ID: 1099330753

View in Genome Browser
Species Human (GRCh38)
Location 12:81282991-81283013
Sequence AAGCATATGAATCTCCTACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099330752_1099330753 3 Left 1099330752 12:81282965-81282987 CCTACTAAATGATATTAAGGGTC 0: 1
1: 0
2: 0
3: 3
4: 98
Right 1099330753 12:81282991-81283013 AAGCATATGAATCTCCTACCTGG 0: 1
1: 0
2: 0
3: 4
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099330753 Original CRISPR AAGCATATGAATCTCCTACC TGG Exonic
904361834 1:29980552-29980574 ATGCACATTGATCTCCTACCAGG - Intergenic
914896624 1:151681011-151681033 AAGGATATGAATGTCCTGCCAGG - Intronic
916219072 1:162425000-162425022 AAGCATCTTAATCTCCATCCAGG - Intergenic
921416625 1:214896123-214896145 TAGCAAATGAATCAACTACCAGG - Intergenic
923165510 1:231357359-231357381 ATGCATATGCATATCCTAACTGG + Intergenic
923854309 1:237829315-237829337 AAGCTTCAGAATCTCCCACCTGG - Intronic
1067200852 10:44170990-44171012 AAGAATAAGAAGCTCCTAACAGG + Intergenic
1068197603 10:53738078-53738100 AAGCAAATGAATCTGCTGCTAGG - Intergenic
1069824045 10:71244482-71244504 AAGGATATGACTCTTCTGCCTGG - Intronic
1071907198 10:90187420-90187442 AACCATAGGAAGCTCCTATCTGG - Intergenic
1076281250 10:129248343-129248365 GAGAATCTGACTCTCCTACCTGG + Intergenic
1081718760 11:45270787-45270809 AAGCACATCAATCTCTAACCTGG + Intronic
1084082942 11:66840954-66840976 GAGCAAATGAATCTCCCAGCTGG - Intronic
1095486456 12:42689769-42689791 AAGCATGTGAAGCTCCAACCAGG - Intergenic
1097105698 12:56622715-56622737 TAGCAGATGACTCTCATACCAGG + Intronic
1099330753 12:81282991-81283013 AAGCATATGAATCTCCTACCTGG + Exonic
1102919766 12:116783118-116783140 AAGAGTGTGTATCTCCTACCGGG - Intronic
1104592214 12:130093641-130093663 AAGCAGATAAATCACCTCCCTGG + Intergenic
1108727376 13:53197928-53197950 AAGCATTTGAATATCATAGCTGG + Intergenic
1111750371 13:92322877-92322899 AAGCATCTGCATCTCACACCAGG + Intronic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1112290476 13:98141706-98141728 AAGCATCTGAATCGCCTGCAGGG - Intergenic
1114803690 14:25808460-25808482 AATCAAATGACTCTCCTACTTGG - Intergenic
1125932950 15:43613026-43613048 AAGAAGATGATTCTCATACCTGG + Exonic
1125946049 15:43712488-43712510 AAGAAGATGATTCTCATACCTGG + Intergenic
1126415268 15:48411754-48411776 ATGCATCTGAATCACCTACTAGG - Intronic
1128778813 15:70344447-70344469 AAGCTTATTAATCACCTAACAGG + Intergenic
1130895496 15:88167341-88167363 AACCAGATGAGTCTCCTCCCAGG + Intronic
1134167799 16:11944261-11944283 AAGCAGGAGAATCTCTTACCTGG - Intronic
1135585125 16:23664307-23664329 AAGCATGTGAATTTCCTAAGTGG - Intronic
1137514238 16:49129045-49129067 ATGCATTTGAATTTCATACCAGG + Intergenic
1141408136 16:83812487-83812509 AATCATATGGATCACCTTCCAGG - Exonic
1141798786 16:86293064-86293086 AAGCTTATAAATCACCTAGCTGG - Intergenic
1141908776 16:87044583-87044605 AAGCAAATGAAGATCGTACCAGG + Intergenic
1143181016 17:4984243-4984265 AAGAATCTGAAACTCCTGCCAGG - Intronic
1150257654 17:63761042-63761064 AAGCATTTGATTCTCCTTCAAGG - Intronic
1151162223 17:72175413-72175435 AAGCAAATGCTTCTCCTCCCAGG + Intergenic
1203163326 17_GL000205v2_random:71586-71608 AGGTATGTGACTCTCCTACCTGG - Intergenic
1155273426 18:24163494-24163516 AGGCATATGGATTTCCCACCAGG + Intronic
1159183495 18:64941961-64941983 AACCATTTGAATCTCTTCCCTGG + Intergenic
1164171547 19:22729763-22729785 AAGGTTCTGAATCTCCCACCTGG + Intergenic
1164233314 19:23310303-23310325 GAGCTTCTGAATCTCATACCTGG + Intronic
1164303721 19:23984968-23984990 GAGCTTCTGAATCTCATACCTGG - Intergenic
1165252773 19:34554020-34554042 AAGCACCTCAGTCTCCTACCAGG - Intergenic
1165273013 19:34726425-34726447 AAGCACCTCAGTCTCCTACCAGG + Intergenic
1167521941 19:49960434-49960456 CAGCACAAGAATCTCCCACCCGG - Intronic
928812509 2:35246794-35246816 ATGCATATTAATCTCCCTCCGGG - Intergenic
937318602 2:120947650-120947672 ATGCATATAAACCCCCTACCAGG + Intronic
939192364 2:138931642-138931664 AAGCATATGGAGCTCCCAGCCGG + Intergenic
940724188 2:157316075-157316097 ATGCAAATGCATCTTCTACCTGG + Intergenic
941289066 2:163652023-163652045 AAGCATTTGAACTTCCTAACTGG - Intronic
942423804 2:175837935-175837957 AAACATATCAATCTCCTCCATGG + Intergenic
943724875 2:191243408-191243430 CAACATATGAACCTGCTACCTGG - Intergenic
945069378 2:205975693-205975715 TAGCATATCCATCTGCTACCAGG - Intergenic
1174217775 20:48930443-48930465 AAGAAAATGAATTTCCAACCTGG + Intronic
1174652017 20:52134646-52134668 AAACATATGAAACCCCTTCCTGG - Intronic
1175265635 20:57701843-57701865 ACGCACATGAGACTCCTACCAGG + Intronic
1175659646 20:60801684-60801706 AACCATATGAATCCCCCAACAGG - Intergenic
1178939425 21:36892561-36892583 AAGGAAATGAATGTCATACCAGG + Intronic
1181024363 22:20119501-20119523 AAGCTTATAAATCCCCCACCCGG + Intronic
1182964588 22:34509335-34509357 AAGCATGTGAGTCTCCTTCTGGG - Intergenic
951200126 3:19867324-19867346 AAGTAGATGAATCACCTACAGGG - Intergenic
951731732 3:25816792-25816814 AAGAAAATGAATTTTCTACCCGG - Intergenic
955080366 3:55652527-55652549 ATGCATATGAAGCCCTTACCTGG - Intronic
957177250 3:76827381-76827403 AAACAAATGAATCACCTACTTGG - Intronic
962880799 3:139574619-139574641 AAGCATATGCTTTTCCCACCAGG - Intronic
968416802 4:444461-444483 ATGCATATGAATCTAGTAACTGG - Intronic
970713021 4:18886666-18886688 TAGCAAATGAAGCTCATACCAGG - Intergenic
972953936 4:44366227-44366249 AACCATATGAGTCTCCTTCATGG - Intronic
973974034 4:56244279-56244301 CAGCATATGAACCCCCTTCCAGG - Intronic
974310710 4:60206058-60206080 AAGCATATGATACTCCTGCTTGG - Intergenic
978255864 4:106692261-106692283 AACCATATTAACCTCCAACCAGG - Intergenic
978602339 4:110441955-110441977 AAGAATAAGAATCTCCTGCATGG - Intronic
978760026 4:112346929-112346951 AAGCAAATACATCTCCTCCCAGG - Intronic
978985018 4:115001446-115001468 AAACCCATGAATCTCCTAACAGG - Intronic
983079030 4:163362716-163362738 AAGAAAATAAATCTCCTTCCCGG - Intergenic
984268201 4:177519686-177519708 AATCATATGAAACTGCTGCCTGG - Intergenic
986460924 5:7971507-7971529 CAGCATATTTATCTCCTTCCTGG + Intergenic
987178731 5:15343763-15343785 AAACATATTAATCTTCTTCCTGG - Intergenic
987420917 5:17719188-17719210 AAGGGTGTGAGTCTCCTACCAGG - Intergenic
988129714 5:27087435-27087457 ATGCATATGAATTTCTTACATGG - Intronic
989106147 5:37865041-37865063 AAGGATATGCAGCTCCTACGAGG + Intergenic
990906260 5:60806563-60806585 CAGTATTTGAAGCTCCTACCAGG - Intronic
994373030 5:98988661-98988683 AACCATCTTAATCTCCTATCTGG + Intergenic
994934806 5:106240464-106240486 AAAAATATGAATTTCCTACCGGG - Intergenic
995131466 5:108635026-108635048 AAAAATAAGAATCTCCTATCTGG + Intergenic
998179779 5:139928505-139928527 AAGCATATGAACCCCGGACCTGG + Intronic
1000744754 5:165019018-165019040 AAGCATGTGAATCGCCTGCAAGG + Intergenic
1005230798 6:23699699-23699721 AAGTGTATGAATCTCCTTCCTGG + Intergenic
1007985161 6:46200056-46200078 AAGTATAGGGATCTCCTAGCAGG - Intergenic
1008257826 6:49325967-49325989 AACCATATCAATCTCCTATGGGG + Intergenic
1010089464 6:71963339-71963361 GGGCATATGATTCTCCTACTTGG - Intronic
1015442271 6:133262930-133262952 ATGCACATGACTCTCCTCCCTGG - Intronic
1020852664 7:13376917-13376939 AAACTTAGGGATCTCCTACCAGG + Intergenic
1022297665 7:29071418-29071440 AAGCATATGCCTCTACTTCCTGG + Intronic
1022946485 7:35290373-35290395 AAAGATATTTATCTCCTACCTGG - Intergenic
1022954816 7:35371382-35371404 AGGCCTGTGAATCTCCCACCAGG + Intergenic
1028811707 7:95095155-95095177 AATCATCTGTACCTCCTACCTGG - Intronic
1032962895 7:137060432-137060454 AAGCATATCAGTCTTCTACATGG - Intergenic
1035782572 8:2239998-2240020 AAGGAAATGCATTTCCTACCAGG + Intergenic
1035809548 8:2479590-2479612 AAGGAAATGCATTTCCTACCAGG - Intergenic
1037020603 8:13965787-13965809 ATACATATAAATCTCCTACTTGG - Intergenic
1039411759 8:37360720-37360742 CAGCATATGAATCTTTTAGCCGG - Intergenic
1042907246 8:73784569-73784591 AAGCAAATGAATATCCTCTCTGG - Intronic
1052477754 9:28982212-28982234 ATGCATATGAATCACCTAGGAGG - Intergenic
1059084257 9:111283267-111283289 ATGCATATCAATCTGTTACCTGG + Intergenic
1059708396 9:116844862-116844884 AAGCATTTGAATTTCCTTTCTGG - Intronic
1186771827 X:12825910-12825932 AAGCATATGCATATTCTACTTGG - Intergenic
1188048492 X:25455485-25455507 AAGAATGTGTCTCTCCTACCAGG + Intergenic
1189099952 X:38178647-38178669 ATGTATATGAATCTCATGCCAGG + Intronic
1192246149 X:69373305-69373327 AAGCCTATGCACCTCCTTCCAGG + Intergenic
1193541990 X:82783240-82783262 AACCATATCAATGTCCTCCCTGG + Intergenic
1193632980 X:83912323-83912345 AAACAGATGCATCTTCTACCTGG - Intergenic
1198090682 X:133326268-133326290 AAGCATACCAATCAGCTACCTGG + Intronic
1200890067 Y:8313776-8313798 AATTATATGAATCTCTTGCCTGG + Intergenic
1202071892 Y:21000519-21000541 AGTTATGTGAATCTCCTACCTGG - Intergenic