ID: 1099335202

View in Genome Browser
Species Human (GRCh38)
Location 12:81347562-81347584
Sequence CACCCCTCGAAGCCCTGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099335202_1099335205 2 Left 1099335202 12:81347562-81347584 CCCTGGCAGGGCTTCGAGGGGTG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1099335205 12:81347587-81347609 CTTTGGAGTTGAGTGTCCACTGG 0: 1
1: 0
2: 1
3: 15
4: 145
1099335202_1099335206 3 Left 1099335202 12:81347562-81347584 CCCTGGCAGGGCTTCGAGGGGTG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1099335206 12:81347588-81347610 TTTGGAGTTGAGTGTCCACTGGG 0: 1
1: 0
2: 1
3: 16
4: 149
1099335202_1099335210 17 Left 1099335202 12:81347562-81347584 CCCTGGCAGGGCTTCGAGGGGTG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1099335210 12:81347602-81347624 TCCACTGGGGGGAGATGAACTGG 0: 1
1: 0
2: 0
3: 16
4: 142
1099335202_1099335208 5 Left 1099335202 12:81347562-81347584 CCCTGGCAGGGCTTCGAGGGGTG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1099335208 12:81347590-81347612 TGGAGTTGAGTGTCCACTGGGGG 0: 1
1: 0
2: 1
3: 22
4: 170
1099335202_1099335207 4 Left 1099335202 12:81347562-81347584 CCCTGGCAGGGCTTCGAGGGGTG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1099335207 12:81347589-81347611 TTGGAGTTGAGTGTCCACTGGGG 0: 1
1: 0
2: 0
3: 15
4: 172
1099335202_1099335209 6 Left 1099335202 12:81347562-81347584 CCCTGGCAGGGCTTCGAGGGGTG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1099335209 12:81347591-81347613 GGAGTTGAGTGTCCACTGGGGGG 0: 1
1: 0
2: 1
3: 16
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099335202 Original CRISPR CACCCCTCGAAGCCCTGCCA GGG (reversed) Exonic
900541787 1:3206600-3206622 CACCCCTCCCGGCCCTTCCATGG + Intronic
901444702 1:9301032-9301054 CACTGCCCGAAGCTCTGCCAGGG - Intronic
901773599 1:11543949-11543971 CACACCAGGGAGCCCTGCCAGGG - Intergenic
904416165 1:30362240-30362262 CCCCTCTCAAAGCCCTTCCATGG + Intergenic
906616340 1:47235356-47235378 CATCCACCAAAGCCCTGCCAGGG + Intergenic
907304540 1:53506452-53506474 CACCCCACCCAGCGCTGCCAGGG - Exonic
907783157 1:57585733-57585755 CACCACACAAAGCCCAGCCAGGG + Intronic
912625972 1:111204547-111204569 CACCCCACGCTGCCCTGCCCAGG - Intronic
913548790 1:119896448-119896470 CTCCCCCGGAAACCCTGCCAGGG - Exonic
916561001 1:165934058-165934080 CACTTCTCCAAGCCCTGCCTGGG - Intergenic
918526829 1:185473792-185473814 CACCCCTCGACACCCTCCCTAGG - Intergenic
919271928 1:195359754-195359776 CACCCTTGGAAGCCATGGCATGG + Intergenic
922798809 1:228354566-228354588 CACCCCGCAGAGGCCTGCCAGGG - Intronic
1063271573 10:4515177-4515199 CTCCGCTCAAAGCCCTGCAATGG + Intergenic
1072152834 10:92696795-92696817 CAGCCCTAGAAGCCAGGCCAGGG - Intergenic
1073067238 10:100769831-100769853 CACCCCTCCAAGCTCTGAGAAGG - Intronic
1073834773 10:107428727-107428749 TACCTCTAGAAGGCCTGCCAAGG + Intergenic
1074469664 10:113715456-113715478 CACCACTTAAAGCCCTCCCAGGG - Intronic
1074827302 10:117223775-117223797 CACCCCACCTACCCCTGCCAGGG + Intergenic
1076715649 10:132362539-132362561 CTCCCCTCAAGGCCCAGCCAGGG - Intronic
1076885176 10:133258857-133258879 CCCCTCTCGAAGCCAGGCCAGGG - Intergenic
1078453418 11:11457052-11457074 CACATCTGGAGGCCCTGCCAAGG + Intronic
1081229978 11:40574333-40574355 CAGACCTTGAAGCCCTGACATGG + Intronic
1082323228 11:51103621-51103643 CAGGCCTCAAAGCCCTCCCAAGG - Intergenic
1083157731 11:60835461-60835483 AACCCCTGGAAACCCTGCCTTGG - Intergenic
1083629249 11:64087349-64087371 CACCCCTGCCACCCCTGCCACGG + Intronic
1083868439 11:65471575-65471597 CACCCCTGGAAGGACTCCCAAGG + Intergenic
1085037860 11:73310483-73310505 CCCCCCTGGAAGCCCTGACTGGG + Exonic
1090269240 11:125374338-125374360 CATCCCACAAAGCCCAGCCAAGG - Intronic
1091345070 11:134846973-134846995 CTCCCCTCTAAGCCCTGGGATGG - Intergenic
1091392962 12:137041-137063 CACCCCACCCAGCCCTGCCCTGG + Intronic
1091989280 12:4941555-4941577 CATCCCTTGGATCCCTGCCAGGG - Intergenic
1096445740 12:51689990-51690012 CCCCCCCCGAAGCCCATCCATGG + Intronic
1099335202 12:81347562-81347584 CACCCCTCGAAGCCCTGCCAGGG - Exonic
1103463412 12:121123024-121123046 CAGTCCTCGAAGCCCTTCCCAGG + Intergenic
1104000012 12:124854430-124854452 CTCCCCTCAAAGCCCTGACATGG - Intronic
1104634116 12:130427081-130427103 CATCCCCCAAGGCCCTGCCAGGG + Intronic
1104889671 12:132134311-132134333 GAGCCCTCGAGGCCCAGCCACGG + Intergenic
1106058846 13:26265724-26265746 CACCCCTCCAAGATCTGGCATGG - Intronic
1106229795 13:27813019-27813041 CAGCCTTCGAGGCCCTGCCTAGG - Intergenic
1110604431 13:77415309-77415331 CACCCCTCACAGCCCTCCCCAGG - Intergenic
1112564411 13:100540887-100540909 CACCCCTCCCAGCCCGGCCCAGG - Intronic
1113940159 13:114014769-114014791 CACCACTCTGGGCCCTGCCAGGG + Intronic
1114525719 14:23365982-23366004 CGCCCCGCGGGGCCCTGCCAAGG - Intergenic
1116474013 14:45318839-45318861 AGCCCCTTGAAGCCCAGCCATGG + Intergenic
1117567509 14:57010077-57010099 CACCCCTAGCTGCCCAGCCAAGG + Intergenic
1119439525 14:74619016-74619038 CACCCCTCCACCCCCAGCCAGGG - Intergenic
1121102773 14:91261486-91261508 CATCCTTCAAGGCCCTGCCAGGG - Intergenic
1122960128 14:105090435-105090457 TGCCCATGGAAGCCCTGCCAAGG + Intergenic
1124236554 15:27994088-27994110 CAACCCTCCTAACCCTGCCACGG + Intronic
1125483848 15:40098789-40098811 CTCCCCACCAAGGCCTGCCATGG - Intronic
1128385728 15:67146988-67147010 CACCCCGCCAGGCCCTGCCAGGG + Intronic
1128916130 15:71564243-71564265 CACTCCTAGAAGCCCTTCAAGGG + Intronic
1129613871 15:77082789-77082811 CACACCTCCAAGCATTGCCATGG + Intronic
1135924056 16:26676731-26676753 CACCACACCCAGCCCTGCCACGG - Intergenic
1137465742 16:48707315-48707337 CATCCCTGAAAGCTCTGCCAAGG + Intergenic
1138029921 16:53551936-53551958 CACCTCTCCAAGCCCTACCCAGG - Intergenic
1139816592 16:69679323-69679345 TACCCCTTGAAGGCCTGGCATGG + Intronic
1141649096 16:85383749-85383771 GACCCCTCTTAACCCTGCCAGGG - Intergenic
1141957881 16:87384386-87384408 CGCCCCTCCAAGCCCTCCCCGGG - Intronic
1142256340 16:89015511-89015533 CACCCCTCTCAGATCTGCCACGG + Intergenic
1143435086 17:6918422-6918444 CACCCCTCTAAGCCTTGATATGG + Intronic
1144672995 17:17143459-17143481 CACCCCTCCAAGAGCCGCCAGGG - Intronic
1145816970 17:27802227-27802249 CATCCCTCAAAACCCTGCCCTGG - Intronic
1152398185 17:80048006-80048028 CACGCCTGGAATCCCAGCCAAGG + Intronic
1152606594 17:81294715-81294737 CGCCCAGCGAAGCCCTGCCCCGG + Intronic
1152710159 17:81867361-81867383 GACACCTCCAAGCCCGGCCAGGG + Intergenic
1153273423 18:3345491-3345513 CACCTCTGGATGCCCTGACAAGG + Intergenic
1156370127 18:36465559-36465581 CACCCCTGGAAGCAGTGTCAGGG - Intronic
1158269748 18:55699640-55699662 CACCCCTCAAAGCTCTGAGATGG - Intergenic
1160797451 19:952677-952699 CACCCCTCCCACCCCTGCCGTGG + Intronic
1161943094 19:7418054-7418076 CTCTGCTCAAAGCCCTGCCATGG - Intronic
1163552501 19:17973621-17973643 CCCTGCTCAAAGCCCTGCCATGG - Intronic
1165393045 19:35549284-35549306 AACCCCACAAAGCCCTGCCCTGG - Intergenic
1166251269 19:41572669-41572691 CACCCCACTGAGCCCTGCCTGGG + Intronic
1166290991 19:41863424-41863446 CACCCTGCCAAGCCCTCCCAGGG - Intronic
1166365220 19:42274664-42274686 CTCCCCTTGAAGCCCTCCCAAGG - Intronic
1167601174 19:50455653-50455675 CACCCCCACCAGCCCTGCCAGGG - Intronic
925634779 2:5932733-5932755 CACCCCTGGCAGCCCTGCAGAGG + Intergenic
925992997 2:9268965-9268987 CACTCCTCCCAGCCCTGACAGGG - Intronic
927450468 2:23205386-23205408 CACCCCACGAATCACTGCCAGGG + Intergenic
927843264 2:26458299-26458321 GACCCCCAAAAGCCCTGCCATGG + Intronic
931665561 2:64607863-64607885 GACCCCTGGAAGCCCCGCCAAGG - Intergenic
933698763 2:85239330-85239352 GACCCCTCCCTGCCCTGCCACGG + Intronic
934574589 2:95392020-95392042 CCTCCCTGGGAGCCCTGCCAGGG - Intergenic
938691941 2:133799936-133799958 CACACCTCTAAGCCATGCAAGGG - Intergenic
939625989 2:144478038-144478060 CACCCATGGATGCCCAGCCAGGG + Intronic
942063213 2:172247235-172247257 CACCCTGCGAGGCCCAGCCAGGG + Intergenic
943661475 2:190563853-190563875 CACTCATCAAAGCCCTGCCAAGG + Intergenic
946470638 2:219957328-219957350 GACCCCAAGAAGCCCAGCCAGGG - Intergenic
947732374 2:232438565-232438587 ATCACCTCTAAGCCCTGCCAGGG + Intergenic
1170586139 20:17735506-17735528 CAGTCCTTGAAGCCCTGACATGG - Intronic
1171422425 20:25026116-25026138 CAACCCTGGAAGCCAGGCCAGGG + Intronic
1179537000 21:42059305-42059327 CACCCTTGGAAGCCCTGACCTGG + Intergenic
1180127588 21:45802742-45802764 CAGCCCTGGAGGCCCTGCCTGGG - Intronic
1181044152 22:20206756-20206778 CACCCTTCCCAGCCCTGCCCTGG - Intergenic
1181989858 22:26829198-26829220 CACCCCTCAAAACCCTGCTCTGG - Intergenic
1182083049 22:27542838-27542860 CACCTCTCCAAGTCCTCCCAAGG - Intergenic
1183134383 22:35872639-35872661 CACCCGTCAATGGCCTGCCAGGG + Intronic
1183420884 22:37710585-37710607 CACCCCATGAAGCCCTTCCTGGG - Intronic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
1184361728 22:44023200-44023222 CACAGCTCAAAGCCCTGCCTGGG + Intronic
1184597742 22:45524455-45524477 CACACCTCCCAGCCCTGCCGGGG - Intronic
1185151812 22:49168030-49168052 CACCCCTCACTGCCCTGCTAAGG + Intergenic
949404171 3:3697351-3697373 TACCCCTGGTAGCCCTGACAGGG + Intergenic
952195984 3:31075822-31075844 CCTCCCTTGAAGCCCTGCAATGG + Intergenic
953878383 3:46679171-46679193 CCCCCCTCCACACCCTGCCAAGG - Intronic
953979940 3:47408584-47408606 CACCCCTCTAGGCCCTGGCTTGG + Intronic
961536125 3:127572138-127572160 CAACCCTCCAGGCCCTCCCAGGG + Intergenic
961661504 3:128470998-128471020 TCCCTCTCCAAGCCCTGCCAAGG - Intergenic
961726794 3:128936080-128936102 CACCCCTCCAAGCCCTGCCCTGG + Intronic
963503824 3:146160916-146160938 CACCCCTGGAATCCCTGTCTGGG - Exonic
964003925 3:151808089-151808111 AACTCCTCAAAGCCCTGGCAAGG + Intergenic
964735398 3:159912027-159912049 CACTCCTTAAAGCCCTTCCATGG + Intergenic
964969983 3:162548191-162548213 GAAGCCTCGAAGCCCAGCCAAGG + Intergenic
968077670 3:195825305-195825327 CCCCTCAGGAAGCCCTGCCAAGG + Intergenic
968814263 4:2813567-2813589 CACCACTCCCAGCCCTGCCAGGG - Intronic
968962535 4:3752829-3752851 CACACCTCGAATCTCAGCCAGGG + Intergenic
973884150 4:55303813-55303835 CCACCCTCCAAGTCCTGCCAGGG + Intergenic
985508875 5:300508-300530 CTTCCCCTGAAGCCCTGCCAAGG - Intronic
985739249 5:1605408-1605430 CTTCCCCTGAAGCCCTGCCAAGG + Intergenic
985800480 5:2002508-2002530 GGCCCCTCCAAGCCCTGCCCTGG - Intergenic
986027398 5:3863886-3863908 GACCCCTGGAAGGCCTTCCAGGG + Intergenic
990984238 5:61626521-61626543 CACCCCGCGAGGCGCTGGCATGG - Intergenic
992896699 5:81252134-81252156 CAGCCCTTGGAACCCTGCCATGG + Intronic
993252500 5:85547803-85547825 CACTGCTCGAACCCCTGGCAGGG + Intergenic
997509714 5:134445777-134445799 CAGTCCTAGAAGCCCAGCCAAGG + Intergenic
997979355 5:138459342-138459364 CACCCCTCAAAGCCCTCCCTGGG + Intergenic
999256868 5:150214465-150214487 CAGCCCTGGATGCCCTTCCAGGG - Intronic
999697961 5:154202963-154202985 CTGCCATCCAAGCCCTGCCAGGG + Intronic
1001397276 5:171426412-171426434 CTCCCCTCCATGCACTGCCATGG - Intronic
1002057327 5:176606010-176606032 CAGCCCTGGAAGCCCAGCCCTGG + Intronic
1004620225 6:17325031-17325053 AACTCCTCAAAGCCCTGGCAAGG - Intergenic
1006119491 6:31795460-31795482 CACTCCCCGAAGCCCCGCGATGG - Intronic
1013170510 6:107633978-107634000 CCCGCCTCGGAGCCCTCCCATGG + Exonic
1013563175 6:111327302-111327324 CACACCTGTAATCCCTGCCAAGG + Intronic
1016074186 6:139776745-139776767 TACCCCTCTAGGCCCTACCAGGG - Intergenic
1019083709 6:169454841-169454863 CAGCCCTGGCAGCCCAGCCATGG - Intergenic
1019540539 7:1549317-1549339 CACCCCTTGGACCCCTGCGAAGG - Intronic
1019934094 7:4242962-4242984 CACCCCACGAGGCCTTCCCAAGG + Intronic
1021001664 7:15339255-15339277 CACCACACAAAGCCCTGACATGG + Intronic
1023385455 7:39652448-39652470 CATCCCTAGAAGCCCTACTATGG - Intronic
1023658294 7:42448353-42448375 CACCCCTCCAAACACAGCCAGGG - Intergenic
1023718437 7:43068027-43068049 CACCCTTCTATACCCTGCCATGG - Intergenic
1025247154 7:57326042-57326064 CTCTCCTCAAAACCCTGCCATGG + Intergenic
1027624179 7:80527498-80527520 CACTCCTCAAAACCCTGCAATGG - Intronic
1029043633 7:97603809-97603831 CACGCCTGTAATCCCTGCCAAGG + Intergenic
1034435720 7:151061996-151062018 CGCCCCTCGGCGCCCCGCCAAGG + Exonic
1034472662 7:151263883-151263905 CACCCCTGTGAGCCCTGGCAAGG - Intronic
1034558894 7:151867143-151867165 CACCTCTCCAGGCCATGCCATGG + Intronic
1037865885 8:22441558-22441580 CACCCCTCCGAGCCCTCCTAGGG - Intronic
1039395638 8:37223031-37223053 CACCCCTCCATGCACTGCCAAGG + Intergenic
1045872948 8:106946814-106946836 CACCCCCACATGCCCTGCCATGG + Intergenic
1049789300 8:144465703-144465725 CGCCCCTCGCAGCCCCGCCCCGG - Intergenic
1056883879 9:90421205-90421227 AACCCCACAAAGCTCTGCCATGG + Intergenic
1057448689 9:95137496-95137518 CACCTGGCAAAGCCCTGCCATGG + Intronic
1060287269 9:122264947-122264969 CGCCCCTCGAGGCCCTGTCAAGG - Intronic
1061649874 9:132038871-132038893 CTCCGTTCGAAGCCCTGCCACGG - Intronic
1061838965 9:133346920-133346942 CAGCCCTCCAAGCCCTGTCCAGG + Intronic
1061906965 9:133703872-133703894 CACCCACTGCAGCCCTGCCAAGG + Intronic
1062574105 9:137198604-137198626 CACCCCTCAAAGCCAAGCCCAGG + Intronic
1189088694 X:38054566-38054588 CACACCCCAGAGCCCTGCCAAGG - Intronic
1190217493 X:48489560-48489582 CTCTGCTCGGAGCCCTGCCATGG - Intergenic
1196701729 X:118677301-118677323 CATCCCACTAGGCCCTGCCAAGG + Intronic
1199167457 X:144693670-144693692 CATCACTCAAAACCCTGCCATGG + Intergenic