ID: 1099325304

View in Genome Browser
Species Human (GRCh38)
Location 12:81207719-81207741
Sequence TCAACTAGCTAGTTGACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099325304_1099325306 16 Left 1099325304 12:81207719-81207741 CCTTGAGTCAACTAGCTAGTTGA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1099325306 12:81207758-81207780 CTCATTCTTCTGTGCTGTCCTGG 0: 1
1: 1
2: 2
3: 19
4: 237
1099325304_1099325307 17 Left 1099325304 12:81207719-81207741 CCTTGAGTCAACTAGCTAGTTGA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1099325307 12:81207759-81207781 TCATTCTTCTGTGCTGTCCTGGG 0: 1
1: 1
2: 1
3: 23
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099325304 Original CRISPR TCAACTAGCTAGTTGACTCA AGG (reversed) Intronic