ID: 1099310991

View in Genome Browser
Species Human (GRCh38)
Location 12:81022632-81022654
Sequence CTCACCAAGGGGAAGCCAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099310991_1099310997 15 Left 1099310991 12:81022632-81022654 CCGTTTGGCTTCCCCTTGGTGAG 0: 1
1: 0
2: 2
3: 14
4: 149
Right 1099310997 12:81022670-81022692 ACCTTAAAAAAATGAAGCCAAGG 0: 1
1: 0
2: 2
3: 49
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099310991 Original CRISPR CTCACCAAGGGGAAGCCAAA CGG (reversed) Intronic
902129756 1:14249578-14249600 CTCCCCAAGGGGAAGCCAGATGG + Intergenic
902363346 1:15954504-15954526 CTGAGCAACTGGAAGCCAAATGG - Intronic
907962898 1:59299097-59299119 CTCAACATGGGGAAGCCATTTGG + Intronic
908673588 1:66576304-66576326 CTCAGCAATGGGAAGCTACATGG - Intronic
911565487 1:99458471-99458493 CTCACCTAAGGGAAGTAAAAAGG + Intergenic
912230049 1:107783049-107783071 CTCACCAAAGGATAGACAAAGGG - Intronic
912966040 1:114238377-114238399 CTCAACTAGGGGTAGCCACAAGG + Intergenic
914746987 1:150508379-150508401 CTCAGAAAAGGAAAGCCAAACGG - Intronic
914913967 1:151807027-151807049 CTCCCCAAGCCGAAGCCCAAAGG + Exonic
915126572 1:153669831-153669853 CTCACCAAATAGAAGTCAAATGG + Exonic
917524958 1:175780376-175780398 CTCACCATGGAGAAGGCAAGAGG - Intergenic
918082231 1:181216658-181216680 ATCACCTAGGAGAAGTCAAAAGG - Intergenic
1064701783 10:18029362-18029384 CTCAACAACGGCAGGCCAAAGGG + Intronic
1065340609 10:24701222-24701244 CTCTCCCTGGGGAAACCAAATGG - Intronic
1067947346 10:50698116-50698138 CTCACCAAGTGAAGGCCAAAAGG - Intergenic
1069020925 10:63487586-63487608 CACATCAATGGGAAGACAAAGGG + Intergenic
1069997732 10:72353374-72353396 CTCTCCAAGGGGAGGCAAACAGG + Intronic
1070882657 10:79863101-79863123 CTCACCAAGTGAAGGCCAAAAGG - Intergenic
1071649225 10:87379403-87379425 CTCACCAAGTGAAGGCCAAAAGG - Intergenic
1072152210 10:92691982-92692004 CTCACCAAGGGAGATCCAAGGGG + Intronic
1075025217 10:118979115-118979137 CTCTCCAGGGGGAAGTCACAGGG - Intergenic
1075326470 10:121536136-121536158 CTCAGCAAGTGGAAACAAAAAGG - Intronic
1076511314 10:131015689-131015711 CTCACAAAGGGGAAGCTGGAGGG + Intergenic
1077285174 11:1762379-1762401 CACACCAAGGGGAAGGCCAGTGG - Intronic
1077368939 11:2172642-2172664 CTCTCCAAGGGGAAGGCATCAGG - Intergenic
1078600979 11:12730455-12730477 CTCACCAAACTGGAGCCAAATGG - Intronic
1079086792 11:17451828-17451850 CTCACCAATGGGATGCGAGAGGG + Intronic
1080572045 11:33565521-33565543 CTCAGGAAGGGGAAGCCAGGAGG + Intronic
1083663479 11:64262791-64262813 CTCACCTTGGGGAAGTCGAAGGG - Exonic
1085261374 11:75207137-75207159 CTGACCAAGGGGAAGCTGAGTGG - Intergenic
1085450150 11:76627001-76627023 CTCACCAAGGGGGAGCCCCTGGG + Intergenic
1089409375 11:118226678-118226700 CACACCAAAAGGTAGCCAAAGGG + Exonic
1090028247 11:123185636-123185658 CTCCCCCAGGGGAAGGCAGATGG + Intronic
1091147968 11:133297184-133297206 CTTACCTAGGGAAAGACAAAGGG + Intronic
1091755658 12:3049769-3049791 CTAACCAAGAGAAAGCCAACTGG - Intergenic
1099310991 12:81022632-81022654 CTCACCAAGGGGAAGCCAAACGG - Intronic
1101360632 12:104023393-104023415 TTCACCCAGGGGAACACAAATGG + Intronic
1101531160 12:105574837-105574859 CTCTCCATGGGGAATCCAAGAGG - Intergenic
1102205109 12:111084925-111084947 CTCACCACAGTGAAGCCACATGG + Intronic
1102261582 12:111446445-111446467 CTCACCAGTGGGAAGAGAAACGG + Intronic
1106257123 13:28031894-28031916 CTCAGTATGGAGAAGCCAAAGGG + Intronic
1109162927 13:58998655-58998677 CTCAGCAAGGGGAAAACAAAAGG + Intergenic
1116416212 14:44680725-44680747 CTCACCAAGAGAAAGATAAAGGG - Intergenic
1118743799 14:68759798-68759820 CTCACCAAGAGGCAGGGAAAGGG - Intergenic
1123979157 15:25583425-25583447 CTCACCAAAGGGAGGAGAAAAGG + Intergenic
1124195450 15:27622499-27622521 CTTACCCAGGGGAAGCTGAAGGG + Intergenic
1124788221 15:32701647-32701669 CTGACCATGGGAAAGCCACATGG + Intergenic
1126330087 15:47522578-47522600 CTCTAAAAGAGGAAGCCAAAGGG + Intronic
1130048271 15:80462714-80462736 CTCACCAAAGAGCAGCCAATGGG - Intronic
1130863766 15:87914364-87914386 ATCACCAAGGGAAAGCCAGCTGG - Intronic
1131597427 15:93812784-93812806 CTTACCAAGAGGAAACAAAAGGG + Intergenic
1133799110 16:9070542-9070564 CACCCCAAGGGGAATTCAAATGG + Intergenic
1137604926 16:49780964-49780986 CACACCAGCCGGAAGCCAAAGGG + Intronic
1138392725 16:56682284-56682306 CTCAACGAGGTGGAGCCAAAGGG + Intronic
1143347411 17:6260078-6260100 CTCAGCAAGGGGAAGACCCAAGG + Intergenic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1145788509 17:27609676-27609698 CACATCTAGGGGAACCCAAAAGG + Intronic
1147181833 17:38691349-38691371 CTCTTCCAGGGGAAGCCAAGCGG + Intergenic
1148457528 17:47819077-47819099 ATCACCAAGGGGAAGCTCCATGG - Exonic
1150240902 17:63631794-63631816 CTTCCCATGGGGAAGTCAAAGGG - Intronic
1151269325 17:72981085-72981107 ATCACCAAGGGGAAGGAAACAGG + Intronic
1152403855 17:80085476-80085498 CCCACCATGGGGAAGCTAGAGGG + Intronic
1157194184 18:45607159-45607181 GTCCCCAAGGGGTAGCCAGAGGG + Intronic
1157506422 18:48229873-48229895 CCCACCACGTGGAGGCCAAAAGG - Intronic
1158500708 18:57998148-57998170 CGGACCAAGGGCAAGCCACATGG + Intergenic
1159607630 18:70491996-70492018 CTCACCAATGCAAAGCGAAATGG - Intergenic
1159729333 18:72005489-72005511 TTCCCCAGGAGGAAGCCAAAGGG - Intergenic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1159892953 18:73969785-73969807 CACACCATGAGGAAGACAAAGGG + Intergenic
930034070 2:47074778-47074800 CTCAGGCAGGGGAAGCCAAAAGG - Exonic
930439855 2:51391601-51391623 CTTAGCCAGGGGAAGCCATAAGG + Intergenic
930710090 2:54542774-54542796 CTCTCCAAGGGGATGGGAAAGGG + Intronic
934923779 2:98367127-98367149 CTCACCAAGGAGAATGAAAATGG - Intronic
934968110 2:98740740-98740762 TAAACCAAGAGGAAGCCAAAAGG + Intergenic
935208538 2:100919050-100919072 CTCACCAATGAGAAGGCACACGG + Intronic
935502337 2:103856858-103856880 CTCAGCAGGGGGAAGAAAAATGG - Intergenic
935588469 2:104823489-104823511 ATCAGCAAGGGGAAGCTAGAAGG - Intergenic
935840800 2:107107991-107108013 CTCTCAAAGTGGGAGCCAAATGG - Intergenic
935978803 2:108606372-108606394 TTCACCAAGGTGAAGCCAGCTGG + Intronic
937679454 2:124627942-124627964 CTGACCAAGTGGAAGAGAAATGG + Intronic
940127519 2:150343653-150343675 CTTAACAATGGGAAGCCAAGTGG - Intergenic
940856544 2:158732687-158732709 GTTACAAAGGTGAAGCCAAAAGG + Intergenic
940859106 2:158753935-158753957 CCCACCAAGGGGAGGAGAAAAGG - Intergenic
942662039 2:178275700-178275722 GTCACTCAGGAGAAGCCAAACGG + Intronic
943264929 2:185717118-185717140 CTCACCAAGGTCAAAACAAAAGG - Intergenic
946438558 2:219675948-219675970 AGCACCAAGGGGAAGCCACATGG - Intergenic
946467382 2:219924187-219924209 CTCACCAAGGGGATGTGGAAAGG + Intergenic
947370641 2:229442048-229442070 CTCACCATTGGGACCCCAAATGG - Intronic
947711610 2:232319603-232319625 CTCACCCAGGGGAGGCCTGAAGG + Intronic
948086098 2:235249637-235249659 TGCACTAAGGGAAAGCCAAATGG - Intergenic
948466373 2:238153655-238153677 CTCACCAAGCGACAGCCATAGGG + Intergenic
1170390692 20:15870587-15870609 ATCACAAAGTGGAAGGCAAAGGG - Intronic
1171073101 20:22094460-22094482 CTCACCCAGGAGGAGCCAGATGG - Intergenic
1171494671 20:25547489-25547511 CTGAACTGGGGGAAGCCAAATGG + Intronic
1172820391 20:37727819-37727841 TTCACCAAAGGGAAGCCAAAGGG - Intronic
1173936917 20:46874562-46874584 CAGTCCAAGGAGAAGCCAAAGGG + Intergenic
1175878161 20:62240205-62240227 CTCAACAAGGGGAAGGTAACTGG - Intronic
1179076460 21:38126858-38126880 CTCACCTAGAGGGCGCCAAAGGG - Intronic
1180802556 22:18638607-18638629 CTCACCATGGGGCAGCCAACCGG - Intergenic
1180853791 22:19034163-19034185 CTCACCATGGGGCAGCCAACTGG - Intergenic
1181219167 22:21356654-21356676 CTCACCATGGGGCAGCCAACCGG + Intergenic
1184179819 22:42813156-42813178 CTCTGCTAGGGGAAGACAAAGGG + Intronic
1184250271 22:43256249-43256271 CTCAACAAGGGGATGCAAAGAGG + Intronic
1185023441 22:48394054-48394076 CCCAGAAAGGGGAAGCCAGATGG - Intergenic
1185416373 22:50712538-50712560 CTCACCCAGGGAAAGCCCAGTGG - Intergenic
949313672 3:2728429-2728451 CACACCAAGGGGGAACCCAATGG - Intronic
952851869 3:37736046-37736068 CACACCAAGGGAAAGCCAGATGG - Intronic
953223813 3:40998533-40998555 CTCACCAAGGTGTAGCAAACTGG - Intergenic
954839360 3:53496717-53496739 ATCACCAAGGGGAAAAAAAAAGG - Intronic
954941422 3:54376406-54376428 TACACCAAAGGGAAACCAAAGGG - Intronic
955856335 3:63277806-63277828 TTCCCCCAGGGGAAGCAAAAGGG - Intronic
959359215 3:105367918-105367940 CTCACCAAGGGGAAGTTACTAGG - Intronic
964049542 3:152373536-152373558 CCCACCAAAGGGAAGCCATGAGG - Intronic
964323350 3:155520771-155520793 CTCACAATGGGTAAGCCACAAGG - Intronic
965012118 3:163107378-163107400 CTCTCCTAGGGGAATGCAAAGGG - Intergenic
968896539 4:3407302-3407324 CTCACGGATGGGAAGCCAACAGG - Intronic
969380551 4:6794116-6794138 CCGACCAAGTGGAAGTCAAAAGG - Intronic
969509458 4:7609506-7609528 CTGACCAAGGAGAAACCACAGGG - Intronic
969537783 4:7767264-7767286 TTCACCAAGAGGGAGCAAAAGGG + Intronic
969815003 4:9680267-9680289 CTCACCAAGTGGATCCCACATGG - Intergenic
971255678 4:25011354-25011376 CTCAGCACGGGGAGGCCAGATGG + Intronic
972959139 4:44430596-44430618 ATCACCAAGGGGAGACAAAAAGG - Intronic
974983085 4:68986105-68986127 CTTACCAAGTAGAAACCAAAGGG + Intergenic
976915846 4:90373918-90373940 CTCCCCCAGGGGAATGCAAAGGG - Intronic
984082599 4:175266778-175266800 CTCACATAGGGGAAGACAGAAGG - Intergenic
985333303 4:188864570-188864592 CACACAAAGGGAAATCCAAATGG - Intergenic
988430887 5:31117297-31117319 CTCATCAAGGGGAATTCAAAGGG + Intergenic
990615210 5:57500852-57500874 CTCACCAAGGAGAGGCCATTGGG - Intergenic
991335668 5:65544196-65544218 CTCACATAGTGGAAGGCAAAAGG + Intronic
991350032 5:65711570-65711592 ATCACCAAAGGGAAGAAAAAGGG + Intronic
993509491 5:88754116-88754138 CTGACCAGTGGGAAGCCAGAGGG - Intronic
995280462 5:110330209-110330231 CACACCTTGGTGAAGCCAAATGG + Intronic
995786550 5:115836480-115836502 CTCACAAAAGTGAAGCTAAATGG - Intronic
999013935 5:148075928-148075950 TTCACCAAGGGTAAGGAAAATGG + Intronic
999171557 5:149599370-149599392 CTCAGGCAGGGGAACCCAAAAGG + Intronic
1000379254 5:160614336-160614358 CCCAGCTAGGGGAAGCCAACAGG + Intronic
1001330775 5:170760867-170760889 CTCACCTAGGGGAGGGCAGAGGG - Intergenic
1002771532 6:293972-293994 ACCACCAATGGGAAGGCAAACGG - Intronic
1003133945 6:3418624-3418646 CTCCCCAGGGGGAAGCCCAGAGG - Intronic
1006096972 6:31662183-31662205 CCCAGGAAGGGGAAGTCAAAGGG + Exonic
1007472264 6:42098689-42098711 CTGGCCTAGGGGAAGCCAAGGGG + Intergenic
1015367325 6:132411008-132411030 CCCAGAAAGAGGAAGCCAAATGG + Intergenic
1021057446 7:16067566-16067588 CTCAGCAAGGTGATGGCAAAAGG - Intergenic
1026011309 7:66638656-66638678 CACAGCAAAGGGAAGCCAATGGG - Intronic
1027593100 7:80138968-80138990 CTCAACTAGGGGAAGTCACAGGG - Intronic
1027656898 7:80941476-80941498 TTCACCAAGGGCAGGCCGAAAGG + Intergenic
1030113996 7:106049522-106049544 TCCACCCAGGGGAACCCAAAGGG - Intergenic
1038571216 8:28664318-28664340 CTCACCAAGGGAAGGCCACATGG - Intronic
1042529500 8:69800523-69800545 CTCACCAAAGGGATACCAACTGG + Intronic
1045503226 8:102759041-102759063 CTCAAGGAGGGGAGGCCAAAGGG + Intergenic
1045922599 8:107548567-107548589 GTAACCAAGGTGAAGACAAAAGG + Intergenic
1047294374 8:123558159-123558181 CTAAGCAAGGGGAAACCAATGGG + Intergenic
1048101770 8:131359540-131359562 CTCACAGAGAGGAAGCAAAAGGG - Intergenic
1049320826 8:141995298-141995320 CTCACCAAGAGGGAGACAGAGGG - Intergenic
1049729513 8:144168698-144168720 CTCACTAAGTGGAGGCCTAATGG + Intronic
1051971535 9:22893570-22893592 CTTACCAAGAGTAAGTCAAAAGG + Intergenic
1053293868 9:36899616-36899638 CTACCCAAGGGCTAGCCAAAGGG + Intronic
1055221731 9:73941691-73941713 CTAATCAAGTAGAAGCCAAAGGG + Intergenic
1061049465 9:128185895-128185917 CCCACCCAAGGGCAGCCAAAGGG + Intronic
1061970442 9:134041990-134042012 CACACCAAGGGGCAGCCCCATGG - Intronic
1186372295 X:8959628-8959650 ATCACCAGGGCGAAGCCACATGG + Intergenic
1186770122 X:12810125-12810147 CTGACGCAGGGGGAGCCAAAAGG + Exonic
1195990735 X:110679686-110679708 CTCTCCTAGGGAAAGCCACATGG + Intronic
1197891160 X:131272043-131272065 TTCACCAAGGGAAAGAGAAATGG - Intergenic
1198120746 X:133590133-133590155 CTCACCTGGGGGAAGGCAAAAGG - Intronic
1198271359 X:135059135-135059157 CTCAACAAGGGGCAGCCACTGGG + Intergenic