267-140212289 GTGATCCCATAAGATTATAATGG + Intronic
998541350 5:142984675-142984697 GTGGTCCCATAAGATTATAATGG + Intronic
999077893 5:148814256-148814278 GTGTTCCCATAAGATTATAATGG - Intergenic
999617509 5:153440044-153440066 GTGCTTACCAAGGATGGTAAAGG - Intergenic
999629706 5:153558160-153558182 GTGGTCCCATAAGATTATAATGG - Intronic
1000709308 5:164551037-164551059 ATGGTCACCTAAGATTTTAATGG - Intergenic
1000957887 5:167563669-167563691 GTGGTCCCATAAGATTATAATGG + Intronic
1001471844 5:172019662-172019684 GTGGTCCCATAAGATTATAACGG + Intergenic
1001609426 5:172988179-172988201 GTGGTCCCCTAAGATTATAATGG - Intronic
1001763565 5:174226833-174226855 GTACTCATCTAAGATTATGATGG + Intronic
1003228349 6:4226665-4226687 TTACTTTCCTAAGATTATAGGGG - Intergenic
1004288941 6:14349064-14349086 GAGGTTAACTAAGGTTATAAAGG - Intergenic
1004524657 6:16395447-16395469 GCGGTCACATAAGATTATAATGG + Intronic
1004565517 6:16792402-16792424 GTGGTCCCATAAGATTATAATGG - Intergenic
1004590992 6:17051409-17051431 GTGGTCCCATAAGATTATAATGG + Intergenic
1004951307 6:20675519-20675541 GTGGTTTCATAAGATTATAATGG + Intronic
1005077415 6:21921994-21922016 GTGTTCCCTTAAGATTATAATGG - Intergenic
1005229008 6:23677706-23677728 GTGCTTACTTAGCATTATATTGG - Intergenic
1005598633 6:27404600-27404622 GTGATCACATAAGATTATAATGG + Intergenic
1006660726 6:35641525-35641547 GTGGTCCCATAAGATTATAATGG - Intronic
1007057568 6:38902917-38902939 GTGGTCACATGAGATTATAATGG + Intronic
1007103146 6:39264760-39264782 GTGGTCCCATAAGATTATAATGG + Intergenic
1008001895 6:46369551-46369573 GTGGTCCCATAAGATTATAATGG - Intronic
1008627445 6:53331568-53331590 GTGGTCCCATAAGATTATAATGG - Intronic
1008695759 6:54034419-54034441 GTGGTCATATAAGATTATAATGG + Intronic
1009602222 6:65816435-65816457 GTGGTTCCATAAGATTATGATGG + Intergenic
1009780118 6:68259012-68259034 GTGGTCCCATAAGATTATAATGG - Intergenic
1009997207 6:70909433-70909455 GTGATTACCAGAGATAATAAGGG + Intronic
1010118966 6:72351245-72351267 GTGCTGACCTAAAAATTTAATGG - Intronic
1010744890 6:79549425-79549447 GTGGTCCCATAAGATTATAATGG + Intergenic
1010832799 6:80551872-80551894 GTGGTCCCATAAGATTATAATGG + Intergenic
1011146662 6:84225448-84225470 ATGGTTCCGTAAGATTATAATGG - Intronic
1011958782 6:93059636-93059658 GTGGTCTCATAAGATTATAAAGG - Intergenic
1012160364 6:95877566-95877588 GTGCTTAGTTAAGATGAAAAAGG + Intergenic
1012236515 6:96822942-96822964 TTCCTTTCATAAGATTATAATGG + Intronic
1012415789 6:99011799-99011821 GTGATCCCATAAGATTATAATGG + Intergenic
1012726385 6:102816146-102816168 GTGCTTAGTTAAGATTGGAAAGG + Intergenic
1013024515 6:106257485-106257507 GTGGTCCCTTAAGATTATAATGG - Intronic
1013238391 6:108219885-108219907 GTGGTGCCTTAAGATTATAATGG + Intronic
1013385614 6:109627587-109627609 GTGGTCCCATAAGATTATAATGG - Intronic
1013446554 6:110234756-110234778 GTGGTCCCCTAAGATTATAATGG - Intronic
1013967981 6:115978655-115978677 GTGGTTCCATAAGATTATAGTGG + Intronic
1014643298 6:123941521-123941543 GTGATCTCGTAAGATTATAATGG - Intronic
1014806908 6:125839718-125839740 GTGGTTCCATAAGATTATGATGG + Intronic
1015519982 6:134120565-134120587 GTGGTTCCCTAAGATTATAATGG + Intergenic
1015608896 6:134992305-134992327 GTGGTCCCATAAGATTATAATGG + Intronic
1016522159 6:144958352-144958374 GTGGTCCCATAAGATTATAATGG - Intergenic
1017351340 6:153445714-153445736 GTGGGCACGTAAGATTATAAGGG - Intergenic
1017833150 6:158150790-158150812 GTGGTCTCATAAGATTATAATGG + Intronic
1018041591 6:159928582-159928604 GTGATTTCTTAAGATTATAATGG + Intergenic
1018412399 6:163564358-163564380 GTGGTCCCATAAGATTATAATGG - Intronic
1018558135 6:165071723-165071745 GTGGTCCCATAAGATTATAATGG - Intergenic
1018599012 6:165518830-165518852 GTGCTTCTCTAAGATGAGAAAGG + Intronic
1018886809 6:167945647-167945669 GTGGTCTCCTAAGATTAAAACGG - Intronic
1019041999 6:169113962-169113984 GTGTTTACCTAAGATTCTTAAGG - Intergenic
1020512212 7:9071473-9071495 TTGCCTACCTAAGCTTATGATGG - Intergenic
1020551929 7:9617674-9617696 GTGATACCATAAGATTATAATGG - Intergenic
1020636540 7:10702118-10702140 GTGATTCCATAAGATTATAATGG + Intergenic
1020805712 7:12787998-12788020 GTGGTCCCATAAGATTATAATGG + Intergenic
1021254526 7:18374832-18374854 GTGGTCCCATAAGATTATAATGG + Intronic
1021546114 7:21814712-21814734 GTGGTTTCATAAGATTATAATGG - Intronic
1021696529 7:23281619-23281641 GTGGTCCCATAAGATTATAATGG + Intergenic
1021846009 7:24763133-24763155 GTGCTTGCTTAAGATGAAAAAGG - Intergenic
1022571680 7:31459791-31459813 GTGGTCCCTTAAGATTATAATGG + Intergenic
1022627228 7:32050171-32050193 GTGGTCCCATAAGATTATAATGG - Intronic
1022971984 7:35526879-35526901 GTGCTTAGTTAAGATGAAAAAGG - Intergenic
1023291504 7:38672900-38672922 GTGGTCCCATAAGATTATAATGG + Intergenic
1023527895 7:41123892-41123914 GTGGTCCCATAAGATTATAATGG + Intergenic
1023622835 7:42090382-42090404 GTGGTCCCATAAGATTATAATGG - Intronic
1023656426 7:42426449-42426471 GTGGCCACGTAAGATTATAATGG - Intergenic
1024277226 7:47687838-47687860 GTGGTTCCATAAGATTATAATGG - Intergenic
1025297970 7:57791514-57791536 GTGCTTAGTTAAGATGAAAAAGG + Intergenic
1027341874 7:77218135-77218157 ATGGTTCCATAAGATTATAATGG - Intronic
1027545810 7:79526265-79526287 GTGGTCTCATAAGATTATAATGG - Intergenic
1027892871 7:83999127-83999149 GTGGTCCCATAAGATTATAATGG - Intronic
1028185140 7:87774798-87774820 GTGGTCTCATAAGATTATAATGG + Intronic
1028612196 7:92724219-92724241 GTGATTACATAAGAATACAAGGG + Intronic
1028681795 7:93543577-93543599 GTGGTCCCATAAGATTATAATGG - Intronic
1028699378 7:93759523-93759545 GTGACTCCATAAGATTATAATGG - Intronic
1030123318 7:106131701-106131723 GTGGTCCCATAAGATTATAATGG + Intergenic
1030254576 7:107494398-107494420 GTGGTCCCATAAGATTATAATGG + Intronic
1031316801 7:120268658-120268680 GTGGTTCCATAAGATTATAATGG + Intergenic
1031432651 7:121691513-121691535 GTGGTCCCATAAGATTATAATGG + Intergenic
1031697830 7:124881305-124881327 GTGGTCTCGTAAGATTATAATGG - Intronic
1032158878 7:129494966-129494988 GTGATCCCATAAGATTATAATGG - Intergenic
1032791995 7:135249145-135249167 GTGGTCACATAAGATGATAATGG + Intronic
1032891814 7:136204247-136204269 GTGATTCCATAAGATTATTATGG - Intergenic
1032940777 7:136787994-136788016 GTGGTCCTCTAAGATTATAATGG + Intergenic
1033379617 7:140802189-140802211 GTGGTCCCATAAGATTATAAAGG + Intronic
1033612426 7:142977046-142977068 GTGGTCTCATAAGATTATAATGG - Intergenic
1033616358 7:143018908-143018930 GTGGTTCTATAAGATTATAATGG - Intergenic
1033642463 7:143274931-143274953 GTGGTCCCTTAAGATTATAATGG - Intergenic
1033899662 7:146120645-146120667 GTGGTTCCATAAAATTATAATGG + Intronic
1034596937 7:152205614-152205636 GTGGTCCCATAAGATTATAATGG + Intronic
1035130943 7:156652569-156652591 GTGCTCCCATAAAATTATAATGG + Intronic
1035416918 7:158696916-158696938 GTGGTCCCATAAGATTATAATGG + Intronic
1036021175 8:4848361-4848383 GTGGTCACGTAAGATTATAGTGG + Intronic
1036131627 8:6120255-6120277 GCGTTTCCATAAGATTATAATGG - Intergenic
1036165419 8:6428356-6428378 GTGATCACATAAGATTATAATGG - Intronic
1036447445 8:8834217-8834239 GTGGTCCCATAAGATTATAATGG + Intronic
1037195435 8:16183054-16183076 GTGGTCCCATAAGATTATAATGG - Intronic
1037395937 8:18443113-18443135 GTGGTCCCATAAGATTATAATGG + Intergenic
1037560570 8:20070834-20070856 GTGGTCCCATAAGATTATAATGG - Intergenic
1037597043 8:20362971-20362993 GTGCTGAACTAGGCTTATAATGG - Intergenic
1038137961 8:24810822-24810844 GTGCTTACTTAAGATAGAAAAGG + Intergenic
1038371898 8:27002383-27002405 GTGGTTTCATAAGATTATAATGG + Intergenic
1038710133 8:29935973-29935995 GTGGTTCCATAAGATTTTAATGG + Intergenic
1038738386 8:30193326-30193348 GTGGTCTCATAAGATTATAATGG + Intergenic
1038813154 8:30872266-30872288 GTGGTCCCGTAAGATTATAATGG + Intronic
1038834435 8:31103486-31103508 GTGGTCCCATAAGATTATAATGG - Intronic
1038868640 8:31468040-31468062 GTGGTCCCCTAAGATTACAATGG + Intergenic
1038961976 8:32530411-32530433 GTGGTCCCATAAGATTATAATGG - Intronic
1039740555 8:40379034-40379056 GTGGTCCCCTAAGATTATAATGG - Intergenic
1040724193 8:50361705-50361727 GTGGTCCCGTAAGATTATAAAGG - Intronic
1040759529 8:50822230-50822252 GTGGTTTTATAAGATTATAATGG - Intergenic
1041069840 8:54116972-54116994 GTGGTCCCATAAGATTATAATGG - Intergenic
1041098233 8:54371210-54371232 GTGGTTCCATAAGATTATAATGG - Intergenic
1041134274 8:54739819-54739841 GTGGTCCCATAAGATTATAATGG + Intergenic
1042322047 8:67486302-67486324 GTGGTTCCACAAGATTATAATGG + Intronic
1042585737 8:70336252-70336274 GTGGTCCCATAAGATTATAAAGG - Intronic
1042599146 8:70480876-70480898 CTGCTTATCTAAAGTTATAAAGG + Intergenic
1042662394 8:71169385-71169407 GTGGTTCCATCAGATTATAATGG - Intergenic
1043736671 8:83756743-83756765 CTGCTTATCTAAGATCACAAGGG - Intergenic
1043779787 8:84317608-84317630 GTGCTTAACTAAGCTAATCATGG - Intronic
1043909498 8:85844794-85844816 GTGGTCTCATAAGATTATAACGG + Intergenic
1044208300 8:89518490-89518512 GTTCTTACATAAGATCATAAGGG - Intergenic
1044517983 8:93161915-93161937 GTAGTTTCATAAGATTATAATGG + Intronic
1044733432 8:95251988-95252010 GTGGTTCCATAAGATTATGACGG - Intronic
1044843261 8:96356012-96356034 GTGGTCCCATAAGATTATAATGG + Intergenic
1045149357 8:99386582-99386604 GTGGTTCCATAAGATTATAATGG - Intronic
1045462329 8:102436301-102436323 GTGCTTACTTAAAAATTTAACGG + Intergenic
1045628013 8:104079311-104079333 GTAATTACCTAAGAATATAAAGG + Intronic
1046549420 8:115695408-115695430 GTGGTTTTATAAGATTATAATGG - Intronic
1046945578 8:119971340-119971362 GTGATTACCTAATATTCCAATGG + Intronic
1047193210 8:122697433-122697455 GTGGTCTCATAAGATTATAATGG - Intergenic
1047252302 8:123190023-123190045 GTGCTCCCATAAGATTATAATGG + Intronic
1047932165 8:129739558-129739580 GTGGTCCCATAAGATTATAATGG + Intergenic
1048301898 8:133257608-133257630 GTGGTTCCATAAGATTATAATGG - Intronic
1051128281 9:13830665-13830687 GTGATCCCATAAGATTATAATGG - Intergenic
1053402679 9:37840165-37840187 GTGGTTCCAGAAGATTATAATGG + Intronic
1053795634 9:41724513-41724535 GTGCTTAGTTAAGATGAAAAAGG - Intergenic
1054184044 9:61936568-61936590 GTGCTTAGTTAAGATGAAAAAGG - Intergenic
1054654461 9:67651918-67651940 GTGCTTAGTTAAGATGAAAAAGG + Intergenic
1054854741 9:69886483-69886505 GTCCTTAGCTAAGATGAAAAAGG + Intronic
1055121456 9:72665133-72665155 GTGGTATCATAAGATTATAAAGG - Intronic
1055395683 9:75871947-75871969 GTGGTTCCATAAGATTATAATGG + Intergenic
1055858535 9:80721514-80721536 GTGGTCTCATAAGATTATAATGG - Intergenic
1056432011 9:86537096-86537118 GTGGTCCCATAAGATTATAATGG + Intergenic
1057452864 9:95180894-95180916 GTGGTCTCATAAGATTATAATGG - Intronic
1057711916 9:97453344-97453366 GTGGTCCCATAAGATTATAATGG + Intronic
1058097087 9:100874779-100874801 GTTCTTACCCATGATTATATAGG - Intergenic
1058281226 9:103117275-103117297 GTGGTCCCATAAGATTATAATGG + Intergenic
1058318856 9:103604346-103604368 TTGGTCCCCTAAGATTATAATGG + Intergenic
1058356625 9:104091406-104091428 GTGGTCCCTTAAGATTATAATGG - Intergenic
1058712030 9:107687916-107687938 GTGGTCCCATAAGATTATAATGG - Intergenic
1058986733 9:110214778-110214800 GTGCTTTCCTAAGATTCTATGGG - Intergenic
1059591906 9:115670972-115670994 GTGCTTTCCTAAAAATAAAAGGG + Intergenic
1060707092 9:125813379-125813401 ATGGTTTCATAAGATTATAAAGG - Intronic
1061919312 9:133773980-133774002 GTGGTCCCGTAAGATTATAATGG - Intronic
1185819974 X:3193433-3193455 GTGCTCAATTAACATTATAAAGG - Intergenic
1186296395 X:8153761-8153783 GTGGTCCCATAAGATTATAATGG - Intergenic
1186577099 X:10778293-10778315 GTGGTCCCATAAGATTATAATGG - Intronic
1186948367 X:14594813-14594835 ATGTTTACCAAATATTATAAAGG - Intronic
1187080212 X:15978116-15978138 GTGGTCCCTTAAGATTATAATGG + Intergenic
1187395290 X:18914205-18914227 GTGGTCCCCTAAGATTATAATGG - Intronic
1187441083 X:19320772-19320794 GTGGTCCCATAAGATTATAATGG - Intergenic
1187762264 X:22600830-22600852 GTGGTCCCATAAGATTATAATGG + Intergenic
1188733950 X:33688670-33688692 TTTCTTAGCTAAAATTATAAAGG + Intergenic
1188772490 X:34170432-34170454 GTGTTCCCATAAGATTATAATGG + Intergenic
1188777471 X:34238640-34238662 GTGGTTCCATAAGATTATACAGG - Intergenic
1188939057 X:36215141-36215163 GTGGTCCCATAAGATTATAATGG - Intergenic
1189063417 X:37779404-37779426 GTGGTCCCATAAGATTATAATGG - Intronic
1189132317 X:38512936-38512958 GTGGTCCCATAAGATTATAAAGG - Intronic
1189521764 X:41776281-41776303 GTGCTCTCATAAGAGTATAATGG - Intronic
1189890609 X:45598205-45598227 GTGCTTAGTTAAGATGAAAACGG - Intergenic
1190794661 X:53729629-53729651 GTGGTCCCCTAAAATTATAATGG + Intergenic
1191920277 X:66248727-66248749 GTGCTTAGTTAAGATGAAAAAGG + Intronic
1192276327 X:69634812-69634834 GTGGTCCCGTAAGATTATAATGG + Intronic
1192710352 X:73576463-73576485 GTGGTCCCATAAGATTATAATGG - Intronic
1192841035 X:74856557-74856579 GTGGCCACATAAGATTATAATGG + Intronic
1193137903 X:77993612-77993634 GTGGTCCCGTAAGATTATAATGG + Intronic
1193317864 X:80084862-80084884 GTGGTCCCATAAGATTATAATGG + Intergenic
1193872252 X:86814019-86814041 GTGGTTCCATAAGATTATAATGG - Intronic
1193973178 X:88083529-88083551 GTGGTCCCATAAGATTATAATGG - Intergenic
1194311515 X:92314691-92314713 GTGGTTCCATAAGATTATAATGG - Intronic
1194461996 X:94182074-94182096 GTGGTTCCATAAGATTATAATGG - Intergenic
1194565319 X:95479751-95479773 GTGGTCCCATAAGATTATAACGG - Intergenic
1194697039 X:97065416-97065438 ATGATTCCATAAGATTATAATGG + Intronic
1194918677 X:99735998-99736020 GTGATCCCATAAGATTATAATGG + Intergenic
1194927745 X:99846539-99846561 GTAGTCCCCTAAGATTATAATGG - Intergenic
1195580755 X:106498829-106498851 ATGTTTCCATAAGATTATAATGG + Intergenic
1195873046 X:109506197-109506219 GTGGTTCTATAAGATTATAATGG - Intergenic
1196041296 X:111207467-111207489 GTGGTCCCATAAGATTATAATGG + Intronic
1197138191 X:123087234-123087256 GTGGTCACGTAAGACTATAATGG + Intergenic
1197227421 X:123967879-123967901 GTGGTCCCATAAGATTATAAGGG - Intronic
1197265349 X:124363455-124363477 GTGGTCCCATAAGATTATAATGG + Intronic
1197420904 X:126236057-126236079 GTGTTTATATAAGATGATAATGG + Intergenic
1197919591 X:131578395-131578417 GTGGTCCCATAAGATTATAATGG + Intergenic
1198180790 X:134206663-134206685 GTGGTCCCATAAGATTATAATGG + Intergenic
1198604706 X:138324034-138324056 GTCCTTACCAAAGATGAAAATGG - Intergenic
1198697463 X:139357483-139357505 GTACTTAGCTAAGATGAAAAAGG + Intergenic
1200355478 X:155545618-155545640 GTGGTCCCATAAGATTATAATGG + Intronic
1200619789 Y:5428825-5428847 GTGGTTCCATAAGATTATAATGG - Intronic
1201324401 Y:12739728-12739750 GTGCTTAACTAACATTTTCATGG + Intronic
1201638511 Y:16152418-16152440 GTGGTCCCATAAGATTATAATGG - Intergenic