ID: 1099311851

View in Genome Browser
Species Human (GRCh38)
Location 12:81035806-81035828
Sequence TAAGAAAAGCTTTATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 1, 2: 0, 3: 55, 4: 460}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099311849_1099311851 13 Left 1099311849 12:81035770-81035792 CCAGAAAGATAAATCAGCATTCT 0: 1
1: 0
2: 2
3: 34
4: 288
Right 1099311851 12:81035806-81035828 TAAGAAAAGCTTTATGAGGTAGG 0: 1
1: 1
2: 0
3: 55
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099311851 Original CRISPR TAAGAAAAGCTTTATGAGGT AGG Intronic
902788925 1:18751899-18751921 TAAAAACAGCCTTGTGAGGTGGG + Intergenic
902829180 1:18998831-18998853 TAAGAAAAGCTTCATGAGAGAGG + Intergenic
903273029 1:22203668-22203690 TCAGAAAAGCTTTGTAGGGTAGG + Intergenic
903616362 1:24661661-24661683 GAATAAAAGCTTTAGGAGGTTGG - Intronic
903617426 1:24671074-24671096 TCACAAGAGCTTTATCAGGTAGG + Intronic
904444220 1:30554821-30554843 TAAGAAAAATATTATGATGTGGG + Intergenic
904800297 1:33087838-33087860 TAAGAAGTGCCTGATGAGGTGGG - Intronic
904934428 1:34119332-34119354 AAAGGAAAGCTTTATGACATTGG + Intronic
905559183 1:38912789-38912811 TCACAACAACTTTATGAGGTAGG + Intronic
906544631 1:46612415-46612437 AAAGAAAAGCCCTCTGAGGTGGG + Intronic
908364287 1:63402302-63402324 TATGATAAGCTGTAAGAGGTGGG - Exonic
908476772 1:64496728-64496750 TAAATAAAGCTTTCCGAGGTTGG - Intronic
908625164 1:66032157-66032179 TCAAAACAGTTTTATGAGGTGGG - Intronic
908649599 1:66317397-66317419 TAAGAAAGTCTTTAGGAGGAAGG + Intronic
909013494 1:70358954-70358976 TCAGAAAAGCTTTCTGGGGCTGG + Intronic
909143985 1:71905452-71905474 CAAGAAAATCATTATGTGGTTGG + Intronic
909602555 1:77475822-77475844 TAAGAAGAGCTTTGTCAGGCTGG - Intronic
909853530 1:80500074-80500096 TAAGAAACCCATTATGAGCTAGG - Intergenic
910084885 1:83388526-83388548 TCACAACAGCGTTATGAGGTAGG - Intergenic
910893681 1:92044743-92044765 GAAATAAAGATTTATGAGGTTGG + Intronic
910894444 1:92053355-92053377 TAAGAAGAGCATTATGAGGCTGG + Intronic
912046174 1:105460879-105460901 TGAGAAAAGCTGTAGCAGGTGGG + Intergenic
912768758 1:112442497-112442519 CAAGAATAACTTTTTGAGGTGGG - Intronic
913368618 1:118071150-118071172 TAGGAAGTGCTATATGAGGTGGG - Intronic
914685165 1:149972193-149972215 TCATAACAGCTCTATGAGGTAGG - Intronic
915587696 1:156852991-156853013 AAAGAAAACCTTTCAGAGGTGGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916142828 1:161713977-161713999 TAAGAATAGCTGAATGAGGCTGG - Exonic
916517917 1:165537355-165537377 GAAGAAAACCTTTATGAGGAAGG + Intergenic
917003873 1:170389400-170389422 TAGGAAAATCTTTATGACATTGG - Intergenic
917977406 1:180249153-180249175 TAATAAAAACCTCATGAGGTAGG - Intronic
918496928 1:185150584-185150606 TAAGAAAGACTTTAAGAAGTAGG - Intronic
918904329 1:190473902-190473924 TAAGAAAAAATACATGAGGTGGG - Intronic
919192253 1:194237264-194237286 GAAGAAAAGCTCTATGACATTGG + Intergenic
919362599 1:196613143-196613165 AAGGAAAGGCTCTATGAGGTAGG - Intergenic
919701236 1:200633115-200633137 TGACAAAAGCTCTATGAAGTAGG - Intronic
920188620 1:204178285-204178307 ATAGAAAAGCTCTATGGGGTTGG - Intergenic
920558649 1:206922934-206922956 TCAGAAAAGCCATGTGAGGTGGG - Intronic
920840358 1:209548709-209548731 AAACAATAGCTGTATGAGGTAGG - Intergenic
920856443 1:209666369-209666391 TACAAACAGCTCTATGAGGTAGG - Intergenic
921028363 1:211312231-211312253 TAAGAAAAGCATTATAATTTTGG - Intronic
923413243 1:233730697-233730719 TGAAAAAGGATTTATGAGGTTGG - Intergenic
924530994 1:244893826-244893848 GAAGAAAAGCATTGTGAGCTGGG - Intergenic
924756841 1:246948900-246948922 TCAGAACAGCTCTGTGAGGTGGG - Intronic
924873773 1:248077608-248077630 GAAGAAAATCTTTATGACTTGGG + Intronic
924938982 1:248797075-248797097 TAAAAAATCATTTATGAGGTGGG - Intergenic
1064048328 10:12039143-12039165 TACTAAAATCTTTATGAGGTGGG + Intronic
1064425354 10:15224927-15224949 AGAGAAAAACTATATGAGGTTGG - Intronic
1065030587 10:21582074-21582096 TAAGAAAAGCTATATGAATGTGG - Intronic
1066517083 10:36174835-36174857 GAAGAAAAACTTTATGACATTGG + Intergenic
1066522238 10:36234306-36234328 GAAAAAAAGCTTGATGATGTTGG + Intergenic
1068379080 10:56225128-56225150 TAAGATAAGCTATAAGAGGGAGG + Intergenic
1068496585 10:57791010-57791032 TAAAAAAAGATTTGTGAGGTTGG + Intergenic
1068792565 10:61043256-61043278 TATAAAAAGCTGCATGAGGTTGG + Intergenic
1068802691 10:61160236-61160258 TGGGAAAAGCTGCATGAGGTGGG + Intergenic
1069165340 10:65151162-65151184 CAAAAAAATCTTTATGATGTTGG + Intergenic
1069411938 10:68163006-68163028 AAACAAAAGCCTTATGAGGCTGG + Intronic
1069695174 10:70381098-70381120 TAAGAGAAGTTTTTTGAGGAAGG + Intronic
1070599561 10:77856400-77856422 TGAGTGAAGCTTTATGTGGTTGG - Intronic
1071194357 10:83140509-83140531 CAAGAAAATCTTTATGAGCTTGG - Intergenic
1072899441 10:99394203-99394225 GAAGAAAATCTTTGTGGGGTGGG - Exonic
1073417026 10:103392642-103392664 AAAGAAAAGCTTTTGGAAGTAGG + Intronic
1074090001 10:110242180-110242202 TAAGAAAAGCTTTAGAAGGGTGG - Intronic
1074737461 10:116451342-116451364 GAAGAAAAGCTTTATGACATTGG + Intronic
1075231873 10:120686920-120686942 AAAAAAAAGCTTCCTGAGGTGGG + Intergenic
1075685445 10:124361946-124361968 TAAGAAACTCTTTCTGAGGCTGG - Intergenic
1077084857 11:744543-744565 TAAGAAAATATTTTTGAGGCCGG + Intergenic
1077577530 11:3395842-3395864 TGAGGAAATCTTTAAGAGGTTGG - Intergenic
1077855850 11:6123871-6123893 TATGGAAAACTTTATGAGCTCGG - Intergenic
1078129866 11:8604625-8604647 TAGGAAAAGCTCTCTGAGGAGGG + Intergenic
1078436401 11:11329140-11329162 TCATAACAGCCTTATGAGGTAGG - Intronic
1078554954 11:12317039-12317061 AAAGAGAAACTCTATGAGGTTGG - Intronic
1078723229 11:13903167-13903189 GAAGAAAGGCTTTCAGAGGTTGG + Intergenic
1078808799 11:14736866-14736888 TAAGAAAAGATTAAAGAAGTGGG + Intronic
1079009763 11:16818276-16818298 TCAGAAGAGCCTTATGAGGCAGG - Intronic
1079416502 11:20242547-20242569 TAAAAAAATCTTTATTAGGGTGG + Intergenic
1079525571 11:21383784-21383806 TAAAAAAAGCATTTTGAGGGGGG - Intronic
1079551211 11:21700596-21700618 TCACAAAACCTTTATAAGGTAGG + Intergenic
1079899381 11:26162526-26162548 GAAAAAAATCTTTATGAGCTGGG - Intergenic
1080398996 11:31916575-31916597 TCAGAACAGTCTTATGAGGTAGG - Intronic
1080459199 11:32438683-32438705 TCAGAACAACTCTATGAGGTGGG - Intergenic
1081251157 11:40836181-40836203 TAAGAGAAGATTGGTGAGGTTGG - Intronic
1081285064 11:41257997-41258019 AAAGAAAAGCCTCATGAGCTAGG + Intronic
1082228818 11:49740394-49740416 TGAGAAAGGATTTGTGAGGTTGG - Intergenic
1082252487 11:49997082-49997104 TGAAAAATGATTTATGAGGTTGG + Intergenic
1082555364 11:54557799-54557821 TGAAAAACGATTTATGAGGTTGG - Intergenic
1083426953 11:62593072-62593094 TGGGAACAGCTTTATGAGATAGG - Intergenic
1084373115 11:68757858-68757880 TAAGTTAAGCTTTAAGACGTTGG - Intronic
1086570136 11:88273838-88273860 TAAGAAAACCTTTATTATATTGG + Intergenic
1086621249 11:88888729-88888751 TGAGAAAGGATTTGTGAGGTTGG + Intronic
1086650448 11:89282073-89282095 TTTGAAAAGGTTGATGAGGTGGG + Intronic
1087518906 11:99203892-99203914 TAAGAAATGTTATATGAGGCCGG - Intronic
1087652644 11:100885953-100885975 TAAGCAATTCTTGATGAGGTAGG + Intronic
1087987476 11:104701919-104701941 TCAAAACAACTTTATGAGGTAGG - Intergenic
1089027253 11:115283960-115283982 GAAGAAAAGCTTTAAGGGATCGG + Intronic
1089357548 11:117864500-117864522 CAGCAAAAGCTTTATGACGTTGG + Intronic
1090046320 11:123337610-123337632 TAAGAAAATCTTTGTGACCTTGG + Intergenic
1090291005 11:125544844-125544866 TATTAAAAACTTTATGAGGCTGG + Intergenic
1090544044 11:127742813-127742835 AAAGAAAATCTTTATGACTTTGG - Intergenic
1091179661 11:133592349-133592371 AAAGAAAAGCTTTTGCAGGTGGG - Intergenic
1091469106 12:711244-711266 AAAGAAAAGATTAATGAAGTTGG - Intergenic
1091950598 12:4590000-4590022 TCACAAAAGCCTTATGAGGTAGG + Intronic
1093002285 12:14010979-14011001 TAAAAGAAACATTATGAGGTTGG + Intergenic
1093394413 12:18663659-18663681 GGACAAAAGCTTTATGATGTTGG + Intergenic
1094348613 12:29498531-29498553 AAATAAAAGCTTCTTGAGGTAGG + Intergenic
1094689656 12:32756121-32756143 TCACAACAGCCTTATGAGGTAGG - Intergenic
1094745492 12:33340038-33340060 AAAAAAAAGCCTGATGAGGTTGG - Intergenic
1094747012 12:33356630-33356652 TATGAAAAGTTATATGAGTTAGG - Intergenic
1095276429 12:40288963-40288985 TAAGAAAAGGTTTCTTAAGTGGG - Intronic
1095413519 12:41949516-41949538 TAAGAAATGTTTTATGTGGTTGG + Intergenic
1095555577 12:43499830-43499852 TAACAAAACCTTTCTGAGGGTGG + Intronic
1095717322 12:45360685-45360707 TAAAAAAAACTTTATGACTTTGG - Intronic
1095796187 12:46221351-46221373 TAAGAAATACTAGATGAGGTTGG - Intronic
1096279879 12:50243865-50243887 TAACAAAAACTATATGAGGAAGG - Intronic
1096903672 12:54912563-54912585 AAATAAAAGATTTATGTGGTAGG + Intergenic
1097601288 12:61695713-61695735 TGAAAAAGGATTTATGAGGTTGG + Intergenic
1097712429 12:62931750-62931772 TCATAAAAGCCTAATGAGGTAGG - Intronic
1098445265 12:70560131-70560153 TAAGAAAAGGTATATGAGGCTGG - Intronic
1098931918 12:76427101-76427123 TAATGGAAGCTTTATGAAGTTGG - Intronic
1098997894 12:77142925-77142947 TAAGAAAAGCTAAATGCGCTGGG + Intergenic
1099043314 12:77683091-77683113 GAAGAAAAGCTCTATGACATTGG - Intergenic
1099311851 12:81035806-81035828 TAAGAAAAGCTTTATGAGGTAGG + Intronic
1099505300 12:83468513-83468535 TGAGAAAAGATTTAGTAGGTTGG - Intergenic
1099796197 12:87403183-87403205 TAAAAAAATCCTTAGGAGGTTGG - Intergenic
1100101930 12:91119374-91119396 CAAAGAAAGCTTTATGAGGTAGG - Intergenic
1100179030 12:92063639-92063661 GAAAAAAAGCTTTTTAAGGTAGG + Intronic
1100648629 12:96559936-96559958 TAAGAAAATCTTCATGATCTGGG - Intronic
1100724663 12:97396012-97396034 CAAGAAAATCTATATGAGATTGG + Intergenic
1100933265 12:99634681-99634703 GCAGAAAAGCTTTATGACATTGG + Intronic
1100945800 12:99782657-99782679 TCACAAAAGCCTTGTGAGGTGGG - Intronic
1100977434 12:100137105-100137127 TAGGAAAAGCTATCTGAGGCTGG - Intronic
1101930025 12:109006345-109006367 TAAGAAACGCTTTCTGGGGTGGG - Intronic
1102370673 12:112380967-112380989 TAAGGAGAGCTTTCTGGGGTAGG - Intronic
1103769039 12:123305801-123305823 TGAGAAAAACTTTAAGAGGAAGG + Intronic
1103981115 12:124737626-124737648 TGAGCAAAGCTTTGGGAGGTGGG - Intergenic
1104079253 12:125415788-125415810 TGAGAAATGATTTTTGAGGTCGG + Intronic
1104329876 12:127834710-127834732 TAAGAAATGCTTTAGTAGGTGGG + Intergenic
1105053485 12:133076900-133076922 TAAGAAAAGCTTGAAAAGATGGG + Intergenic
1105461988 13:20600388-20600410 CAAGAAAGGCTTTATGAAGGAGG + Intronic
1105668709 13:22588728-22588750 TAAGAAAAGTATTAGGAGGAGGG + Intergenic
1105913053 13:24889231-24889253 TAAGAAATGTTTTATTAAGTTGG + Intronic
1106704967 13:32270501-32270523 TAAAAATAGCTTTTAGAGGTCGG - Intronic
1107252914 13:38387499-38387521 AAAGAAAAGCTTTATGACACTGG - Intergenic
1107309897 13:39065593-39065615 GGAGAAAAGCTTTATGACATTGG - Intergenic
1108010546 13:46003903-46003925 GAAGAAAAGCTTCATGACATTGG + Intronic
1108429245 13:50337631-50337653 AAAGATGAGCTTTATGAGTTAGG - Intronic
1108857889 13:54818757-54818779 AAAGAAAAGCTATATTAGGCCGG - Intergenic
1109474572 13:62862545-62862567 TAAGAAGAGCTATATGATGATGG + Intergenic
1109483538 13:62988557-62988579 TAAGAGAAGCTTAAAGAAGTGGG - Intergenic
1109511336 13:63378746-63378768 TGAGAAAAGCTTTTTGACATCGG - Intergenic
1110559161 13:76891723-76891745 TAACAATAACTTTATGAGGTTGG + Intergenic
1110564964 13:76948892-76948914 TAAGATAAGCTTTTTGAGGCAGG + Intronic
1110580514 13:77118299-77118321 TCAGAAATGCTTGATGAGGCAGG + Intronic
1110849165 13:80224180-80224202 TAACAAAAGTTTTATGGGGCTGG - Intergenic
1111624152 13:90762419-90762441 TAAGATAAAGTTTATGAGCTAGG + Intergenic
1111754270 13:92372820-92372842 TAAGAAAAGCTATCTGAACTGGG + Intronic
1112964613 13:105172759-105172781 TAAAAAAAGCTCTATGATATTGG + Intergenic
1113132191 13:107050568-107050590 TAACAAAAGCAATATGAGGAAGG + Intergenic
1113362779 13:109646242-109646264 TTAGACAAGCTCTTTGAGGTGGG + Intergenic
1113608304 13:111625983-111626005 TCAGAATAGCAGTATGAGGTGGG + Exonic
1113630067 13:111876283-111876305 TAAGAAGAGCCTGATAAGGTGGG + Intergenic
1114777922 14:25506217-25506239 TGACAATAGCTGTATGAGGTGGG + Intergenic
1115891713 14:38037730-38037752 TAAGATAAGCCTGAAGAGGTAGG - Intronic
1116538807 14:46071120-46071142 TAAGAAAACCTTTATGAAGAGGG - Intergenic
1117303486 14:54450879-54450901 TTAAAACAACTTTATGAGGTAGG - Intergenic
1117335190 14:54751279-54751301 TAAGAAGAGGTTTATGATGATGG + Intronic
1117373832 14:55103105-55103127 TAGGAAAAACGTTATGTGGTGGG - Intergenic
1118952235 14:70445502-70445524 TAAAAAAGGATTCATGAGGTTGG - Intergenic
1120297327 14:82659773-82659795 GAAGAAATGCTCTATGAGCTGGG + Intergenic
1120459364 14:84774185-84774207 GGAGAAAAGCTTCATGATGTTGG - Intergenic
1120783070 14:88503338-88503360 TAACAAAATCTTTTTGAGCTTGG + Intronic
1121040616 14:90743731-90743753 TCACAAAAGCTTCATGAAGTAGG + Intronic
1121436283 14:93922391-93922413 TAAGAGAAGCTTTTTTAGGCTGG + Intronic
1121519661 14:94577336-94577358 TAGGAAAAGCTTTGTGAAGGTGG - Intronic
1122395920 14:101430519-101430541 GAAGAAAACCTTTATGACTTGGG - Intergenic
1123020842 14:105397244-105397266 TCAGAACAGCTCTGTGAGGTAGG - Exonic
1124922470 15:34039764-34039786 TCATAACAGCTCTATGAGGTAGG + Intronic
1125420164 15:39497238-39497260 TAACAATATCCTTATGAGGTAGG - Intergenic
1125737379 15:41936371-41936393 TCACAAAAGCTCTGTGAGGTAGG - Intronic
1126219059 15:46191173-46191195 TAAGTTAAGCTATATGATGTGGG - Intergenic
1126376099 15:47998138-47998160 TCAGAACAGACTTATGAGGTAGG + Intergenic
1127157824 15:56148305-56148327 TAAGCAAAGATTTATGAAGACGG + Intronic
1127562754 15:60156631-60156653 TAAGAAAAGCATAATGGTGTAGG + Intergenic
1128199732 15:65793984-65794006 TAAAAAAAGCTTTTTAAGGTAGG - Intronic
1130213915 15:81951026-81951048 TCAAAACAGCTTTATGAGATAGG - Intergenic
1130513484 15:84607896-84607918 TAAGAGCAGCTTTATGAAGAGGG - Intronic
1131610957 15:93963186-93963208 AAAGAAAAGTTATATGTGGTAGG - Intergenic
1132536788 16:485784-485806 TAAGCAAAGATTTATCAAGTGGG - Intronic
1132559734 16:588095-588117 TCAGAAACGCTTTCTGAGGCCGG - Intergenic
1133641775 16:7724092-7724114 TAAGACAAGCTTTATAAGACAGG - Intergenic
1134418264 16:14062978-14063000 TAAGACAAGCCGTATGATGTCGG - Intergenic
1134467580 16:14492923-14492945 TGATAAAAGCTTTGTAAGGTAGG - Intronic
1135092403 16:19529069-19529091 TCAAAATAGCCTTATGAGGTAGG - Intronic
1135100882 16:19604208-19604230 TATGAAAATTTTTAAGAGGTTGG - Intronic
1136351667 16:29712764-29712786 TAAAAAAGGATTTGTGAGGTTGG + Intergenic
1137297111 16:47105407-47105429 TGAGAAAAGCTTCATGACATTGG + Intronic
1137963053 16:52904491-52904513 GAAGAAAAGCTTTATGACATTGG + Intergenic
1140528093 16:75640791-75640813 TCAGAAAAGCTTTGTGAGAAAGG - Intronic
1140971235 16:80014785-80014807 TCACAAAAACTCTATGAGGTTGG - Intergenic
1141209896 16:81968402-81968424 GAAGAAAAGCTTCATGACATGGG - Intergenic
1202995935 16_KI270728v1_random:110464-110486 TAAGAAAAACTTTTTGAGACAGG + Intergenic
1203022622 16_KI270728v1_random:422806-422828 TAAGAAAAACTTTTTGAGACAGG + Intergenic
1142995880 17:3760167-3760189 TATGAAAAGTGTTTTGAGGTGGG - Exonic
1144100096 17:11935256-11935278 TAAGAAAACCTCCATGAGGCCGG - Intronic
1144123997 17:12183845-12183867 TAAGAAAACCTCCATGAGGCCGG - Intergenic
1144378459 17:14669021-14669043 TTTTCAAAGCTTTATGAGGTAGG + Intergenic
1146282882 17:31557069-31557091 CCAGAAAAGCTGTATGATGTTGG + Intergenic
1148377863 17:47165738-47165760 GAAAAAAATCTTTATGAGCTAGG - Intronic
1149470178 17:56909989-56910011 TAAGAACAACACTATGAGGTAGG + Intronic
1151525259 17:74661422-74661444 TAAGAAAAGATTTTAGAGGGCGG + Intergenic
1152053853 17:78005808-78005830 TTGTAACAGCTTTATGAGGTAGG - Intronic
1153139838 18:1958040-1958062 GAAGAAAAGCTTCATGATATTGG - Intergenic
1154112041 18:11578605-11578627 TCACAACATCTTTATGAGGTAGG + Intergenic
1155748358 18:29389390-29389412 TTAGAGAAGCTTTATTAAGTAGG - Intergenic
1158527707 18:58230013-58230035 AAAGGAAAGCTTTTTCAGGTTGG + Intronic
1158867015 18:61647836-61647858 TAAAAAGAGCTTTGTTAGGTTGG - Intergenic
1159073416 18:63652022-63652044 TGAGAAAAGCTTCATGATATTGG + Intronic
1159729053 18:72002218-72002240 TGAGAAAAACCTTATGTGGTTGG - Intergenic
1162306905 19:9880370-9880392 GAGCAGAAGCTTTATGAGGTTGG - Intronic
1162835422 19:13313937-13313959 TAAGACAAGTTTTCTGAGTTAGG - Intronic
1163626705 19:18394264-18394286 AAAGAAAAGCTTTTCTAGGTTGG - Intronic
1164418341 19:28065138-28065160 AGAGAGAAGCTCTATGAGGTTGG - Intergenic
1166469768 19:43069752-43069774 GAAGAAAAGCTTCATGATGCTGG + Intronic
1167535368 19:50047375-50047397 TCAGAAAAGCCCTCTGAGGTAGG - Exonic
925791850 2:7497239-7497261 TCAGAACAGCTTCATGTGGTAGG - Intergenic
925811699 2:7707747-7707769 TTAGAAAAGCATTATGATGAAGG - Intergenic
926932516 2:18054628-18054650 TAAGAAAAGGACTATGAGGAAGG + Intronic
927188591 2:20500197-20500219 TAAGGAACGCTTTCTGGGGTAGG + Intergenic
929339574 2:40798235-40798257 TAACAAAAGCATTGTGAAGTGGG + Intergenic
930060111 2:47281479-47281501 CAGGAAAAGCTTTATGACATTGG - Intergenic
930445467 2:51465656-51465678 TTAGAAAAGCTTTATGATGCTGG - Intergenic
931552674 2:63463930-63463952 GAGGAAAAGCTTTATGACATTGG + Intronic
931773117 2:65516572-65516594 TCACAACAGCTTTATGAAGTTGG + Intergenic
932036125 2:68248771-68248793 TAGGAAAAGTTTTATGAAGGAGG - Intronic
932192866 2:69755603-69755625 TAAAAAAATTTTTTTGAGGTAGG - Intronic
932694682 2:73945533-73945555 TCAAAACAGCTTCATGAGGTAGG - Intronic
932918745 2:75885353-75885375 TAAGAAAATCTTTGTGATGTAGG - Intergenic
933022396 2:77210335-77210357 AAAGGAAAGCTTTATAGGGTGGG - Intronic
933249221 2:80010010-80010032 TAAGAAAAGTTATTGGAGGTAGG - Intronic
933704435 2:85279261-85279283 TAAGAAGAGCTTTATTGGCTGGG + Intronic
933807086 2:86007010-86007032 TAAGAAAAGTTCTATGACATTGG + Intergenic
936720847 2:115251235-115251257 TCAGAAAAGCTTTGAGAGGTAGG + Intronic
937650817 2:124316929-124316951 CAAAAAAAACTGTATGAGGTAGG + Intronic
938827016 2:135015921-135015943 TAAGAAAATCTTTGTGACCTTGG - Intronic
939821675 2:146964842-146964864 TAAAAAAAGATTTGTGAAGTGGG - Intergenic
939887057 2:147692521-147692543 TAATAAATTCTGTATGAGGTAGG - Intergenic
939973553 2:148689516-148689538 TCAGAAATCCTTTATGGGGTGGG + Intronic
940523642 2:154783598-154783620 TCATAAAAACTTCATGAGGTAGG + Intronic
940968326 2:159865689-159865711 GAAGAAAGACTTTGTGAGGTTGG + Intronic
941090951 2:161175022-161175044 TAGGAAAGGCTTTGAGAGGTAGG - Intronic
941522648 2:166566556-166566578 TAGGAAAAGCTTTATGACATTGG + Intergenic
941544668 2:166833987-166834009 GAAGAGAAGATTTATGAGTTAGG - Intergenic
941898571 2:170655629-170655651 TAAGAATTGCTTTTTGAGGCCGG - Intergenic
942066322 2:172275064-172275086 AAAAATAAGCTTTATGGGGTAGG + Intergenic
942618568 2:177822166-177822188 GAAGAATATCTTCATGAGGTTGG - Intronic
942700762 2:178707021-178707043 TAAAATAAGCCTTAGGAGGTTGG + Intronic
942832004 2:180248093-180248115 TAATAAAATCCTCATGAGGTAGG + Intergenic
942901020 2:181118781-181118803 CAACAAAACCTCTATGAGGTAGG + Intergenic
943137426 2:183932270-183932292 TAAGAAAAGTCTTACCAGGTTGG + Intergenic
944352812 2:198749043-198749065 TAAGAAAAACTTGATGATCTTGG - Intergenic
946185314 2:217977641-217977663 TCACAACAACTTTATGAGGTAGG + Intronic
947509967 2:230743072-230743094 TATGAATAGCTTTCTAAGGTGGG + Intronic
947700081 2:232226446-232226468 TCACAAAAGTTCTATGAGGTAGG - Intronic
1169150980 20:3289173-3289195 TTAAAAAAGCTTTTAGAGGTGGG - Intronic
1169998394 20:11585641-11585663 TAATAAAAGCACTATGAGTTGGG + Intergenic
1172066667 20:32225818-32225840 AAAAAACAGCTTTATGATGTGGG + Intronic
1172901872 20:38341125-38341147 TCATAACAACTTTATGAGGTAGG - Intergenic
1173259845 20:41424208-41424230 AAAGAAAAGCAATATGAGATGGG - Intronic
1173807120 20:45933501-45933523 TCACCAAACCTTTATGAGGTAGG + Intergenic
1173896008 20:46551144-46551166 TAAAAAAAGTTTAATGAGGCTGG + Intergenic
1173954856 20:47023524-47023546 GAAGAAAAGATTTATGAACTTGG - Intronic
1174245402 20:49175783-49175805 AAAAAAAGGCATTATGAGGTTGG - Intronic
1175136328 20:56827122-56827144 TAAGCAAACTTTTATGAGTTTGG - Intergenic
1175168321 20:57062214-57062236 GAAGCAAAGCTTTCTGAGGCAGG - Intergenic
1175349280 20:58307378-58307400 TTATAAAAGCCTTTTGAGGTGGG + Intergenic
1175648854 20:60699145-60699167 AAAGAAAAACTGCATGAGGTGGG + Intergenic
1177767876 21:25479222-25479244 AAAGAAAAGCTCTATGACATTGG - Intergenic
1177968919 21:27763712-27763734 GAAGAAAAGCTTCATGACATAGG + Intergenic
1180848259 22:18996217-18996239 TAAGAAATGCATAATAAGGTGGG + Intergenic
1181742839 22:24935144-24935166 TCAGAACAACCTTATGAGGTAGG + Exonic
1182063032 22:27411323-27411345 TAACCATAGCTGTATGAGGTAGG - Intergenic
1182683297 22:32099969-32099991 TAAGAAAGGCTTTATTAGCAGGG + Intronic
1182827917 22:33281844-33281866 TGAAAATAACTTTATGAGGTGGG - Intronic
1182924916 22:34113181-34113203 TCATGAGAGCTTTATGAGGTAGG + Intergenic
1184100414 22:42339052-42339074 TCAGAAAAGCTCTGTGAGGCAGG + Intronic
1184846029 22:47087380-47087402 TAAGAATAGCTTTCTGATTTGGG - Intronic
949250875 3:1982338-1982360 GAAGAAAATCTTGATGAGCTTGG + Intergenic
949681648 3:6520646-6520668 TAAGAAAAGCTTTGAAAGTTTGG - Intergenic
950048273 3:9964940-9964962 TAAAAAATGCTTTATGAGTTGGG + Intronic
951202052 3:19886203-19886225 TATAAAAAGCTTCATTAGGTAGG + Intronic
951294277 3:20914893-20914915 TAAAAAAGGCTTTATGAGAAAGG + Intergenic
952244675 3:31574023-31574045 TCAGGAAAACTTTATGAGGTTGG + Intronic
952327094 3:32330896-32330918 TGAGAAAAGCTTCATGACATTGG + Intronic
952492900 3:33888748-33888770 GAAGAAAAGCTACATGAGGAAGG + Intergenic
953285371 3:41601667-41601689 TAAGATAAGCATTATGGGTTTGG - Intronic
954995009 3:54873137-54873159 TCAGAACAGCTCTATGAGGTGGG - Intronic
955466922 3:59247010-59247032 TCACAAAAACTTCATGAGGTAGG + Intergenic
955495382 3:59526277-59526299 GAAGAAAAGCTTCATGACGTTGG + Intergenic
955968388 3:64412504-64412526 TAACAACAGCTTTACAAGGTAGG - Intronic
957995845 3:87688735-87688757 TTAGAAAAGCTTCATGAAATAGG + Intergenic
958712359 3:97732714-97732736 TCACAATAACTTTATGAGGTAGG - Intronic
960025958 3:113009736-113009758 TCACAAAAGCTCTGTGAGGTGGG - Intronic
960212069 3:114981644-114981666 TAACAAAAACTCTAGGAGGTAGG + Intronic
960767036 3:121143893-121143915 GAAGAAAAGCTTCATGACGCTGG + Intronic
960935410 3:122897526-122897548 CGAGAAAATCTTTATGAGCTTGG - Intergenic
962018194 3:131466381-131466403 TAAGAAAATTTGTATTAGGTTGG + Intronic
962474179 3:135741194-135741216 TAAAAAAAGATTTAGGAGGGAGG - Intergenic
962806933 3:138934422-138934444 TTACAAAAGCTTGATGTGGTAGG + Intergenic
963482457 3:145893352-145893374 TAAGAAAATATTTATGATATTGG - Intergenic
963875334 3:150468897-150468919 TAAGAAAGGCTGCATGGGGTAGG + Intergenic
963959022 3:151287294-151287316 TAAGAAAGGATTTTGGAGGTAGG - Intronic
964944715 3:162206312-162206334 TAATAAAAGCATTATATGGTGGG + Intergenic
965966646 3:174499508-174499530 CAAGAAAAGCTTTGTGTGCTTGG - Intronic
966334387 3:178852143-178852165 TAACATAAGCTTCAAGAGGTGGG + Intergenic
967143271 3:186582449-186582471 TAAAAAAAGCTTTAAGACTTAGG + Intronic
967320723 3:188192197-188192219 TTAGAAAGGCTTCATGGGGTTGG + Intronic
969122556 4:4920697-4920719 TAAGAAAAGCTTGGTGAGGGAGG - Intergenic
969361537 4:6667163-6667185 TAAGAAATGGTTTCTGAGGCTGG - Intergenic
970041689 4:11805568-11805590 TAAGAAAATTTTTATAAGATGGG - Intergenic
970091470 4:12412983-12413005 TAATAAAAATTTTATGAGGTAGG + Intergenic
970287115 4:14530295-14530317 TCAGAACAGCTCTATGTGGTAGG + Intergenic
970298639 4:14658732-14658754 TAGGGAGAACTTTATGAGGTGGG + Intergenic
970504482 4:16713591-16713613 TTTTAAAAGCTTTATTAGGTTGG + Intronic
971519054 4:27526328-27526350 GAAGAAAGGCTTTCTTAGGTTGG + Intergenic
972224319 4:36994977-36994999 TAAGAAAAGCTTTTTGGTTTGGG + Intergenic
972990357 4:44815963-44815985 CAAAAAAATCCTTATGAGGTAGG - Intergenic
973217288 4:47683505-47683527 TAAGAAAATGTTTAAGAAGTGGG - Intronic
973243599 4:47985900-47985922 TCAGAAAAACCTAATGAGGTAGG - Intronic
973574400 4:52272148-52272170 GGAGAAAAGCTTTATGACATAGG + Intergenic
975403453 4:73963378-73963400 TAAGAATTGCTTTATGAGTCTGG + Intergenic
976866103 4:89729189-89729211 TATGAAATGCCTTCTGAGGTAGG - Exonic
977143403 4:93404550-93404572 TTATAACAGCTTTATGAGGTAGG - Intronic
977636226 4:99301732-99301754 TCAGAATAACTCTATGAGGTAGG + Intergenic
977948803 4:102945940-102945962 TAAGAAATGCTTTAAAAGATTGG + Intronic
978368023 4:108002976-108002998 TCACAACAGTTTTATGAGGTGGG + Intronic
978465890 4:109008486-109008508 TAAGAAATGCTTTGGGATGTGGG + Intronic
978496288 4:109362818-109362840 TTATAAAAGCTCTATTAGGTAGG - Intergenic
978586127 4:110277608-110277630 TAAGAAAACCTTTAAGAAGTGGG - Intergenic
978704085 4:111684346-111684368 TAATAAAAGCTATATGAGAGGGG - Intergenic
978742486 4:112152875-112152897 TCATAAAAACTTTAAGAGGTGGG - Intronic
978868448 4:113544575-113544597 TCAGAACAACTTTATGAGGAAGG - Intronic
979083375 4:116372773-116372795 TAAGTATAACTTTATGAGTTTGG - Intergenic
979378468 4:119978026-119978048 CAAGAAAAGCCTTAAGGGGTTGG - Intergenic
979470820 4:121093819-121093841 TAAGGAAAGATTTAAGAAGTGGG + Intergenic
980324291 4:131322280-131322302 TAAGAAAAGCTTAAGGACATTGG + Intergenic
980595623 4:134950738-134950760 TAAGAAAGGCTTAATGAGATTGG - Intergenic
980750588 4:137081855-137081877 TTATAAAAGCTTCATAAGGTAGG + Intergenic
980786277 4:137560207-137560229 TTACAAAAACTTTATGAGGCAGG + Intergenic
981527219 4:145719068-145719090 GAACATAAGCTTTATGAGGGAGG + Intronic
982129179 4:152212059-152212081 TGAGAAAAGATCTATGAGATGGG + Intergenic
982152971 4:152483405-152483427 AAAAAAAAGCTTTTTGAGGCTGG + Intronic
982478075 4:155877324-155877346 TGACAAATTCTTTATGAGGTTGG - Intronic
982742828 4:159075544-159075566 TAATGAAAGCTTTTAGAGGTGGG + Intergenic
982945536 4:161617865-161617887 TAAGAAATGCTTAATGGGGATGG + Intronic
983277275 4:165633664-165633686 TATGAAAAACTTTCTTAGGTGGG - Intergenic
983331653 4:166336932-166336954 TATGGAAAGTATTATGAGGTGGG + Intergenic
984461247 4:180039896-180039918 TTATAAATGCTTTATGCGGTTGG + Intergenic
985040099 4:185881804-185881826 TAACCAAAGCATTAGGAGGTAGG + Intronic
985127502 4:186709355-186709377 AAAGAAACGCTGTATGAGGTGGG + Exonic
985226470 4:187766337-187766359 TATCAAAAGCTATATGAGTTAGG + Intergenic
986660505 5:10055787-10055809 TAAGAACACCTTTGTGAGTTGGG + Intergenic
987048338 5:14127917-14127939 TCAGAATAACTGTATGAGGTAGG + Intergenic
987606727 5:20145275-20145297 TAAGAAAAACTTTATTAAGAAGG - Intronic
987832388 5:23111937-23111959 TAAGAATACATTTATTAGGTTGG + Intergenic
988125369 5:27026460-27026482 TAAGTAGAGCTTTATGAACTTGG - Intronic
988139275 5:27214790-27214812 GGAGAGAAGCTTTATGAGTTAGG + Intergenic
988174803 5:27708377-27708399 TAAGAAGAGCTTCATTGGGTAGG + Intergenic
988214312 5:28251381-28251403 TGACAAAAGCTTTAAGAGTTGGG + Intergenic
988344170 5:30015726-30015748 TAAGAAGAGATTCATGAGATAGG - Intergenic
988411338 5:30889423-30889445 TAGGAAAAGATTTATAATGTAGG - Intergenic
988862068 5:35292140-35292162 GAAGAAAAGCTTCATGACATTGG - Intergenic
988875509 5:35441296-35441318 AAAGAAAAAGTTTAGGAGGTTGG + Intergenic
988954644 5:36302749-36302771 TATGAAAATTTTTATGAAGTAGG + Intergenic
989418092 5:41204247-41204269 TAACAAAAGCTTTATGAGGTAGG - Intronic
990190106 5:53250019-53250041 GAGCAAAAGCTTTATGGGGTTGG - Intergenic
990371334 5:55121883-55121905 TAAGAAAAGCGTTAAGATGTAGG - Intronic
990893124 5:60669719-60669741 TAAGGAAAGATTTCTGAGTTTGG - Intronic
992325716 5:75657610-75657632 TAAGAAATGCTTTTTGGGGCCGG + Intronic
992598809 5:78375429-78375451 TCAGAAGAGCTTTATGACTTGGG - Intronic
992603763 5:78434018-78434040 AAACAAAAGCTTTATGTGGGAGG - Intronic
994501339 5:100581958-100581980 TAAGAGACTCTTTATGTGGTAGG + Intronic
995100962 5:108305055-108305077 TTATGACAGCTTTATGAGGTAGG - Intronic
995186254 5:109274592-109274614 GAGGAAAAGCTCTATGAGATTGG + Intergenic
995901325 5:117070742-117070764 TAAGAAAAGCTTCATGATATTGG - Intergenic
996277304 5:121682449-121682471 TTAGAAAGTCTTTATGAAGTTGG + Intergenic
996903859 5:128575491-128575513 TGAGAAAAGCTCTATGGGGATGG + Intronic
998526386 5:142846942-142846964 TCAGAACAACCTTATGAGGTGGG + Intronic
999480640 5:151944985-151945007 AAAGAAAAACGTTATGTGGTAGG - Intergenic
999504583 5:152181485-152181507 GAAGAAAGGCTTGATGAGATAGG - Intergenic
999868032 5:155722898-155722920 TCAGAACAGCTTTCTGAGGTAGG + Intergenic
1001196398 5:169676992-169677014 TCAAAACAACTTTATGAGGTAGG + Intronic
1001411187 5:171513215-171513237 TAACAAAGGCCTTGTGAGGTGGG - Intergenic
1003050012 6:2771478-2771500 TCAGAAGTGCTTTATGTGGTGGG + Intronic
1003114592 6:3275378-3275400 AGAGAAAAGCTTTATGACGTTGG + Intronic
1007734865 6:43974999-43975021 TATGAAAATCTTTATGACCTGGG - Intergenic
1008805635 6:55423981-55424003 GAAGAAAAGCTTGCAGAGGTTGG - Intergenic
1008971157 6:57369996-57370018 CAAGAAAAGCTACATGAGATAGG + Intronic
1009160116 6:60271805-60271827 CAAGAAAAGCTACATGAGATAGG + Intergenic
1009572476 6:65404737-65404759 TAACAAAAAGTTTAGGAGGTTGG + Intronic
1010028846 6:71251344-71251366 TTAGAACACCCTTATGAGGTAGG + Intergenic
1010062325 6:71637212-71637234 GAAGAAATGCTTTATGATATTGG - Intergenic
1010088325 6:71948587-71948609 TCACAACATCTTTATGAGGTTGG - Intronic
1010405287 6:75497818-75497840 TCACAATAACTTTATGAGGTGGG + Intergenic
1011674706 6:89721146-89721168 TAAGAACAGCTTTTCGAGGTAGG + Intronic
1011816345 6:91195463-91195485 TCACAAAAACTTGATGAGGTGGG - Intergenic
1012742473 6:103036097-103036119 TGAGAAAAGCTTCATGACATAGG - Intergenic
1013002080 6:106032983-106033005 TCACAAAAGCCCTATGAGGTGGG + Intergenic
1013201537 6:107901551-107901573 TATGAAAAGCTTTGTGAGTTAGG - Intronic
1013346190 6:109262867-109262889 TCAGAATATCCTTATGAGGTAGG + Intergenic
1013858841 6:114609054-114609076 TCACAAGAACTTTATGAGGTAGG - Intergenic
1014053856 6:116989976-116989998 TTATAAAAACTTTATGAGGTAGG + Intergenic
1015061442 6:128971665-128971687 TAAGAAAAGCTGAAAAAGGTAGG + Intronic
1015221405 6:130807935-130807957 TGAGAAAATCTTTATGATCTTGG + Intergenic
1015296779 6:131603914-131603936 TAAGAAAAGGTTAATGTGCTAGG - Intronic
1015495930 6:133883330-133883352 TCATAAAAACTTTATAAGGTAGG - Intergenic
1015646764 6:135399884-135399906 TAAAAAAAGATTTATTATGTTGG - Intronic
1016121904 6:140354342-140354364 TCAGAATAGCTCTATGAGGTAGG + Intergenic
1016380655 6:143475305-143475327 TAAGAAATGATTTGAGAGGTGGG - Intronic
1016521681 6:144953644-144953666 TCAGAAAAGCTGAGTGAGGTAGG - Intergenic
1017310576 6:152971650-152971672 TAAGAATAGTTTTATTATGTAGG + Intronic
1017469669 6:154727116-154727138 TAAGAAAAGATTCATTGGGTGGG + Intergenic
1018448055 6:163876267-163876289 TGAGACTTGCTTTATGAGGTGGG + Intergenic
1020038280 7:4979502-4979524 TAAAAAATGCTTTAAGAGTTTGG - Intergenic
1020156962 7:5734646-5734668 TAAAAAATGCTTTAAGAGTTTGG + Intronic
1021431657 7:20566332-20566354 GGAGAAAAGCTTCATGAGGTTGG + Intergenic
1022215500 7:28256446-28256468 GAAGAAAATCTTTATGAACTTGG - Intergenic
1023811740 7:43917268-43917290 TAAAAAAGGATTTGTGAGGTTGG + Intronic
1027301706 7:76844621-76844643 TCACAACAGCGTTATGAGGTAGG - Intergenic
1027570522 7:79860302-79860324 GAAGAAAAGCTATCTGAGGCTGG + Intergenic
1028077166 7:86531283-86531305 TAAGAACTGCTTTATGAATTTGG + Intergenic
1028084051 7:86615248-86615270 TAGGAAAATCTTTATGATATTGG + Intergenic
1028424050 7:90666235-90666257 TAAGAAAAGATATCTGAGCTGGG - Intronic
1029894555 7:103969024-103969046 TTAGGAGAGCCTTATGAGGTAGG - Intronic
1030175887 7:106652917-106652939 TCACAAGAGCTCTATGAGGTAGG + Intergenic
1030435191 7:109508956-109508978 AAAGAAAAGTTCTATGGGGTGGG - Intergenic
1030499148 7:110337542-110337564 CAGGTAAAGCTTAATGAGGTAGG - Intergenic
1030601019 7:111592330-111592352 TCACAAAAACATTATGAGGTAGG + Intergenic
1031011774 7:116532139-116532161 TATGAAAAGCTTCATGATGTGGG + Intronic
1031333467 7:120496381-120496403 AAAGAAAAGCTTCAAGAAGTAGG - Intronic
1031555972 7:123176794-123176816 GAAGAAAAGGTTATTGAGGTAGG - Intronic
1031623069 7:123958965-123958987 TTATAACAACTTTATGAGGTAGG + Intronic
1031714633 7:125093202-125093224 TCTGTAAAGCTTTATGAAGTAGG + Intergenic
1031908524 7:127488531-127488553 TAAAAAACTTTTTATGAGGTAGG + Intergenic
1033819322 7:145115011-145115033 TAAGAAAATATTTGTGAGGAAGG - Intergenic
1034997208 7:155585250-155585272 TAAGAAAAGCTGTATGCATTTGG + Intergenic
1035071605 7:156148937-156148959 TGTGCAAAGCTCTATGAGGTTGG + Intergenic
1035106774 7:156447552-156447574 TAAGAACAGATTTATGAAATGGG + Intergenic
1035412315 7:158654751-158654773 TAGGAGAAGCTTTGTGAGGCTGG - Intronic
1035426225 7:158776524-158776546 GAAGAAAAGTTTGAAGAGGTTGG - Intronic
1036532339 8:9603614-9603636 TTAGAAGAGCTTTATGAGTAAGG + Intronic
1036566169 8:9940068-9940090 TAGGAACAACTTTATGAAGTAGG + Intergenic
1037054815 8:14426407-14426429 TAAAAAAAGTATTATGATGTTGG + Intronic
1037233544 8:16689070-16689092 TAAAAAAAGTTCTATGAGCTGGG + Intergenic
1038248943 8:25884580-25884602 TAATACAAGCTTTATGAAGTTGG + Intronic
1038708544 8:29920036-29920058 CTAGAAAAGAGTTATGAGGTTGG - Intergenic
1039632073 8:39122954-39122976 GAAGAAAATCTTTGTGAGCTTGG - Intronic
1039665615 8:39523515-39523537 TTAGAAAAGCTTTATGGCTTAGG + Intergenic
1040921168 8:52619451-52619473 TAAGTAAATCTTTATGACCTTGG + Intergenic
1041041793 8:53854145-53854167 GGAGAAAATCTTTATGAGGTAGG + Intronic
1041361399 8:57058150-57058172 TAACAACAGCATTATGAGGTGGG - Intergenic
1041626005 8:60027865-60027887 TCACAACATCTTTATGAGGTTGG - Intergenic
1042670320 8:71255644-71255666 TAGGAAAAGCTTCATGACATTGG + Intronic
1042848403 8:73191081-73191103 TAAGACAAGCTGTATGAAGGAGG - Intergenic
1043457207 8:80424549-80424571 TAAGAAAAGTTTTTTGTAGTTGG - Intergenic
1043531033 8:81150175-81150197 CAAGAACAGCTTTCTGAGTTTGG + Intergenic
1043789264 8:84442988-84443010 TCACAACAGCTTCATGAGGTAGG - Intronic
1043983034 8:86662553-86662575 TCATAATAGGTTTATGAGGTGGG + Intronic
1045632356 8:104140289-104140311 TGAGAAAAGCTTTATAAACTTGG - Intronic
1045659363 8:104420979-104421001 TAACCAAAACTTTATGAGGTAGG + Intronic
1045689909 8:104749590-104749612 TAACAATGGCTTTATGAGCTAGG + Intronic
1046326528 8:112654321-112654343 TAAGAAAGGATTTATGATGTTGG + Intronic
1046346879 8:112941106-112941128 TAAGAAAAGCTTTATAAAAGAGG + Intronic
1046389548 8:113551866-113551888 TAAGATAATCTCTATGAGCTGGG + Intergenic
1047086960 8:121528247-121528269 TCACATTAGCTTTATGAGGTAGG + Intergenic
1047345163 8:124020752-124020774 TCATAACAGCCTTATGAGGTAGG - Intronic
1047875355 8:129130722-129130744 TAAGAACAGGTTTATGTGCTGGG - Intergenic
1048177647 8:132167498-132167520 CAAGAAAACCTTTAGGAGGTAGG + Intronic
1048645218 8:136412251-136412273 TAAGACAAACTTTCAGAGGTAGG + Intergenic
1050420894 9:5464341-5464363 TCAGAACAACTTTATGAGTTAGG - Intronic
1051268768 9:15334514-15334536 TCAGAAAAACTTTAGGAGTTAGG - Intergenic
1051445364 9:17134729-17134751 CAAGGAAGGCTTTAAGAGGTGGG + Intergenic
1052041167 9:23740808-23740830 TAAGAACTGCTTTCTGAGTTTGG - Intronic
1052417680 9:28199229-28199251 TAATAAATGCTTTATGATGAAGG + Intronic
1052930620 9:34052467-34052489 GAAGATTAACTTTATGAGGTCGG + Intergenic
1053271703 9:36754432-36754454 TAAGAAAAGTTTGATGCTGTTGG + Intergenic
1053306047 9:36985639-36985661 CAAGAAGAGCTTTCTGAGGCCGG + Intronic
1053319528 9:37083260-37083282 GAAGAAAAGCATTAACAGGTGGG + Intergenic
1053510943 9:38687334-38687356 TCACAACAGCTCTATGAGGTAGG + Intergenic
1054778041 9:69140302-69140324 TAAAAACAACTCTATGAGGTAGG + Intronic
1055138936 9:72853280-72853302 AAATGAAAACTTTATGAGGTAGG - Intergenic
1055464212 9:76547890-76547912 GAAGAAAACCTTTGTGAGCTTGG - Intergenic
1055536661 9:77253806-77253828 GAAGAAAAGCTTTATGACATTGG - Intronic
1059585854 9:115605513-115605535 TCAGAAAATATTAATGAGGTGGG + Intergenic
1060350842 9:122858477-122858499 TCACAACAGCCTTATGAGGTAGG + Intronic
1060867965 9:127014773-127014795 TTAGAAAAGGCTGATGAGGTGGG - Intronic
1061512845 9:131071448-131071470 GAAGAAAAGGTGTATGAGGCTGG - Intronic
1186691415 X:11979932-11979954 AGAGAAAAGCTTTATGACTTTGG - Intergenic
1187350849 X:18515628-18515650 TAATAAAAGATATATGAGTTTGG + Intronic
1187739959 X:22344933-22344955 TAAGACCAACTTTATAAGGTAGG - Intergenic
1188735524 X:33709915-33709937 AAATAAATGCTTTGTGAGGTAGG + Intergenic
1189483580 X:41411848-41411870 AAAGAAAAGCTTCAAGAGGTCGG + Intergenic
1190923893 X:54883834-54883856 TAAGAAAATCTTTATGGCATGGG + Intergenic
1191764001 X:64676736-64676758 CAATAAAAGCTTTATGACATTGG + Intergenic
1192254609 X:69444765-69444787 GAGGAAAAGCTTTATGACATTGG + Intergenic
1193339725 X:80333994-80334016 TCACAACAGCTTTATAAGGTTGG + Intergenic
1194656062 X:96575264-96575286 TTAGAAAAACTCTATGAGGTAGG - Intergenic
1194810210 X:98380014-98380036 TAAGAAAGGATTTGTGAGGTTGG - Intergenic
1196111631 X:111952807-111952829 TCACAATAGCTTTATGAGGTAGG - Intronic
1196117411 X:112012572-112012594 TCAGAACAGCCTTATGAGGCAGG + Intronic
1196816122 X:119666788-119666810 CAAGAAGAATTTTATGAGGTGGG + Intronic
1197836854 X:130704011-130704033 TCAGAACAGCCCTATGAGGTAGG + Intronic
1198167487 X:134071848-134071870 TCAAAAAACCTTTATGAGATAGG - Intergenic
1198576655 X:138017492-138017514 TCAGAACAATTTTATGAGGTAGG + Intergenic
1198939323 X:141935439-141935461 TAAAAAAAGATTTGTCAGGTTGG + Intergenic
1201533669 Y:15021826-15021848 TAAGAAAAGATTTTAGATGTTGG + Intergenic
1201862478 Y:18614603-18614625 TAAAATTAGCTTTATGTGGTGGG - Intergenic
1201870845 Y:18705777-18705799 TAAAATTAGCTTTATGTGGTGGG + Intergenic