ID: 1099336698

View in Genome Browser
Species Human (GRCh38)
Location 12:81369437-81369459
Sequence TGTAACATGCAGACTGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099336696_1099336698 29 Left 1099336696 12:81369385-81369407 CCAAGCATCAGCAAAACATTGGA 0: 1
1: 0
2: 0
3: 6
4: 146
Right 1099336698 12:81369437-81369459 TGTAACATGCAGACTGTGCATGG 0: 1
1: 0
2: 0
3: 17
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099336698 Original CRISPR TGTAACATGCAGACTGTGCA TGG Intronic
900707862 1:4091468-4091490 GGGAGCATGCAGACTGTTCATGG + Intergenic
901592937 1:10361083-10361105 TGTAACCTGCACACTGTTCAGGG - Intronic
903227318 1:21901332-21901354 AGTATCATGCAGAGGGTGCATGG + Intronic
907865932 1:58399093-58399115 TGTGACATGCTGACATTGCATGG - Intronic
908007726 1:59743935-59743957 TGTGACATGCTGCCTGGGCAGGG - Intronic
908213774 1:61930165-61930187 TGTAAAATGGGGACTGTACACGG - Intronic
911591770 1:99755913-99755935 TGTCAAATGCTGACTGTTCAAGG + Intronic
918083889 1:181228748-181228770 TGTAAGCTGCAGACTTTGGAGGG + Intergenic
922089425 1:222381516-222381538 TGTAACATTCAGTCTTTGCTAGG + Intergenic
923948250 1:238915928-238915950 TGAAACAGGCTGACTCTGCATGG + Intergenic
1064847989 10:19677547-19677569 TCTAACATCCAGAATGTACAAGG - Intronic
1065889960 10:30112579-30112601 TGAAATATCCAGACTGGGCACGG + Intronic
1066254698 10:33667143-33667165 TGAAACATAAAGACTTTGCAAGG + Intergenic
1066408714 10:35144868-35144890 TGTAACTTCCAGGCTGGGCATGG + Intronic
1066440723 10:35436128-35436150 TGTGACATGGGGACTGGGCAAGG + Intronic
1066454228 10:35559345-35559367 TGTGACTTCCACACTGTGCATGG - Intronic
1067300770 10:45006795-45006817 TGTCACACTCAGACTCTGCATGG - Intergenic
1067379733 10:45761839-45761861 TGTAACATGCAGGAGGGGCACGG + Intronic
1068421791 10:56803978-56804000 TGTAACTTGCAGTATATGCAAGG - Intergenic
1068939180 10:62664177-62664199 GTTAAGAAGCAGACTGTGCAGGG + Intronic
1070189652 10:74100264-74100286 TTTAACAGGGATACTGTGCAAGG - Intronic
1071482786 10:86077829-86077851 TGTTTCATGCAGACTGTGTGTGG - Intronic
1072589519 10:96815425-96815447 TATAAAATGCAGGCTGGGCATGG - Intergenic
1074284003 10:112080873-112080895 TGTATCATGAAGGCTGGGCATGG + Intergenic
1075797326 10:125129969-125129991 TGCAACATGCTGGCTGTACAGGG + Intronic
1076453659 10:130574667-130574689 AGGAACATGCAGACTGAGCCTGG - Intergenic
1080322337 11:31025999-31026021 TGTAAAATGCAGAAAGTGCCAGG + Intronic
1080847139 11:36036329-36036351 TGCAGCAAGCAGAGTGTGCAGGG - Intronic
1083339993 11:61952765-61952787 TGTACCATGTGGGCTGTGCATGG - Intronic
1089791808 11:120950954-120950976 TGTTGTATGCAGACTGAGCATGG + Intronic
1090338394 11:125991926-125991948 TGTAATATGCATATTGAGCATGG - Intronic
1091913732 12:4252402-4252424 TGTAAGATACAGACAGTGCCTGG + Intergenic
1092265977 12:6980854-6980876 TGTAACAGGCACTCTGTGCCAGG - Intronic
1095272637 12:40237869-40237891 TTTTACATGAAGACTGTGAATGG - Intronic
1095288918 12:40452384-40452406 TGTAGCAAGCAAACTGTCCATGG + Intronic
1095878221 12:47104929-47104951 TGTACCATGGAGACTGGGCAGGG + Intronic
1099336698 12:81369437-81369459 TGTAACATGCAGACTGTGCATGG + Intronic
1104903177 12:132199978-132200000 CGTAACATCCAGACTCTGCTGGG - Intronic
1105547955 13:21365552-21365574 TGTAGAAGGCAGAGTGTGCAGGG - Intergenic
1105828005 13:24139775-24139797 TGTAACATGCAGGCCGGGCGCGG + Intronic
1106638371 13:31556323-31556345 TCAGACATGCAGACTGAGCAAGG - Intergenic
1107299785 13:38953536-38953558 TGTAACATGTCGACTTTACATGG - Intergenic
1107907978 13:45079066-45079088 TGAAACAGTCAGATTGTGCAAGG + Intergenic
1108632059 13:52294007-52294029 AGTTACATGCAGAGTTTGCAGGG + Intergenic
1108654639 13:52518587-52518609 AGTTACATGCAGAGTTTGCAGGG - Intergenic
1109388057 13:61658290-61658312 TGTAACATCCAGAATCTACAAGG - Intergenic
1110550952 13:76811105-76811127 TGTAAAATGCAGATTATGCTAGG - Intergenic
1111894968 13:94129907-94129929 TGTAACATACAGACCCTGCCTGG - Intronic
1112581638 13:100681243-100681265 TGTATGGAGCAGACTGTGCATGG - Intergenic
1113404797 13:110028684-110028706 TCAGACATACAGACTGTGCAGGG - Intergenic
1116336368 14:43662289-43662311 TGTAATATGCAGACTCATCAAGG + Intergenic
1117268540 14:54116603-54116625 TATATCATGCTGCCTGTGCAGGG - Intergenic
1121999234 14:98632890-98632912 TTGAACATGCAGCCTGCGCATGG - Intergenic
1127395187 15:58538821-58538843 TGTAACATGCAGATTCAGGAAGG - Intronic
1128486634 15:68097721-68097743 TACAACATGCAGGCTGGGCACGG - Intronic
1130388821 15:83436689-83436711 TTTAAAATGCACACTGTCCAGGG - Intergenic
1133829031 16:9304896-9304918 TGGAACATGCTGACTGGACAGGG - Intergenic
1134185395 16:12081103-12081125 TGTAAAATGAAGACAGTGGAAGG + Intronic
1134293964 16:12928370-12928392 TGTAAAATGCAGACAATGGATGG - Intronic
1138391702 16:56675320-56675342 TGTAACATTTAGAATGTGCCAGG - Intronic
1141627578 16:85269363-85269385 TGTAACATACAGACCGTGGCAGG + Intergenic
1142337637 16:89500487-89500509 TGCAGCATGGGGACTGTGCATGG - Intronic
1145291595 17:21551191-21551213 CGTAAAGTGCAGCCTGTGCACGG + Exonic
1145413940 17:22697210-22697232 AGTAATATGCAGAATGTGCAGGG - Intergenic
1145414212 17:22701561-22701583 AGTAATATGCAGACTCTGCAGGG + Intergenic
1150154833 17:62844352-62844374 TTAAACATGCAGGCTGGGCACGG + Intergenic
1152289723 17:79433021-79433043 TGTAACCTGGAGTCTGTGCTGGG - Intronic
1155571428 18:27197962-27197984 TGCAGCATGGAAACTGTGCAAGG + Intergenic
1155686771 18:28563047-28563069 TGTATCATGCAGAATGGGAAGGG - Intergenic
1160209798 18:76867740-76867762 TGTAAGACGCTGACTGTGCGTGG - Intronic
1161510171 19:4666025-4666047 TGGAAAATGCAGGCTGGGCATGG + Intronic
1161557551 19:4952717-4952739 TGTAACATAAAGAATGTGAAAGG + Intronic
1162869936 19:13578614-13578636 TGTACCATACACACTCTGCAGGG - Intronic
1166198626 19:41222033-41222055 TGGAACATGCAGGCTGCGCTGGG - Exonic
1167012805 19:46820050-46820072 TGTTCCATGCAGACTGTGACTGG - Intergenic
1168410280 19:56135583-56135605 TGTCACCTGCAGACAGGGCAGGG + Intronic
926340257 2:11899326-11899348 TGTATCATGTAGCCTGTGAAAGG + Intergenic
926548967 2:14277897-14277919 TGTAATATGCAGAATGTGTAAGG - Intergenic
931489481 2:62727976-62727998 TGAGACATGCAGACTGGGCTGGG + Intronic
932749624 2:74363127-74363149 TGCAACATGCAGAGGGGGCAGGG + Exonic
934975942 2:98802297-98802319 TGTAACACACAGCGTGTGCATGG - Intronic
940663173 2:156573025-156573047 TGATACATGCTGACAGTGCAAGG + Intronic
941870413 2:170378923-170378945 TGTAACAGGCAGACTGGGGAAGG - Intronic
945477626 2:210304108-210304130 AGAAACATGCAGAATGTGCATGG - Intronic
946263418 2:218516666-218516688 GGACACATGCAGAATGTGCAAGG - Intronic
1169271275 20:4201247-4201269 TGTAACATAATAACTGTGCAAGG - Intergenic
1170237471 20:14123179-14123201 TGTAACATTCAGACTATGTTTGG - Intronic
1170758791 20:19230748-19230770 TGTGACATGCGGACTGTGGAAGG - Intronic
1170811956 20:19681017-19681039 TGTGACATGGAAACTGTGCCTGG + Intronic
1172994262 20:39058378-39058400 TATAAGATGCAAAATGTGCATGG + Intergenic
1173891749 20:46517751-46517773 TGTAAAATGCATACAGTGCCTGG - Intergenic
1177414130 21:20772350-20772372 AGACACATGCAGAATGTGCAGGG - Intergenic
1179085011 21:38208163-38208185 GTTAACATGCAGATTGTGCAGGG + Intronic
1184507583 22:44913770-44913792 TGGCACCTGCAGACTGAGCAGGG + Intronic
950803188 3:15572128-15572150 TTTAAAAAGCAGACTGGGCATGG - Intronic
951849012 3:27117703-27117725 TGTAATATCCAGAATCTGCAAGG - Intronic
951919292 3:27836339-27836361 TGTAAAATGCAGACCTTGAAAGG - Intergenic
952729079 3:36620268-36620290 TGCACCATGCAGACTGTACAAGG - Intergenic
953057862 3:39402626-39402648 TGTAACAACCAGGCTGGGCACGG + Intergenic
954383521 3:50232386-50232408 TAAAACATGCAGAATGTGCATGG - Intronic
956520046 3:70094086-70094108 TATAAAATTCAGATTGTGCACGG + Intergenic
958038880 3:88202565-88202587 TCTAACATAGAGACTGGGCATGG + Intergenic
958463524 3:94428771-94428793 TGCAAGATGCAGACTTTGCCAGG + Intergenic
958708139 3:97682713-97682735 TGTGACATATATACTGTGCACGG - Intronic
962051394 3:131819431-131819453 TGTAAAATGCATACTGGGGAAGG - Intronic
962591680 3:136895853-136895875 AATAACATACAGACTGGGCATGG - Intronic
965451466 3:168844482-168844504 TGCAACAAGCAGACTGAGTACGG + Intergenic
965875880 3:173319086-173319108 TATAACATGCAGATTTTTCATGG - Intergenic
967192325 3:186995548-186995570 GTTAAAATGCAGGCTGTGCATGG + Intronic
968504225 4:964543-964565 TGGAACATGGAGACAGGGCAGGG - Intronic
968920633 4:3520649-3520671 GGCCACCTGCAGACTGTGCAGGG + Intronic
969153338 4:5188816-5188838 TGTAACATGGACACAGGGCAGGG + Intronic
969321899 4:6417553-6417575 TGTGCCAGGCAGACTGGGCATGG - Intronic
969519742 4:7669109-7669131 TGTAAAATGCACACTGTCAAGGG - Intronic
970886785 4:20995805-20995827 TGTACCATGCAAAATATGCAAGG + Intronic
971634343 4:29036963-29036985 TGAAACCTGCAGACAGTTCAAGG + Intergenic
974096034 4:57365435-57365457 TCTAAAATGCATACTGTCCAAGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976046230 4:80951341-80951363 TGTGCAATGTAGACTGTGCATGG + Intronic
980519456 4:133911404-133911426 TCTAACATCCAGAGTCTGCAAGG + Intergenic
981149142 4:141361288-141361310 TCTAATATCCAGACTGTACAAGG + Intergenic
981995125 4:150965798-150965820 TGTAACATCAACACTTTGCAAGG - Intronic
982285852 4:153733678-153733700 GGAGAAATGCAGACTGTGCAAGG - Intronic
986114836 5:4762831-4762853 TAAAAAATACAGACTGTGCAAGG - Intergenic
986350902 5:6878545-6878567 CATAACATGTAGACTGTGCAGGG + Intergenic
987171803 5:15267104-15267126 TGTGAAATGCAGGCTGTACAGGG + Intergenic
989620930 5:43383794-43383816 AGTGACATGCAGGCTGGGCACGG + Intronic
991085467 5:62644729-62644751 TGTAACATGCAGGCCATACAGGG + Intergenic
991390995 5:66143782-66143804 AGTAAGATGAAGGCTGTGCAGGG - Intronic
992264767 5:75007703-75007725 TGTCATCTTCAGACTGTGCAGGG - Intergenic
993809739 5:92461216-92461238 TGTAACAACCAGATTGTGCAAGG + Intergenic
995506491 5:112866010-112866032 TCAAACATGCAGGCTGGGCATGG - Intronic
996148886 5:120010746-120010768 AGAAAAATGCAGACTGGGCATGG - Intergenic
996397452 5:123027358-123027380 TGCAAGATGCACACTGGGCAGGG + Intronic
997452733 5:133996449-133996471 AGTATTATGCAGACTGTGCTGGG - Intronic
1000202316 5:159023604-159023626 TGTAACATGCAGATAGTGATTGG + Intronic
1002590075 5:180284735-180284757 TCTAAAATGCACACTGTGGATGG + Intronic
1010550749 6:77220189-77220211 TCTAACATCCAGAATGTGTAAGG + Intergenic
1013462887 6:110392628-110392650 TGTAACATGTAAGCTGAGCACGG - Exonic
1015257544 6:131196552-131196574 TGAAAAATGCAGGCTGAGCACGG - Intronic
1018434325 6:163747440-163747462 TGTAATATGAATACTCTGCAGGG - Intergenic
1018806958 6:167269175-167269197 CGGAACAGGCAGGCTGTGCAGGG + Intergenic
1019585817 7:1802821-1802843 TGAAAGATGCCGTCTGTGCAAGG - Intergenic
1021915111 7:25423652-25423674 TGTCACATGTAGCCTGTGCAAGG - Intergenic
1023071537 7:36439756-36439778 TGACACATGCAGACAGTGGAAGG + Intronic
1023907484 7:44532820-44532842 TGTTACATGCAGACCAGGCATGG + Intronic
1024720103 7:52126982-52127004 GGTAAGATGAAGACTGTGTAGGG - Intergenic
1026031660 7:66799495-66799517 TGTAAAATGCAGATTGTCGAAGG + Intronic
1027837947 7:83270006-83270028 TATAAAATGCAGAGTGTGGATGG + Intergenic
1027918111 7:84352703-84352725 TGTAACATGGATACAGTGTAGGG + Intronic
1030901212 7:115126486-115126508 TGTGACAAGCACACTGTGCCAGG - Intergenic
1032687516 7:134250649-134250671 TGAAACATGCAGACTGAGAGGGG - Intronic
1034418518 7:150977560-150977582 TGTGACACGCTGAGTGTGCAGGG - Intronic
1035068434 7:156124269-156124291 TCTAACATGCAGCCTTTCCATGG + Intergenic
1036397416 8:8381169-8381191 TGTGATTTGCAGACTGTGTAGGG - Intronic
1036919910 8:12842445-12842467 TTTAAAATGCAGACTGTGCCTGG + Intergenic
1036952319 8:13153055-13153077 TTTAACATTCATACTGTGCCTGG + Intronic
1037116023 8:15228901-15228923 TGAAAAATGCAGGCTGGGCATGG + Intronic
1038104324 8:24415821-24415843 TGTCACCTGGAGTCTGTGCAGGG + Intergenic
1039828993 8:41198000-41198022 TGAAACATCCAGACAGTGAAAGG + Intergenic
1040886903 8:52273859-52273881 TGCAACATGCATACAGTGTATGG + Intronic
1040890279 8:52309954-52309976 TGCATCATGTATACTGTGCATGG + Intronic
1046759705 8:118008540-118008562 TATAAAATGCAGGCTGGGCATGG - Intronic
1051161039 9:14207566-14207588 TGTCACATGCAGTCCCTGCACGG - Intronic
1051346174 9:16153049-16153071 GGTAACAAGCAGAATGAGCAGGG + Intergenic
1051746926 9:20303851-20303873 GCTAACATGCAGACAGGGCAGGG + Intergenic
1053144701 9:35704511-35704533 TGTCACATGGTGACTGTGGAAGG + Intronic
1053416625 9:37950889-37950911 TGTAAAATGCAGCCTCTGGATGG - Intronic
1055150829 9:72997435-72997457 TGTAACATTCAGTCTGCACAAGG - Intronic
1058317262 9:103584186-103584208 TGTAACTTCCAGAATGTGCCTGG - Intergenic
1059919892 9:119148179-119148201 TTTAACATGCTGACATTGCAAGG + Intergenic
1186935482 X:14446113-14446135 TGCTACAGGCTGACTGTGCAAGG + Intergenic
1189401139 X:40669768-40669790 TATCTCAGGCAGACTGTGCAGGG - Intronic
1191614696 X:63156626-63156648 TCTAACATCCAGAGTCTGCAAGG + Intergenic
1191621600 X:63222301-63222323 TCTAACATCCAGAGTCTGCAAGG - Intergenic
1192926530 X:75759949-75759971 TGGAATATGCAGGCTGTGCAGGG - Intergenic
1194697144 X:97067081-97067103 TGTAATATGTAGCATGTGCAAGG + Intronic
1199026914 X:142950359-142950381 TCTAATATCCAGACTGTGCAAGG - Intergenic
1201352259 Y:13056734-13056756 TGTAACATCCAGAGTATACAAGG - Intergenic
1201699232 Y:16861809-16861831 TGAAACAGGCAATCTGTGCATGG - Intergenic
1202329122 Y:23727466-23727488 TGTGAAATCCAGACTTTGCATGG + Intergenic
1202541649 Y:25942588-25942610 TGTGAAATCCAGACTTTGCATGG - Intergenic