ID: 1099328699

View in Genome Browser
Species Human (GRCh38)
Location 12:81253312-81253334
Sequence CTGCCACGGTACCATGGGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099328699_1099328704 -2 Left 1099328699 12:81253312-81253334 CCTTTCCCATGGTACCGTGGCAG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1099328704 12:81253333-81253355 AGACTGTGCTGTTGTTGGCAAGG 0: 1
1: 0
2: 2
3: 14
4: 193
1099328699_1099328703 -7 Left 1099328699 12:81253312-81253334 CCTTTCCCATGGTACCGTGGCAG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1099328703 12:81253328-81253350 GTGGCAGACTGTGCTGTTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 176
1099328699_1099328705 14 Left 1099328699 12:81253312-81253334 CCTTTCCCATGGTACCGTGGCAG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1099328705 12:81253349-81253371 GGCAAGGAAGATCCCTTAAAAGG 0: 1
1: 0
2: 0
3: 14
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099328699 Original CRISPR CTGCCACGGTACCATGGGAA AGG (reversed) Exonic
900612044 1:3548353-3548375 CGGCCACAGTCCCATGAGAACGG + Intronic
901194602 1:7433359-7433381 CTGCCACAGTCCCATCTGAAGGG - Intronic
901515674 1:9744298-9744320 CTGGCAGGGGACCCTGGGAAAGG + Intronic
903510339 1:23869834-23869856 CCTCCTCGGTACAATGGGAAGGG - Intergenic
903761403 1:25701232-25701254 CTGCTCAGGCACCATGGGAAGGG + Intronic
903951036 1:26996089-26996111 CTCCCACAGTACCCTGGGCAGGG + Intronic
912395749 1:109342194-109342216 CTGCCAAGATGCCATGGGCAGGG + Intronic
912420111 1:109536912-109536934 CTGCCATGATACCAAGGGAAGGG + Intergenic
915279074 1:154810141-154810163 CTGGCACCTTACCATAGGAACGG + Intronic
918006240 1:180544381-180544403 CTGCCAAGGTTCCAGGGAAATGG + Intergenic
921607109 1:217168760-217168782 CTGCCTCGGTACCAGGGACAGGG - Intergenic
922067521 1:222158514-222158536 CTCCCAAGGGACCAAGGGAAGGG + Intergenic
923830490 1:237550249-237550271 CTGCCACGTTCACATGGCAAAGG - Intronic
924654047 1:245956704-245956726 CTGCTTCGGTACTCTGGGAAGGG + Intronic
1066789304 10:39045358-39045380 CTGCCACAGAACCAGGGAAACGG + Intergenic
1067914765 10:50385397-50385419 CTGCCATGTGATCATGGGAAAGG + Intronic
1074913944 10:117937986-117938008 CTGCTACTGCACCCTGGGAATGG + Intergenic
1076551734 10:131283124-131283146 CTGCCACGGTGCCGTGAGCAAGG + Intronic
1076939545 10:133592604-133592626 CTGCTAAGGTATCATGGGCACGG - Intergenic
1079083544 11:17429984-17430006 CTGCCAGGGTCCCATGAGACAGG + Intronic
1079291983 11:19196606-19196628 CTGGCAAGGTACCAAGGGATGGG + Intronic
1084632064 11:70359396-70359418 CTGCCAGTGTGCCATGGCAATGG + Intronic
1087803503 11:102530496-102530518 CTGCAATGCTAACATGGGAAGGG + Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089328879 11:117676464-117676486 CTGCTATGGTAACAAGGGAAAGG - Intronic
1089821816 11:121235388-121235410 TTGTCACAGTGCCATGGGAAAGG + Intergenic
1095841306 12:46696514-46696536 CTGGCATGGTAAAATGGGAATGG + Intergenic
1099328699 12:81253312-81253334 CTGCCACGGTACCATGGGAAAGG - Exonic
1107050109 13:36037912-36037934 CTTCCAAGGTTCCATGGGTATGG + Intronic
1113147994 13:107230054-107230076 CTGCCAGGTGACTATGGGAAAGG + Intronic
1113920530 13:113906072-113906094 CTGCCATGTTCCCATGGGGAAGG - Intergenic
1114442274 14:22758939-22758961 CTGCTACAGTACCATGTAAAAGG - Intergenic
1116984422 14:51204067-51204089 ATGCCTTGGTCCCATGGGAAAGG + Intergenic
1118642575 14:67806389-67806411 CTCCCACAGTCCCATGGGAAAGG - Intronic
1121558589 14:94857392-94857414 CTGACACGGTCCCATCAGAATGG - Intergenic
1126866653 15:52944302-52944324 CAGCCACAGCACCATGGAAAGGG + Intergenic
1129727607 15:77909521-77909543 CTGCCTGGGTGCCATGGGAGAGG + Intergenic
1129840276 15:78739449-78739471 CTGCCTGGGTGCCATGGGAGAGG - Intergenic
1131132461 15:89909059-89909081 CTGCCAAGGTGCAATGGAAAGGG + Intronic
1134303603 16:13012915-13012937 CTGCCTGGGTACCATGGAGATGG - Intronic
1134392056 16:13829291-13829313 CTGCAAGGGTACCAGTGGAAGGG - Intergenic
1135701308 16:24634797-24634819 GTGCCACTGAACCATGAGAAAGG - Intergenic
1142284261 16:89165353-89165375 CTGCCACTGTCCCATGGCACAGG + Intergenic
1145761925 17:27430163-27430185 CAGCCCCGGGACCATGGGACAGG + Intergenic
1148026911 17:44594915-44594937 CTGCCATGGGACAATGAGAAAGG + Intergenic
1148775031 17:50090381-50090403 CTGCTACAGTACCATGGAAGGGG - Intronic
1148835434 17:50463436-50463458 CTGCCACGGAACCCAGGCAATGG - Exonic
1160511013 18:79453392-79453414 GTGCCACGGCGCCATGGGTAAGG + Intronic
1162416926 19:10543958-10543980 CTGGCCCGGTACCCTGGGGACGG + Exonic
1163761971 19:19142210-19142232 CTGCCACGGGAGCCTGGGGAGGG + Intergenic
1167535848 19:50050867-50050889 CTCCCGCGGTACTCTGGGAAGGG - Intronic
925255010 2:2475871-2475893 CTGGCACTGTACCCTGGGAGAGG + Intergenic
926137631 2:10347677-10347699 CAGACACAGTGCCATGGGAAAGG - Intronic
929158777 2:38811311-38811333 GTCCCACAGTGCCATGGGAAAGG - Intronic
938213992 2:129492641-129492663 CAGCCATGGAACCATCGGAAAGG + Intergenic
938699957 2:133867502-133867524 CTGCCACAGTAGCTTGGAAAGGG - Intergenic
940771472 2:157843664-157843686 CTCCCATGATATCATGGGAAAGG + Intronic
945051855 2:205831485-205831507 CTGCCAAGGTATTATTGGAAAGG - Intergenic
947858410 2:233340380-233340402 CTGCCTCTGAATCATGGGAAAGG + Intronic
1175761137 20:61562702-61562724 CTCCCACCTTGCCATGGGAATGG + Intronic
1184175825 22:42788249-42788271 CTGCCTGGGTGCCGTGGGAAAGG - Intergenic
1184890857 22:47378297-47378319 CTGCCACGGAAACAAAGGAAAGG - Intergenic
950518215 3:13480702-13480724 CTGCCAGGGTGTGATGGGAAGGG + Intronic
954914578 3:54138049-54138071 CTGCGACGATCCCATGGGACAGG + Intronic
957353504 3:79054787-79054809 CTGCCACAGAACCAGGGAAATGG + Intronic
959822820 3:110756871-110756893 CTGCCACGTTGCCAGGGCAAGGG - Intergenic
960381151 3:116963541-116963563 TTACCACAGTACCATGGGATAGG - Intronic
973744660 4:53951311-53951333 CTGCCATGGTACCACAGAAAGGG + Intronic
974123617 4:57668566-57668588 CTGCCATGGTAACATGGGTCTGG + Intergenic
974891893 4:67893275-67893297 CTGACACGGTGCCCAGGGAATGG + Intergenic
976122831 4:81801627-81801649 CTGCCAAGGTAACATGTGATAGG + Intronic
983305073 4:165974802-165974824 CTGCCACGGTATTTTGGCAATGG - Intronic
995066017 5:107863874-107863896 CTGCCATGGTGCACTGGGAAGGG - Intronic
996551567 5:124735692-124735714 CTGCTGCGGCATCATGGGAAAGG + Intronic
997747291 5:136310423-136310445 CTGGGACAGGACCATGGGAAGGG - Intronic
998128636 5:139640106-139640128 CTGCCAGGGTGCCACGGGAAGGG - Intergenic
1006875348 6:37290570-37290592 CAGCCAGGGCCCCATGGGAAAGG - Intronic
1013296555 6:108762784-108762806 CTGCCATGGTTCCCTTGGAAAGG - Intergenic
1017577543 6:155821861-155821883 ATGGCACGGTGCCTTGGGAAGGG - Intergenic
1019436119 7:1023081-1023103 CTGCCATGGTGCCGTGGCAATGG + Intronic
1020680601 7:11232358-11232380 CTGCCAGGAGTCCATGGGAATGG + Intergenic
1022722148 7:32950945-32950967 GTGCCACAGTACAATGTGAAGGG - Intergenic
1024663509 7:51521962-51521984 CTGCTACTTTACCATGGAAAGGG + Intergenic
1027441152 7:78220340-78220362 CAGCCAGGGTACCATGGGTGGGG - Intronic
1028338035 7:89681946-89681968 CTCTCAGGGCACCATGGGAAAGG - Intergenic
1030195599 7:106850417-106850439 CTGGGAAGGTAACATGGGAAAGG - Intergenic
1032845086 7:135745417-135745439 CTGCCAGGGCACCACTGGAAGGG - Intronic
1033598236 7:142871331-142871353 CTGCCTGGGTGCCCTGGGAAGGG + Exonic
1034593404 7:152163647-152163669 CTGCTGTGGCACCATGGGAAAGG + Exonic
1035433229 7:158838131-158838153 CTGACACAGTACCAAGGGAACGG + Intergenic
1035610847 8:962937-962959 CTGCCTCCTGACCATGGGAATGG - Intergenic
1039685226 8:39794539-39794561 CTGGCACCGCACCATGGGACTGG + Intronic
1040626267 8:49152717-49152739 CTGCCAAGGGACTATGGGAATGG + Intergenic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1192220318 X:69193511-69193533 CTTCCACACTGCCATGGGAAGGG + Intergenic
1193500606 X:82269595-82269617 CTGTCAGGGTACCAGGGAAATGG - Intergenic
1193569225 X:83121640-83121662 GTGCCATGGTACCATGGGTATGG + Intergenic