ID: 1099323596

View in Genome Browser
Species Human (GRCh38)
Location 12:81182291-81182313
Sequence ATGCTGTCCTTCAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 397}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099323596 Original CRISPR ATGCTGTCCTTCAGGAAAGA AGG Intronic
900866289 1:5270978-5271000 ATGCCCTCATTCAGGAGAGATGG + Intergenic
901099288 1:6706898-6706920 ATCCTTTGCTTAAGGAAAGAAGG + Intergenic
905496864 1:38396840-38396862 AATCTGTCCTTCAGAAATGAAGG + Intergenic
906055624 1:42914551-42914573 AAACTGTCCTTCAGAAACGAAGG + Intergenic
907334790 1:53692999-53693021 ATACCTTCCTTCAGAAAAGATGG - Intronic
907938735 1:59066606-59066628 AAACTGTGCTTCAGAAAAGAGGG - Intergenic
909048028 1:70734226-70734248 AGACTGTCCTTCAGGAATGAAGG - Intergenic
909199416 1:72670731-72670753 ATGCTATCCTCAAGGACAGATGG - Intergenic
910527159 1:88193330-88193352 AAGCTATTTTTCAGGAAAGAGGG + Intergenic
910535749 1:88295652-88295674 ATGATCTGCTTCAGGAAAGAAGG - Intergenic
910573682 1:88735190-88735212 ACTCTGTCCTTCAGGCTAGAGGG + Intronic
910975267 1:92899874-92899896 AAGCTATCCTTCAGAAATGAGGG - Intronic
912075232 1:105866227-105866249 ATGACCTGCTTCAGGAAAGAAGG - Intergenic
913281831 1:117192297-117192319 AAACTGTCCTTCAGAAATGAAGG + Intronic
913613186 1:120528762-120528784 ATGCTAGGCTACAGGAAAGAAGG + Intergenic
914371538 1:147029517-147029539 ATGCTAGGCTACAGGAAAGAAGG + Intergenic
914578001 1:148993485-148993507 ATGCTAGGCTACAGGAAAGAAGG - Intronic
915703012 1:157813984-157814006 AAGCTGTCTTTCAGAAATGAAGG + Intronic
916597197 1:166255669-166255691 AAGCTGTCCTTCATAAAAGAAGG - Intergenic
916795143 1:168160143-168160165 AAGCTATCCTTCAGAAATGAAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917784921 1:178444664-178444686 ATGCTATCCTTCTGGATTGATGG + Intronic
918115491 1:181492820-181492842 CTCCTGACCTTCAGGAAGGAGGG - Intronic
918128760 1:181606804-181606826 ATGCTGTCCTGCATGCATGAGGG + Intronic
918533369 1:185547879-185547901 ATGCTGTCCATCAGAAACTATGG + Intergenic
918656296 1:187029944-187029966 AAGCTGTCCTTCAGAAGTGAAGG + Intergenic
919120365 1:193332837-193332859 AAGCTGTCCTTCAGGAATGAAGG - Intergenic
920338251 1:205259144-205259166 ATGCTTCCCTTTAGGAAAGCAGG - Intronic
921071799 1:211665931-211665953 ATGCTGTCCTACATGGAATAAGG + Intronic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
921398091 1:214690004-214690026 ATGCTGTCCTTAGAGAAAGTTGG + Intergenic
923127559 1:231045779-231045801 ACACTGTCATTCAGGAATGAGGG + Intergenic
923834653 1:237596902-237596924 AAGCTATCCTTCAGAAATGAAGG + Intronic
924198115 1:241631030-241631052 ATACTGTCCTTCATGATACATGG + Exonic
1063327265 10:5116739-5116761 TTGCTGTCCTTCAGGGATGTAGG + Intronic
1063560340 10:7120456-7120478 ATGCTGGCCATGAGGAAAGATGG + Intergenic
1064262482 10:13797239-13797261 TTTCAGTCCTTCAGGAAAAAAGG - Intronic
1064468138 10:15606125-15606147 ATGCAGTGTTTCAGGAAACATGG + Intronic
1065174286 10:23061936-23061958 ATGCCCTGCTTCAGGCAAGAAGG + Intergenic
1065423280 10:25571306-25571328 CCACTGTCCTTCAGGACAGAGGG - Intronic
1067325822 10:45265504-45265526 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1067484995 10:46640041-46640063 ATGCTGTCCCTCCTGTAAGAAGG - Intergenic
1067609760 10:47701618-47701640 ATGCTGTCCTTCCTGTAAGAAGG + Intergenic
1068000589 10:51329663-51329685 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1068548501 10:58379902-58379924 TTGCTGTAATCCAGGAAAGAGGG - Intergenic
1068570173 10:58619063-58619085 ATCGTGTCCTTAATGAAAGAAGG - Intronic
1068712693 10:60151509-60151531 ATGCTTTCATTCATGACAGAAGG - Intronic
1071004753 10:80869992-80870014 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1071625354 10:87163226-87163248 ATGCTGTCCTTCCTGTACGAAGG + Intronic
1072020758 10:91397278-91397300 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1072860885 10:99004882-99004904 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1073382143 10:103086833-103086855 ATGGTGTACTTCAGAAAAGTTGG - Exonic
1073628815 10:105127201-105127223 TTGCTTTCCTGCAGGAAACAGGG - Intronic
1074647379 10:115474197-115474219 ATGTTGCCCTTCAGAAATGAAGG - Intronic
1074727622 10:116329051-116329073 ATCCTGTAATTCAGGAAGGAAGG - Intronic
1075010753 10:118868007-118868029 CTGATGTCCTTCAAGGAAGAAGG + Intergenic
1075062671 10:119267682-119267704 AAACTGTCCTCCAGGAAAGGCGG + Intronic
1075232812 10:120698155-120698177 AAGCTGTTCTTCAGAAATGAAGG - Intergenic
1075318444 10:121470411-121470433 ATGCGGTTCTTCCGGAAGGAAGG - Intergenic
1076079997 10:127570647-127570669 ATGCTTTTTTTAAGGAAAGATGG - Intergenic
1076547654 10:131256573-131256595 ATGCTGTCTTTCTTAAAAGAAGG + Intronic
1076941422 10:133612500-133612522 AATCTGTCCTTCAGAAATGAAGG + Intergenic
1078840403 11:15072237-15072259 CGGCTTTCCTTCAGAAAAGATGG + Intronic
1079935617 11:26612736-26612758 AAGCTATCCTTCAGAAATGAAGG - Intronic
1080679826 11:34464155-34464177 ATGCTGTGCTCCAGGGCAGAAGG - Exonic
1081930272 11:46865239-46865261 ATGCCTTCCTCCAGGAAAGGGGG + Intronic
1083040697 11:59682609-59682631 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1083124175 11:60546625-60546647 AAGCTATCCTTCAGAAACGAAGG + Intergenic
1083278703 11:61612076-61612098 CTGGTGTCCTTCTGAAAAGAAGG + Intergenic
1084138276 11:67204104-67204126 ATGCTTTCCTTCAAGAATGTAGG - Intronic
1084408328 11:68991680-68991702 ATGCCGTTCTGCAGGAGAGACGG + Intergenic
1084643189 11:70438010-70438032 AGGCTGTTCTTCAGGCCAGAGGG - Intergenic
1086333263 11:85775243-85775265 ATACTGTCATTCAGGAAGGAGGG - Intronic
1086508637 11:87531487-87531509 ATTCTGTCCTTCGGGAGAGATGG - Intergenic
1086829448 11:91541656-91541678 AAGCTGTACTTCAGAAATGAGGG + Intergenic
1086880210 11:92145013-92145035 AAGCTGTCTTTCAGAAATGAAGG - Intergenic
1088674137 11:112175296-112175318 ATGCTGTGCATCAGGATAAACGG + Intronic
1088951196 11:114571875-114571897 CTGCTGTCCTACAGGCAGGATGG - Intronic
1090157054 11:124449787-124449809 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1090170998 11:124604365-124604387 ATGCTATCATTCACTAAAGATGG - Intergenic
1090317035 11:125802050-125802072 AAACTGTCCTTCAGAAATGAAGG - Intergenic
1092504650 12:9084092-9084114 AAGCTGTCTTTCAGAAATGAGGG + Intronic
1092568113 12:9690263-9690285 AAGTTGTCCTTCAAGAATGAAGG + Intronic
1093339349 12:17951888-17951910 AAGCTGGCCTTCAGAAATGAAGG + Intergenic
1093339440 12:17953784-17953806 AAGCTGGCCTTCAGAAATGAAGG - Intergenic
1093380367 12:18483979-18484001 ATGCTGTTCTCCAGGAAGAAAGG + Intronic
1093383496 12:18522471-18522493 AAGTTGTCCTTCAGAAATGAGGG - Intronic
1093959345 12:25255222-25255244 ATGATGTCACTCAGGTAAGATGG - Intergenic
1093996873 12:25652541-25652563 ATGCTGTCCTTCTGGCGTGATGG - Intergenic
1094228057 12:28068735-28068757 GTGCTGTCCTTCAGAAATGAAGG + Intergenic
1094293342 12:28876577-28876599 ATGTTATCCTTCAGCCAAGAAGG - Intergenic
1095576472 12:43745785-43745807 ATGGTGTCCTCCAGAGAAGAGGG - Intronic
1095803148 12:46289701-46289723 AAGCTGTCCTTCAAAAATGAAGG + Intergenic
1096041873 12:48524340-48524362 ATGCTGTCATTCAGAAAGGAGGG - Intronic
1096956834 12:55534732-55534754 ATGCTGGCTGTCAGGAAAGTGGG - Intergenic
1097327367 12:58292437-58292459 ATGCTGTGCTCCAGGGAAGCTGG + Intergenic
1097358839 12:58633662-58633684 AAGCTATCCTTCAGAAAGGAAGG + Intronic
1097396763 12:59084695-59084717 AAATTGTTCTTCAGGAAAGATGG - Intergenic
1098207212 12:68124482-68124504 AAGCTGTCCTTTAGAAATGAAGG - Intergenic
1098398665 12:70050049-70050071 TTTCTGTCCTGCAGAAAAGAAGG + Intergenic
1098921298 12:76304571-76304593 ATGCTGTTCTTCTGGAAGAAAGG - Intergenic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1099423191 12:82489736-82489758 AAGCTGTCCTTCAGGAATGAAGG + Intergenic
1099430141 12:82573499-82573521 ATGCGGTCCTACATGAAAGAAGG - Intergenic
1099938057 12:89151671-89151693 TTGCTGTGCGTCAGGAAACAGGG - Intergenic
1101567170 12:105919012-105919034 ATGCTATCCTACAGGGAAGTGGG + Intergenic
1103690442 12:122768893-122768915 TTGATGTCATTCAGGAAAAATGG + Exonic
1103850420 12:123929405-123929427 ATGCTGTGGTGCAGGAGAGAAGG + Exonic
1104733698 12:131122977-131122999 ATTCTGTCCTCCAGGAATGATGG - Intronic
1104757123 12:131276309-131276331 ATTGTTTCCTTCTGGAAAGACGG + Intergenic
1105675016 13:22661770-22661792 ATGTTGTCTTTCAAGAAAAAGGG + Intergenic
1106230382 13:27816838-27816860 AAGCTGTCCTTAAGAAGAGATGG - Intergenic
1106828973 13:33557549-33557571 TTACTGTCCTGCAGGAAATACGG - Intergenic
1107236417 13:38176071-38176093 AGGCTGTCTCTCAGCAAAGAGGG + Intergenic
1107372508 13:39768005-39768027 ATGCTGTCCATTAGGAACCAGGG + Intronic
1107712861 13:43167960-43167982 ATGACCTGCTTCAGGAAAGAAGG + Intergenic
1108460914 13:50666546-50666568 ATTCAGACCTTCAGGAATGATGG + Intronic
1108945417 13:56017452-56017474 AAGCTGTCCTTCAGAAACAAAGG - Intergenic
1109241048 13:59888723-59888745 AAGTTGTCCTTCAGGCAAAAGGG - Intronic
1109254695 13:60064923-60064945 TTGCTGTGCTTCAGGGAATAGGG + Intronic
1109373437 13:61456530-61456552 AAACTGTCCTTCAAAAAAGAAGG - Intergenic
1109653285 13:65355705-65355727 AAGCTGTACTTCAGAAATGAAGG + Intergenic
1110788545 13:79561315-79561337 AGGCTGTGATTCAGCAAAGATGG - Intergenic
1111003319 13:82214414-82214436 ATGCTGTCTTTCAGAAATGAAGG - Intergenic
1111413538 13:87909705-87909727 ATGATGTCCTTAAAGAAAAAGGG + Intergenic
1112848694 13:103676450-103676472 ATGGTTTCCTTCAGGAAAAGTGG - Intergenic
1113708743 13:112450517-112450539 AGGCAGTTCTTCAGGAAAGGCGG + Intergenic
1114618974 14:24083524-24083546 AGACTGGCCTTGAGGAAAGATGG - Intronic
1115149763 14:30270862-30270884 ATGCTGGCCTTCAGCCACGAGGG - Intergenic
1115303500 14:31911364-31911386 AAGCTGTACTTCAGAAATGAGGG - Intergenic
1115382301 14:32754734-32754756 ATGATGTCCTTCAGAAATAAAGG - Intronic
1115540369 14:34413840-34413862 AAGCTGTCCTTCAGATATGAAGG + Intronic
1115745866 14:36437008-36437030 ATCCTTTCCTGCAGTAAAGAAGG + Intergenic
1118520214 14:66575167-66575189 AAGCTGTCCTTCAGGAATAAAGG - Intronic
1118569501 14:67178966-67178988 AAGCTATCCTTCAGGAATGAGGG + Intronic
1118616422 14:67577325-67577347 ATGCTGTGCTACAGCAAAGACGG + Exonic
1118928344 14:70214853-70214875 AGGCTGCCCTTCAGAAAAGTTGG - Intergenic
1118964336 14:70565973-70565995 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1120588305 14:86344325-86344347 AAACTGTCCTTGAGAAAAGATGG - Intergenic
1121399907 14:93665778-93665800 AAGCTATCCTTCAAGAATGAAGG + Intronic
1121638940 14:95472593-95472615 CTGCTGCCTTTCAGGAAGGAGGG - Intronic
1121797683 14:96748732-96748754 AAGATGTTCTTCTGGAAAGAGGG + Intergenic
1122583235 14:102784912-102784934 TGGCTGTCCTTCAGGGGAGAGGG + Intronic
1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG + Intergenic
1125268717 15:37914641-37914663 ATGCTATTGTTCAGGATAGAAGG - Intergenic
1125980280 15:43994982-43995004 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1126431880 15:48594474-48594496 CTGCTCCCCTTCAGGAAAAAGGG - Intronic
1127648924 15:60987275-60987297 AGACCGTCCTCCAGGAAAGAAGG - Intronic
1128286022 15:66437863-66437885 CTGCTCTCATTGAGGAAAGAAGG - Intronic
1128485830 15:68086914-68086936 AAGCTGTCTTTCAGGAAAAAAGG + Intronic
1129017541 15:72481791-72481813 ATGCTATCCTTCAGCTAAGGTGG + Intronic
1129567284 15:76636141-76636163 AAGCTTTCCTTCACAAAAGAAGG - Intronic
1129737224 15:77973140-77973162 ATGCTGGCTTTGAGGAAAGCAGG - Intergenic
1129755252 15:78094188-78094210 ATCTTGTCCTACAGGTAAGAGGG + Exonic
1129848854 15:78780495-78780517 ATGCTGGCTTTGAGGAAAGCAGG + Intronic
1130019169 15:80212861-80212883 GTGCTACCCTTCAGGAAAAAAGG + Intergenic
1130218223 15:81993210-81993232 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1130761279 15:86822674-86822696 ATGCAGTTTTTCAGGAAAGAAGG + Intronic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1132599109 16:766063-766085 AGCCTGTCCTTCAGGCAAGAAGG + Exonic
1133375663 16:5284707-5284729 AAGCTGTCCTTCAAAAATGAAGG - Intergenic
1133453881 16:5925780-5925802 AAGCTCCTCTTCAGGAAAGAGGG - Intergenic
1134265604 16:12690201-12690223 ATGGTGTCTTTCATGAAACAGGG - Intronic
1134682236 16:16134335-16134357 ATGCCGACCTGCAGGACAGAAGG - Exonic
1135064231 16:19295956-19295978 ATGCTCTCCATCAAGAAAGGAGG + Intronic
1135522112 16:23185815-23185837 ATGCTGCCCTTGAGGAAGGCGGG + Intronic
1136782861 16:32917909-32917931 ATGGTGTCATTCAGGGAAGTCGG - Intergenic
1137880733 16:52045337-52045359 AAGATGTCCTTCAGAAATGAAGG - Intronic
1137968796 16:52962894-52962916 ATCATGTGCTTCAGGAAAAAGGG - Intergenic
1138032740 16:53573350-53573372 ATTCTGTCCTTCACAGAAGAAGG - Intergenic
1138453547 16:57107582-57107604 CTGCTGTCCTCCAGGCAGGAAGG - Intronic
1138712398 16:58984288-58984310 AAGCTGTCCTTCAGAAATGAGGG + Intergenic
1140158341 16:72457465-72457487 AAGCTGTCCTTCAGAAATAAGGG - Intergenic
1140570626 16:76102488-76102510 AAGCTTTCCTTCAGAAATGAAGG - Intergenic
1140708400 16:77653088-77653110 ATGCTGGTCTACAGGAGAGAAGG - Intergenic
1140713809 16:77703506-77703528 ATTCTGTCTTTCAAGAAAAATGG + Intergenic
1142673194 17:1496958-1496980 TGGCTGGCCATCAGGAAAGAGGG + Intronic
1142825768 17:2509373-2509395 TTACTGACCATCAGGAAAGAGGG + Intronic
1143689445 17:8549135-8549157 AAGCTTTCCTTCAAAAAAGAGGG - Intronic
1143726194 17:8848289-8848311 ATGCTGTCTTTTAGGAAAAGAGG - Intronic
1145031543 17:19508075-19508097 GTGCTGGAATTCAGGAAAGAGGG + Intronic
1146085571 17:29825316-29825338 ATGCTATCCTTCATGTAAGCTGG + Intronic
1146576675 17:33999992-34000014 AAGCTGTCCTTGAGAAATGAAGG - Intronic
1146805791 17:35864210-35864232 CTGCTGGAGTTCAGGAAAGAAGG - Intronic
1150558290 17:66273381-66273403 ATGATATCCTTCTGGAAAGGTGG - Intergenic
1150897636 17:69232796-69232818 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1151209586 17:72534363-72534385 AGGCTGTGCTTCAGGAAATTAGG - Intergenic
1153353439 18:4108042-4108064 ATGATCTGCTTCAGGAGAGAGGG - Intronic
1154075231 18:11194081-11194103 ATACTATCCTTCATGAATGAAGG - Intergenic
1155228358 18:23750033-23750055 ATGCAGTCATTCAGGGAAGCAGG - Intronic
1157125793 18:44954509-44954531 ATTCTTGCCTTCAGGAAATATGG - Intronic
1157309580 18:46542239-46542261 ATGCTGTCCTTCCTTGAAGAAGG + Intronic
1157358133 18:46953938-46953960 ATGCTCTCCTTCAGGGAATAAGG + Intronic
1157371410 18:47115928-47115950 ATCTTTTTCTTCAGGAAAGATGG - Intronic
1157458055 18:47855569-47855591 AAGCTGTCCTTCAGAAATGAAGG - Intronic
1157505339 18:48222227-48222249 ATGCTTTCCTAGAGGCAAGAGGG - Intronic
1159616506 18:70586136-70586158 AAGCTGTCCTTCAGAAAGAAAGG + Intergenic
1160022895 18:75194102-75194124 AGGCTGTCCTTCACTAGAGAGGG - Intergenic
1160311746 18:77798900-77798922 AAACTATCCTTCAGGAATGAAGG - Intergenic
1160467469 18:79093283-79093305 ACAATGTCCTTCAGGAATGAAGG - Intronic
1161729736 19:5952003-5952025 TTTCTGTGCTTTAGGAAAGAGGG + Intronic
1161829974 19:6595640-6595662 AAGCTGTCCTTCCAGAAAGTTGG - Intronic
1161930586 19:7336916-7336938 ATGCTGTCATTCAGGAAGACAGG - Intergenic
1163398460 19:17077376-17077398 ATCCTGGCCTTTAGGAAAGGTGG + Intronic
1164492742 19:28729438-28729460 CTGCTGGCCTTCAAGAAAGCAGG - Intergenic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1164946878 19:32302842-32302864 AAGCTATCCTTCAGAAATGAGGG - Intergenic
1167728027 19:51232146-51232168 AAGCTATCTTTCAGAAAAGAAGG - Intronic
1168616815 19:57844481-57844503 ATGCTGTCCTTCAAGGTAGCAGG - Exonic
1168625619 19:57915706-57915728 AGGCTGTTCTCCAGGCAAGAAGG - Intronic
925197308 2:1936760-1936782 ATGGTGTCCTGCAGGGAAGCTGG + Intronic
925488659 2:4367478-4367500 AAGCTGTCCTTTAGAAATGAAGG - Intergenic
925590395 2:5503426-5503448 ATGTTCTGCTTCAGGGAAGAAGG - Intergenic
925956919 2:8975587-8975609 ATGTTTCCCTTTAGGAAAGATGG - Intronic
927223207 2:20734873-20734895 AAAGTGTCTTTCAGGAAAGAAGG - Intronic
927352090 2:22127568-22127590 AAGCTGCCCTTCAGAAATGAAGG + Intergenic
928849218 2:35722196-35722218 AAGCTATCCTTCAGAAATGAAGG + Intergenic
930097046 2:47572685-47572707 CTGCTGTGCTCCAGAAAAGAGGG - Intergenic
930405259 2:50946898-50946920 AAACTGTCCATCAGGAAAGAAGG + Intronic
932872052 2:75410951-75410973 AATCTGTCCTTCAGGAATGAAGG + Intergenic
933361359 2:81290218-81290240 ATGCTGTCCTTCACAAATGAAGG - Intergenic
934693140 2:96377387-96377409 AAGCTGTCCTTCAAAAATGAAGG - Intergenic
934878744 2:97952949-97952971 AAGCTATCCTTCAAAAAAGAAGG + Intronic
935069286 2:99679431-99679453 ATGCCGTCCCCCAGGGAAGATGG - Intronic
936876049 2:117190880-117190902 ATGCTGTCCTGCAGAAAAGGAGG + Intergenic
939011107 2:136846790-136846812 ATGCTGTCCTAAAGGTAATATGG - Intronic
940091087 2:149918122-149918144 AAGCTGTCCTTCAGAAATAAAGG + Intergenic
940684506 2:156829031-156829053 ATATTATCCTTCATGAAAGAAGG + Intergenic
941979979 2:171444729-171444751 TGGCTGTCCTTTAGGAAAAACGG + Intronic
943088012 2:183337756-183337778 AAACTGTCCTTCAGAAATGAGGG - Intergenic
943664366 2:190593377-190593399 ATGCGGTCATTCAGAAAAGCAGG + Intergenic
944269117 2:197760996-197761018 AAGCTATCCTTCAGAAATGAAGG + Intronic
944590143 2:201209414-201209436 ATACTGTCCTGCAGGGAAGTGGG - Exonic
947467705 2:230368214-230368236 AAGGTGTCCTTCAGAAATGAAGG - Intronic
947474323 2:230429189-230429211 AAGCTGTCCTTCAGAAGTGAAGG - Intronic
947537516 2:230949765-230949787 ATGCTGGGCTTTATGAAAGATGG - Intronic
948511923 2:238473677-238473699 AAGCTGTCTTTCAGTAATGAAGG - Intergenic
948514052 2:238492060-238492082 AAACTATCCTTCAGGAAGGAAGG - Intergenic
948918056 2:241048300-241048322 ATGGTCTCCTGCAAGAAAGACGG - Exonic
1169310646 20:4536030-4536052 TTCCTGTCATTCAGGAAGGAGGG - Intergenic
1169404826 20:5314670-5314692 ATGCTGTCCTTCCTGACAGCTGG - Intergenic
1170047585 20:12101753-12101775 ATGCTGTTCTGCCAGAAAGATGG + Intergenic
1171468967 20:25354592-25354614 ATCATGGCCATCAGGAAAGATGG - Intronic
1172811435 20:37650969-37650991 ATGCTGTGCTCCAGAAAAAATGG + Intergenic
1173717060 20:45217646-45217668 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1173769226 20:45643864-45643886 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1174728855 20:52894443-52894465 ATGCAGTTACTCAGGAAAGAAGG + Intergenic
1174904722 20:54538370-54538392 AAAATGTCCTTCAGGAATGAAGG + Intronic
1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG + Intergenic
1178526409 21:33333234-33333256 AAACTATCCTTCAGGAATGAGGG + Intronic
1178703397 21:34853083-34853105 GTGTTGGCCTTCACGAAAGATGG - Intronic
1179667206 21:42921171-42921193 ATGCCGTTCGTCAGGATAGAGGG + Intergenic
1181448358 22:22997840-22997862 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1182933195 22:34194506-34194528 ATGCTGTCCTCAAGTAGAGAGGG - Intergenic
1184990189 22:48162357-48162379 ATGCTATCATTCAGCAATGAAGG - Intergenic
1185176433 22:49329869-49329891 ATGCAGTCCTACAGGAAGGCTGG + Intergenic
1185398173 22:50603208-50603230 AGGCTGTCCTGCAGGACGGAGGG - Exonic
949162900 3:902197-902219 AAGCTGTCCTTCAGCAATGAAGG + Intergenic
949402083 3:3675833-3675855 ATTGTTTCCTTCAGGAATGAGGG - Intergenic
949783172 3:7712513-7712535 CTACTGTAATTCAGGAAAGAGGG - Intronic
950065959 3:10111938-10111960 ATGCTGTTCTTGAGTGAAGATGG - Intergenic
951281978 3:20762278-20762300 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
951328352 3:21333287-21333309 AAGCTGACCTTCAGAAATGAGGG + Intergenic
952439409 3:33310702-33310724 AAGCTGTCCTTCAGAAATGAAGG - Intronic
954286500 3:49623295-49623317 ATGCTGGCACTCAGGAAACAGGG - Intronic
954400490 3:50317134-50317156 TGGCTGTCCCTGAGGAAAGAAGG - Intergenic
954731877 3:52670654-52670676 ATGCTGTCATCCTGGGAAGAAGG - Intronic
954868792 3:53751302-53751324 GTGCTGTCCTCCAGGAAAGGAGG - Intronic
954944044 3:54401651-54401673 AAGGTGTCCTTCAGGAATAAAGG + Intronic
955118739 3:56033615-56033637 AAGCTGTCCTTCAGAAATTAAGG - Intronic
956298767 3:67745514-67745536 CTGCTGTCGTCCAAGAAAGATGG + Intergenic
956728977 3:72179158-72179180 ATGGTGTGCTTCAGGGGAGAAGG - Intergenic
958014603 3:87924610-87924632 ATGCTATCCTTCAGAAACTAAGG - Intergenic
958097516 3:88965609-88965631 ATGCTGACCTACTGGCAAGATGG + Intergenic
958634849 3:96730669-96730691 ATGCTGTCCTTTAGGGTAAAGGG + Intergenic
960206834 3:114912174-114912196 AAGCTGTCCTTCAAAAATGAAGG + Intronic
960279617 3:115766643-115766665 AAGCTGTCCTGCAGGGAAGGAGG + Intergenic
962036387 3:131656088-131656110 AAGCACTCCTTCAGGAATGAGGG - Intronic
962057917 3:131892333-131892355 ATGCTATTCTTCAGAAATGAAGG + Intronic
962508965 3:136079348-136079370 ATAATGTGCTTCAGGAAAGTGGG - Intronic
962531014 3:136280280-136280302 AAACTATCCTTCAAGAAAGAAGG - Intronic
962936617 3:140087215-140087237 TTGCTGAACTTCAGGAAGGAGGG + Intronic
963341757 3:144044004-144044026 ATGCTGTATTTGAGGCAAGAAGG - Intronic
963817499 3:149848345-149848367 ATGCTGTCCATAAGGATAGAAGG + Intronic
964521076 3:157568014-157568036 AAGGTGTCCTTCAGAAATGAAGG - Intronic
967709605 3:192690054-192690076 AAGCTGTCTTTCAGAAAAGAGGG + Intronic
967779630 3:193421318-193421340 AAGCTGTCCTTCAGAAGTGAAGG + Intronic
967835006 3:193954870-193954892 AAACTATCCTTCAGGAATGAAGG - Intergenic
967845805 3:194041765-194041787 TTTCTGACATTCAGGAAAGAGGG - Intergenic
968712876 4:2132734-2132756 ATTCTATCCTCCAGGAATGAAGG + Intronic
969407194 4:7001376-7001398 ACTGTGTCCTTCAGGAGAGAGGG + Intronic
970452602 4:16185793-16185815 ATGATGTCCTTGAGGAAGGAGGG - Intronic
970918255 4:21361878-21361900 ATACTGTCCTTCAGGAGTAAAGG + Intronic
972902784 4:43705312-43705334 AAGCTGTCTTTCAGAAATGAAGG + Intergenic
973579618 4:52330059-52330081 AAGCTGTCATTCAGAAATGAAGG - Intergenic
973678356 4:53288653-53288675 AAGCTTTCCTTCAGGAATGAAGG + Intronic
974464144 4:62231769-62231791 GTGTTGTCCATCAGGAATGATGG + Intergenic
974930273 4:68353187-68353209 TTTCTGTAGTTCAGGAAAGATGG + Intergenic
975833535 4:78396470-78396492 AAGCTGTCATTCAGAAATGAAGG - Intronic
976040835 4:80882818-80882840 AAGCTATCCTTCAGAAATGAAGG + Intronic
976443859 4:85108138-85108160 TTCATGTCCTTCTGGAAAGAGGG + Intergenic
977348579 4:95850069-95850091 ATGCTACTCTTCAGCAAAGAGGG + Intergenic
977459102 4:97301724-97301746 AAGCTGTCCTTCAGAAATGAAGG + Intronic
978117773 4:105042664-105042686 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
978417682 4:108494226-108494248 AAGCTGTCTTTTAGGAATGAAGG + Intergenic
979365906 4:119822962-119822984 AAGCTGTTCTTCAGAAATGAAGG + Intergenic
979488055 4:121291272-121291294 ACGCTGTCCTTTAGAAATGAAGG + Intergenic
983078447 4:163354913-163354935 ATGCTGGCTTTCTGGAAAGTGGG + Intergenic
983102842 4:163646290-163646312 AAGCTCTCCTTCAGAAATGAAGG + Intronic
983253676 4:165375061-165375083 GGCCTCTCCTTCAGGAAAGAAGG - Intronic
983488797 4:168363207-168363229 AAGCTATCCTTCAGAAATGAAGG + Intronic
984343761 4:178492677-178492699 ATGCTGTCTTTCAGAAATGCAGG + Intergenic
984519877 4:180788569-180788591 ATGGTCTGCTTCAGGGAAGAAGG + Intergenic
985076954 4:186225209-186225231 AAGCTGTCCTTCAGAAAGGAAGG - Intronic
985637011 5:1040829-1040851 GTGCTGTGCTGCAGGCAAGATGG + Intergenic
987722668 5:21658369-21658391 ATACTTTCCTTCAACAAAGAAGG - Intergenic
988136580 5:27179472-27179494 TTGCTGTCATTCAGCAATGAAGG - Intergenic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
989081634 5:37629012-37629034 AAGCTATCCTTCAGAAATGAAGG - Intronic
989148637 5:38274603-38274625 AAGCTGTCCTTCAGAAATGAAGG + Intronic
990928833 5:61062955-61062977 AAGCTGTTCTTCAGAAATGAAGG + Intronic
991224137 5:64249461-64249483 AAGCTGTCCTTCACAAATGAAGG + Intronic
992343371 5:75849297-75849319 ATGCTAAGCTTCAGGAAAGTAGG + Intergenic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
993173666 5:84453645-84453667 ATGCTGTCATTCAGAAATGAAGG + Intergenic
993544803 5:89198473-89198495 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
994161605 5:96562943-96562965 ATGACCTCCTTCAGGAGAGAAGG - Intronic
994994239 5:107039239-107039261 ATGACGTGCTTCAGGAAAGAAGG + Intergenic
995614530 5:113946191-113946213 AAGCTGTCCATCAGAAATGAAGG + Intergenic
996659779 5:125988414-125988436 GTCCTGTCCTTCAGGGAAGCAGG + Intergenic
996696356 5:126400690-126400712 AAGCTGTCCTTCAGAAATAAAGG - Intronic
997085980 5:130799244-130799266 AAGCTGTCCTTGAGAAATGAAGG + Intergenic
997109162 5:131055690-131055712 AAGCAGTCCTTCATGAATGAGGG + Intergenic
997415059 5:133721517-133721539 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
997654738 5:135546428-135546450 ACGCTGTCCTTTAGGGAAGTCGG - Intergenic
997828516 5:137129179-137129201 GGCCTGTGCTTCAGGAAAGAAGG - Intronic
997833575 5:137174196-137174218 AAGCTTTCCTTCTGGAAAGAGGG + Intronic
998031274 5:138870672-138870694 CTGCTGTCCTTCAGGGCTGATGG + Exonic
1001866824 5:175113482-175113504 TTCCTGTCCTCCAAGAAAGACGG + Intergenic
1002677023 5:180925552-180925574 AATCTGTCCTTCAGAAATGAGGG + Intronic
1003556977 6:7148656-7148678 ATGCTATGCTTAAGGAAACAGGG + Intronic
1003622837 6:7717048-7717070 AAGCTATCCTTCAAGAATGAAGG + Intergenic
1004165176 6:13250599-13250621 ATGTTGTCCTTAAGAAAGGAAGG + Intronic
1006886277 6:37384744-37384766 AGGCTGTCTTTCAGCAAAGGAGG - Intronic
1007412367 6:41672497-41672519 ATGATGTCCATCATGGAAGAAGG + Intergenic
1008020503 6:46572407-46572429 AAGCTGTCCTTCAAAAATGAAGG - Intronic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1008997631 6:57677061-57677083 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1009058533 6:58368951-58368973 AAACTGTCCTTCAGAAAATAAGG + Intergenic
1009186128 6:60576409-60576431 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1009232306 6:61078169-61078191 AAACTGTCCTTCAGAAAATAAGG - Intergenic
1009663426 6:66645550-66645572 AAGCTGTCTTTCAGAAATGAAGG - Intergenic
1009688074 6:66989353-66989375 AAGCTGTCCTTCAGAAAGGAGGG - Intergenic
1010856383 6:80845691-80845713 AAACTGTCCTTCAGAAATGAAGG + Intergenic
1010914708 6:81601618-81601640 ATCCTGTCATTCAGGAAGGTAGG - Intronic
1011500518 6:87983343-87983365 AAGCTATCCTTCAGAAATGATGG + Intergenic
1011522986 6:88230149-88230171 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1011587475 6:88942293-88942315 ATACTGTCATTCAGAAAAAAAGG - Intronic
1012168989 6:95994843-95994865 ATTCTGTCCTTCATGAAAAATGG - Intergenic
1013227805 6:108133080-108133102 GTGCTGCCCCTCAGCAAAGAGGG - Intronic
1013311755 6:108901074-108901096 AAGCCTTCCTACAGGAAAGAAGG + Intronic
1014372206 6:120624850-120624872 ATGCTTTCTTTCAGGCCAGAGGG + Intergenic
1014932495 6:127350657-127350679 AGGCTGTCCTTCAGAAATGAAGG + Intergenic
1016320716 6:142842653-142842675 TTGCAGTCTTTCAGGAAACAAGG - Intronic
1016793494 6:148091605-148091627 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1017049226 6:150374896-150374918 ATGACCTGCTTCAGGAAAGAAGG + Intronic
1017998709 6:159558632-159558654 AGGATGTACTTCAGGAAAAAGGG + Intergenic
1018874761 6:167812044-167812066 ATGCTGTCTTCCGGGGAAGAAGG - Intergenic
1019865040 7:3700102-3700124 AAACTATCCTTCAGGAATGAAGG + Intronic
1021287763 7:18803524-18803546 AAGCTGTCTTTCAAGAATGAGGG - Intronic
1021630814 7:22645488-22645510 AAGCTGACCTTCAGAAATGAAGG - Intergenic
1022661080 7:32367082-32367104 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1022779795 7:33568768-33568790 ATGCTTCCCTTCGGGTAAGAAGG + Intronic
1022855340 7:34308862-34308884 AAGCTGAGTTTCAGGAAAGAGGG + Intergenic
1023100314 7:36711381-36711403 ATGCTGTGCTTCAGGAACAAAGG - Intronic
1023331477 7:39122174-39122196 ATTCTGTACTTCCTGAAAGATGG + Intronic
1024019933 7:45359586-45359608 ATGCTATTTTTCAGGAGAGAAGG + Intergenic
1024453048 7:49570924-49570946 AAGCTGTCCTTCAAAAATGAAGG + Intergenic
1024811231 7:53214791-53214813 AAGCTGTCCTTCAAAAATGAAGG + Intergenic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1027350650 7:77307736-77307758 AAGCTATCCTTCAGAAATGAAGG - Intronic
1028677353 7:93480908-93480930 ATGCTCCCCTTCAGGCAAGATGG - Intronic
1028877453 7:95839807-95839829 AACCTGTCCTTCAGAAATGAAGG - Intronic
1030183476 7:106735689-106735711 AAACTGTCCTTCAGAAATGAGGG - Intergenic
1030845722 7:114407907-114407929 AAGCTGTCCTTGATGAAACATGG - Intronic
1032684113 7:134213326-134213348 TTGCTGTAGTCCAGGAAAGAAGG + Intronic
1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG + Intergenic
1033728591 7:144148542-144148564 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1034262757 7:149766871-149766893 AGGCTGTCCAGCAGGAAAGAAGG - Intronic
1035079852 7:156206930-156206952 ATGGTAACCTTCAGGAAAGGAGG - Intergenic
1035164630 7:156978994-156979016 AAGCTGTCCCTCAGTAATGAAGG - Intergenic
1035357803 7:158288913-158288935 AAGCTGTTCTTCAGAAATGAAGG - Intronic
1035929206 8:3762698-3762720 AAGCTGTCCGTCTGCAAAGATGG + Intronic
1036061815 8:5331159-5331181 ATGCTTTCCTTCAGAAATGAAGG - Intergenic
1036998899 8:13694093-13694115 AAGCTGTCCTTCAGAAATTAAGG - Intergenic
1039376662 8:37041426-37041448 ATGAAGTCCATCAGGGAAGAAGG + Intergenic
1039545953 8:38411796-38411818 ATCCTGTCCCTCAGGAACGGGGG - Exonic
1040283990 8:46090538-46090560 ATGCTGTTTTTCACTAAAGAAGG - Intergenic
1041471736 8:58217409-58217431 ATGCTGTCATCCAAGAAATACGG - Intergenic
1041775597 8:61519544-61519566 ATGTTGTCTTTCATGCAAGAGGG + Intronic
1041994416 8:64036335-64036357 AAGTTGTCCTTCAGCAATGAAGG + Intergenic
1042005931 8:64179830-64179852 AAGCTGTGCTTCAGAAATGAAGG + Intergenic
1042208779 8:66356299-66356321 ATGACCTGCTTCAGGAAAGAAGG - Intergenic
1042233341 8:66581848-66581870 AAGCTATCCTTCAGAAATGAGGG + Intronic
1043528279 8:81120511-81120533 CTGCAGTCCAGCAGGAAAGAAGG - Intergenic
1044765714 8:95572102-95572124 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
1045586349 8:103541383-103541405 AAGCTGTTCTTCAGAAATGAAGG + Intronic
1045906366 8:107350169-107350191 TTGCTGTCATTTAGGAAACATGG - Intronic
1046012268 8:108563803-108563825 AAAATGTCCTTCAGGAATGAAGG - Intergenic
1046880556 8:119302188-119302210 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1047265845 8:123308041-123308063 AAGCTGTCCTTCAAAAATGAGGG - Intergenic
1047946478 8:129885999-129886021 AGGTTGTCCTTCAGGAAAACAGG - Intronic
1048272058 8:133037329-133037351 ATGCTCAGCTCCAGGAAAGATGG - Intronic
1048707023 8:137165202-137165224 ATCCTGTCATTCCTGAAAGAAGG - Intergenic
1049965813 9:778286-778308 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1050006648 9:1139140-1139162 AAGCTGTCCTTCAGAAATAAGGG - Intergenic
1050332400 9:4558485-4558507 TTGCTGTGCTCCAGGACAGAGGG + Intronic
1050960001 9:11717979-11718001 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1051207699 9:14705795-14705817 ATGCTGTCTTTCAAAAATGAAGG + Intergenic
1051210939 9:14742572-14742594 TTGCTGTCCTTGTGGAAATATGG + Intronic
1051280681 9:15440421-15440443 AAACTATCCTTCAGGAATGAAGG - Intronic
1051851308 9:21512102-21512124 CTGCTGTCAGACAGGAAAGATGG + Intergenic
1051918776 9:22238906-22238928 TTACTCTCCTTCAGGAAAGCAGG - Intergenic
1052199623 9:25762761-25762783 AAGGTGTCCTTCAGAAACGAAGG + Intergenic
1053181455 9:35974906-35974928 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1055057271 9:72035476-72035498 ATGATGACCTTCAGCAAAGGAGG + Intergenic
1055235845 9:74122379-74122401 ATGCTGTCACTCAGAAAAGCTGG + Intergenic
1055684034 9:78751456-78751478 AAGCTATCCTTCAGAAATGAGGG - Intergenic
1056969066 9:91187522-91187544 AGGTCGTCCTCCAGGAAAGATGG + Intergenic
1056987846 9:91380677-91380699 ATGCTGTTATTCAAAAAAGAAGG + Intergenic
1056994280 9:91442181-91442203 AAGCTGTCCTTAAGAAATGAAGG - Intergenic
1057296203 9:93844068-93844090 AAGCTGTCCTTCAAGTATGAAGG - Intergenic
1057932739 9:99210228-99210250 AAGCTGTCCTTCATAAATGAAGG - Intergenic
1058319694 9:103613736-103613758 AAGCAGTCCTTCAGAAATGAGGG - Intergenic
1059073897 9:111168695-111168717 AAGCTGTCTTTCAGAAATGAAGG + Intergenic
1059195506 9:112367480-112367502 ATGCTGTCCTTCAGAAATAAAGG - Intergenic
1062727740 9:138085797-138085819 AAGCTATCCTTCAGAAATGAGGG + Intronic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1187315826 X:18193947-18193969 AAATTGTCCCTCAGGAAAGAAGG + Intronic
1188138158 X:26514968-26514990 AAACTGTCCTTCAGAAATGAAGG + Intergenic
1188393219 X:29646858-29646880 AAGCTGTCCTTCAGAAATGAAGG + Intronic
1188746069 X:33845996-33846018 AAGCTTTCCTTCAGAAATGAAGG - Intergenic
1188859727 X:35243066-35243088 ATGCTTTCCTTAAAGGAAGAGGG + Intergenic
1189131633 X:38504344-38504366 ATCCAGTCCTTCAGTAATGAGGG + Intronic
1189691269 X:43618839-43618861 TGTCTGTGCTTCAGGAAAGAAGG + Intergenic
1189875854 X:45434942-45434964 AAACTATCCTTCAGGAATGAAGG - Intergenic
1189990914 X:46594198-46594220 ATAATATCCTTCAGGAATGAAGG - Intronic
1190156146 X:47994306-47994328 AAGTTATCCTTCAGGAATGAAGG + Intronic
1191669781 X:63738545-63738567 ATGCGGTGCTTCAGGAAAAATGG - Intronic
1191700486 X:64036774-64036796 AAGCTGTCCTTCAGAAATGAAGG + Intergenic
1191968564 X:66788429-66788451 AAGCTATCCTTCAGGAATAAAGG + Intergenic
1192070877 X:67940182-67940204 CTGCTGTCTTTCTGGATAGAAGG - Intergenic
1192383187 X:70638388-70638410 AAGCTATCCTTCAGAAATGAAGG + Intronic
1192715210 X:73633269-73633291 AAGCTGTCCTTTAGAAATGAAGG - Intronic
1194020666 X:88688094-88688116 AAGCTGTCCTTTAGAAATGAAGG - Intergenic
1194140229 X:90199663-90199685 ATGATCTGCTTCAGGGAAGAGGG - Intergenic
1194576959 X:95625079-95625101 ATGATGTGCCTTAGGAAAGATGG - Intergenic
1194877689 X:99209276-99209298 AAGCTGTCCTTCAGAAATGAAGG - Intergenic
1195251679 X:103053656-103053678 TTTCTGTCCCTCAGGAGAGAGGG - Intergenic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1195816943 X:108898024-108898046 ACACTGTCCTTCAGAAATGAAGG + Intergenic
1197682032 X:129395433-129395455 AAGCTGTCCTTCAGAAATGAGGG + Intergenic
1197904705 X:131412534-131412556 ATGCTGTCCTTAAAGACAGCTGG - Intergenic
1198192131 X:134317660-134317682 AAGCTGTCCTTCAGAAATAAAGG + Intergenic
1198330034 X:135613922-135613944 ATAGTGTCCTGCAGGGAAGAAGG + Intergenic
1198362702 X:135911383-135911405 ATAGTGTCCTGCAGGGAAGAAGG + Intronic
1198520372 X:137446314-137446336 GTGCTGTTTATCAGGAAAGAAGG - Intergenic
1199003404 X:142668005-142668027 AAGCTGTCTTTCAGAAATGAAGG - Intergenic
1199218430 X:145288943-145288965 AAGGTGTCCTTCAGAAATGAAGG - Intergenic
1199354650 X:146847909-146847931 ATGATGACCTTGAGGATAGAAGG + Intergenic
1200485975 Y:3768629-3768651 ATGATCTGCTTCAGGGAAGATGG - Intergenic