ID: 1099353138

View in Genome Browser
Species Human (GRCh38)
Location 12:81598500-81598522
Sequence CAGTATATGAAACATGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 326}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099353138 Original CRISPR CAGTATATGAAACATGCTTC AGG (reversed) Intronic
902857313 1:19217603-19217625 CAGAATCTGAAACAAGCTACTGG - Exonic
908012470 1:59793255-59793277 CAGTATATGCAACACTCTCCAGG + Intergenic
909745674 1:79094593-79094615 GAGAATATTAAACATGCTTTAGG + Intergenic
910357794 1:86379161-86379183 CTGTATAGGAAGCATGATTCTGG - Intronic
911805963 1:102208765-102208787 CAGCACATGAAACATTCTCCAGG - Intergenic
915683669 1:157608097-157608119 CAGCACATGAAACATTCTACAGG + Intergenic
915761794 1:158320937-158320959 CAGTACATGGAACATTCTCCAGG - Intergenic
917005155 1:170406948-170406970 TAGTGTATGAAACATGATTTAGG + Intergenic
918593908 1:186270494-186270516 TATTTTATGAAACATGCTTTTGG - Intergenic
918652955 1:186988497-186988519 CAGTACATGAACTATGCTTTGGG - Exonic
923809274 1:237294702-237294724 CAGTATATAGATAATGCTTCTGG + Intronic
923876517 1:238055025-238055047 CAGTATAAAAAACATGTTTTTGG + Intergenic
924618680 1:245639890-245639912 CAGTACATGGAACATTCTCCAGG - Intronic
924674925 1:246166161-246166183 CAGTGTATGTGTCATGCTTCTGG + Intronic
924837225 1:247663047-247663069 CAGCAAATGAAACATATTTCAGG - Intergenic
1062883927 10:1001820-1001842 CAGTCCATGAAACATTCTCCAGG - Intronic
1062990897 10:1815920-1815942 GAGTATATGGAACATTCTCCAGG - Intergenic
1063765587 10:9136623-9136645 CAGTATATGAAACTTCGTTGTGG - Intergenic
1064893240 10:20204048-20204070 CAGTATATAATAAATGGTTCAGG + Intronic
1065041519 10:21702370-21702392 CAGCATATGGAACATTCTCCAGG - Intronic
1065843263 10:29723528-29723550 CAGACTATGAACAATGCTTCAGG + Intronic
1066151407 10:32623720-32623742 CAGTACAAGAAACATGGTGCCGG + Intronic
1067929169 10:50542263-50542285 GAGAATAATAAACATGCTTCCGG - Intronic
1068069454 10:52178426-52178448 CAGTATATGGAACATTCCCCAGG - Intronic
1068278879 10:54841128-54841150 CTGTACATGAAACATTCTTCAGG + Intronic
1070211461 10:74327423-74327445 TTGAACATGAAACATGCTTCAGG - Intronic
1070849291 10:79550650-79550672 CAGCATTTGAAAGATGATTCTGG + Intergenic
1070924563 10:80210440-80210462 CAGCATTTGAAAAATGATTCTGG - Intergenic
1071418749 10:85467024-85467046 CAGTATATGGATCATTCTTAAGG + Intergenic
1071516751 10:86302708-86302730 CAGTAGCTGAAACATTCTACAGG + Intronic
1074344700 10:112672888-112672910 AAGTATATGAACAATGCCTCAGG + Intronic
1075809202 10:125212194-125212216 CAGTACATGAAATAACCTTCCGG - Intergenic
1077673444 11:4178017-4178039 CAGCATATGGAACATGCTCCAGG - Intergenic
1078029382 11:7734340-7734362 CTGCACATGAAACATGCTACAGG + Intergenic
1079526427 11:21394512-21394534 CTGCATATAAAACATGCCTCTGG - Intronic
1079824259 11:25171361-25171383 CAGAACATGAAACATTCTCCAGG + Intergenic
1080149009 11:29025803-29025825 CAGAATATGAATCATGCCTAAGG - Intergenic
1080318198 11:30973948-30973970 CAGTACATGGAACATTCTCCAGG + Intronic
1080486275 11:32710616-32710638 CAGTACATGGAACATTCTCCAGG - Intronic
1080524299 11:33098716-33098738 CAGTATATATAACAGACTTCTGG - Exonic
1080907212 11:36558203-36558225 CAGCACATGAAACATTCTCCAGG - Intronic
1082859744 11:57843862-57843884 GTGCATATGAAACATTCTTCAGG + Intergenic
1083059469 11:59854547-59854569 AAGTATATTTAAAATGCTTCTGG - Intronic
1086123351 11:83324625-83324647 CAGCACATGAAACATTCTCCAGG - Intergenic
1086272720 11:85087395-85087417 CAGTGTATGAAGAATGCTCCAGG + Intronic
1087757545 11:102070975-102070997 CAGCACATGGAACATTCTTCAGG - Intronic
1088941120 11:114457333-114457355 CAGGATAAGAAACATGATTTTGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089758303 11:120703488-120703510 CAGTGGAAGAAACAGGCTTCAGG - Intronic
1089804835 11:121076205-121076227 AAGTCTGTGAAACATTCTTCTGG + Intronic
1089952277 11:122539831-122539853 CTGTACGTGAAACATTCTTCAGG + Intergenic
1090911705 11:131126427-131126449 CAGGACATGAAACATTCTCCAGG - Intergenic
1091598064 12:1893198-1893220 CAGCACATGAAACATTCTCCAGG + Intronic
1091809399 12:3382744-3382766 CCTTTTATGAAACATGCTTTTGG + Intronic
1092467593 12:8747091-8747113 GAGTATATGGAAAATGCTTCTGG + Intronic
1092622909 12:10292833-10292855 GTGTACATGAAACAGGCTTCTGG - Intergenic
1092651398 12:10639260-10639282 CATCCTATGAAACAAGCTTCCGG + Intronic
1092683040 12:11009506-11009528 CAGAATATCTAACATACTTCTGG - Intronic
1093578281 12:20761623-20761645 TAGCATATGAAACATTCTCCAGG + Intergenic
1095254139 12:40014161-40014183 CATTATTTGACACATGTTTCTGG - Intronic
1095459839 12:42431662-42431684 CAGTTTATGAAACACCATTCAGG + Intronic
1096930606 12:55204630-55204652 CAGCACATGAAACATTCTCCAGG + Intergenic
1099353138 12:81598500-81598522 CAGTATATGAAACATGCTTCAGG - Intronic
1100782618 12:98045584-98045606 GATTTTATGAAACATGCCTCTGG - Intergenic
1101637291 12:106554946-106554968 CTGTATAGGAAGCATGCTTGGGG - Intronic
1107286496 13:38799393-38799415 CATTACATGGAACATTCTTCAGG - Intronic
1108157336 13:47599345-47599367 CTGTATATGAAACATGATGCTGG - Intergenic
1108871801 13:54996549-54996571 AAGTATATGAAACCAGCTTCTGG + Intergenic
1109648971 13:65299510-65299532 CAGTATATGAAATAAGCATAAGG + Intergenic
1110055688 13:70967651-70967673 CAGAATTTGAAAGATGCTTTAGG - Intergenic
1111943766 13:94641867-94641889 CACTGTATAATACATGCTTCAGG + Intergenic
1112935280 13:104789596-104789618 CATTATATGAACTTTGCTTCTGG + Intergenic
1112943636 13:104897133-104897155 CAGTATATGACTCTTGATTCTGG - Intergenic
1113274241 13:108710552-108710574 CAACATATGTAGCATGCTTCAGG - Intronic
1114085800 14:19236208-19236230 TAGGATAACAAACATGCTTCAGG + Intergenic
1116243836 14:42382427-42382449 TAGATTATGAAACCTGCTTCAGG - Intergenic
1116486046 14:45450238-45450260 CAGCATATGCAACATTCTCCAGG - Intergenic
1118764836 14:68902771-68902793 CAGTATAAGGAACTTGCTACAGG + Intronic
1119774068 14:77237710-77237732 CAGTATTTGAAGCATGCTGCAGG + Intronic
1119880467 14:78095603-78095625 CACCATATGAAACATGTTCCTGG + Intergenic
1121069341 14:91003216-91003238 TAGTATATGAACAATGCTTTTGG - Intronic
1121124431 14:91397081-91397103 CTGTATCAGAAACATGATTCTGG + Intronic
1124079314 15:26476483-26476505 CATAACATGAAACAAGCTTCTGG - Intergenic
1124611245 15:31210530-31210552 CAGAATGTGAGACATTCTTCAGG + Intergenic
1126244789 15:46491798-46491820 CAGCATATGGAACATTCTCCAGG + Intergenic
1126490090 15:49227056-49227078 CAGCAGATGAAACATTCTCCAGG - Intronic
1126691356 15:51291189-51291211 TATGATCTGAAACATGCTTCAGG + Intronic
1127227166 15:56943572-56943594 CAGAAAAGGAAACAGGCTTCAGG + Intronic
1128993914 15:72282664-72282686 CAGCATATAACACATCCTTCTGG - Intronic
1129963234 15:79709172-79709194 CAGTATGTGAAACTTTCTCCAGG - Intergenic
1131660362 15:94508024-94508046 CAGCACATGAAACATTCTCCAGG + Intergenic
1132023683 15:98386291-98386313 CAGTATATTAAACAGGCTCTTGG + Intergenic
1137917188 16:52444960-52444982 CAGCATATTAAACATGATTTGGG + Intronic
1138993054 16:62415249-62415271 CAGTACATGAAACATTCTGCAGG - Intergenic
1141287086 16:82682608-82682630 AATTACATAAAACATGCTTCTGG + Intronic
1141926179 16:87171127-87171149 CAGTGTAGGAAACATCCTGCAGG + Intronic
1141965574 16:87440507-87440529 CAGAATTTGTAACATGTTTCAGG + Intronic
1144613156 17:16743172-16743194 AAATATATGGAAAATGCTTCAGG - Intronic
1144899584 17:18572135-18572157 AAATATATGGAAAATGCTTCAGG + Intergenic
1145132816 17:20373251-20373273 AAATATATGGAAAATGCTTCAGG - Intergenic
1147300904 17:39526506-39526528 CAGTATAGGAAAGGTGCTTTGGG - Intronic
1149232431 17:54550889-54550911 CAGTCCTTGAAACATTCTTCAGG - Intergenic
1149897583 17:60440950-60440972 CAGTAAATGTAATATGCTTGAGG - Intergenic
1150793279 17:68217139-68217161 CAATATATGAAACAGCATTCAGG + Intergenic
1151262826 17:72930126-72930148 CAGCATTTTAAACAAGCTTCTGG + Intronic
1153200404 18:2641881-2641903 CAATATTTGAAACATGCTGCTGG - Intergenic
1153985554 18:10347481-10347503 CAGTACATGATACATGATTCTGG + Intergenic
1154239665 18:12641238-12641260 GAGTTTATTAAATATGCTTCTGG + Intronic
1154416209 18:14177309-14177331 CAGTATATAAAACATGCTAAGGG + Intergenic
1155088267 18:22478870-22478892 CAGCACATGAAACATTCTCCAGG + Intergenic
1156699916 18:39813830-39813852 CAGTTTAGAAAACATGTTTCAGG - Intergenic
1156810123 18:41239074-41239096 AAGCATAGGAAACATGCTCCAGG - Intergenic
1157398561 18:47366124-47366146 CAGTACATGGAACATTCTCCAGG - Intergenic
1158146386 18:54318376-54318398 CAATATATGAAAGATATTTCTGG + Intronic
1159233516 18:65640078-65640100 CAATAAATTAAAAATGCTTCTGG - Intergenic
1161413325 19:4129625-4129647 CAGTAAATGAATCATCCTTCTGG + Intergenic
1165165634 19:33852874-33852896 CAGTACACGAAACATTCTCCAGG + Intergenic
1167773140 19:51534732-51534754 CAGTACATGAAACATTCTCCAGG - Intergenic
925078597 2:1041099-1041121 CAGGATATGTAACATGCTGCGGG - Intronic
927080792 2:19628432-19628454 CAGCATATGAAACATTCTCCAGG + Intergenic
930860532 2:56067602-56067624 CAGCACATGGAACATTCTTCAGG - Intergenic
931068781 2:58620451-58620473 CATTATATGAAATCTGATTCAGG - Intergenic
931601963 2:64013300-64013322 CAGAATGTGGAACATGCTCCAGG + Intronic
933074651 2:77907762-77907784 AAGTATGTGAAACAAGATTCAGG + Intergenic
934153060 2:89168233-89168255 CAGTATATGAAATGAGATTCAGG + Intergenic
934214180 2:90013698-90013720 CAGTATATGAAATGAGATTCAGG - Intergenic
935887902 2:107643969-107643991 GTGTACATGAAACATTCTTCAGG - Intergenic
936745515 2:115571810-115571832 AAGTATAATAAAAATGCTTCAGG - Intronic
936892364 2:117387193-117387215 CAGCATATGGAACATTCTTCAGG - Intergenic
937772619 2:125738703-125738725 CAGCATGTGAAACATTCTCCAGG + Intergenic
940362311 2:152809664-152809686 CAGTTTATGAAACATTCTCTAGG - Intergenic
940587961 2:155679746-155679768 CAGAATATTAATCATGCCTCAGG - Intergenic
940614590 2:156034295-156034317 TAGTATATGGGACATCCTTCAGG + Intergenic
940819306 2:158334187-158334209 CAGTTTATGAATTATGGTTCAGG + Intronic
941301547 2:163808683-163808705 CTCTATAAGAAACATGCTGCTGG - Intergenic
942237559 2:173926956-173926978 CTGTATAGGAAGCATGATTCTGG + Intronic
942883015 2:180885484-180885506 CAGTACATGAAATATTCTCCAGG + Intergenic
943456234 2:188110975-188110997 CAGTATATTCAAAATTCTTCAGG + Intergenic
943475938 2:188354759-188354781 CAGCACATGAAACATTCTCCTGG + Intronic
943484476 2:188462354-188462376 CAGCACATGAAACATTCTTAAGG - Intronic
944144279 2:196489598-196489620 AAGTATTTGAAACAGGCTTGTGG - Intronic
945789774 2:214290810-214290832 CAGCAAATGGAACATTCTTCAGG - Intronic
947407781 2:229798700-229798722 CAGTTTATGAACCCTGCATCTGG - Intronic
947474074 2:230426679-230426701 GTGTATATGAAACATTCTCCAGG - Intronic
949081738 2:242106151-242106173 CTGTATATGAATTATGCCTCAGG + Intergenic
1171241672 20:23573589-23573611 CAGCACATGAAACATTCTCCAGG - Intergenic
1171288029 20:23958549-23958571 CAGCTTCTGAAACATGCCTCTGG - Intergenic
1175455792 20:59112761-59112783 CAGAATGTGAAACTTGCTACAGG + Intergenic
1176857139 21:13981987-13982009 CAGTATATAAAGCATGCTAAGGG - Intergenic
1176867467 21:14062239-14062261 CAGTATATAAAGCATGCTAAGGG + Intergenic
1177622818 21:23618935-23618957 CAGTATATGAGACACCATTCAGG + Intergenic
1179029130 21:37704561-37704583 CACTATATAAAACATGCTTGAGG + Intronic
1183275379 22:36893379-36893401 CTGTGTATGAGACATGCTTATGG + Intergenic
949709467 3:6858149-6858171 CATTATTTGAAACATGGTCCCGG + Intronic
951334209 3:21401632-21401654 CAGCACATGAAACATTCTTCAGG + Intergenic
951398962 3:22206486-22206508 CAGCATATGAATCATTCTTAAGG + Intronic
952972801 3:38664188-38664210 CAGTACATGGAACATACTCCAGG + Intergenic
953511783 3:43548645-43548667 AAGTATATGAAACACCATTCAGG + Intronic
955052684 3:55427994-55428016 CAGTATATGCACCAAGCCTCAGG - Intergenic
955932324 3:64069706-64069728 CAGCATATGGAACATTCTCCAGG - Intergenic
956332084 3:68122368-68122390 CAGAAGATAAAACATTCTTCTGG - Intronic
956400035 3:68868460-68868482 CAGCATATGGAACATTCTCCAGG + Intronic
957304871 3:78444244-78444266 CAGCATATGGAACATTCTCCAGG + Intergenic
957506533 3:81128211-81128233 CAGCACATGAAACATTCTACAGG + Intergenic
958267645 3:91458270-91458292 CAGGATTTGGAACATGCTTCAGG - Intergenic
958391280 3:93470645-93470667 CGGTATATAATACATGCTTTGGG + Intergenic
958576959 3:95962746-95962768 CAGTACATGGAACATTCTCCAGG + Intergenic
958713011 3:97741004-97741026 CAGAATATGAAAGATGGATCAGG + Intronic
959038330 3:101390810-101390832 CAGCATATGGAACATTCTCCAGG + Intronic
961989035 3:131167939-131167961 AAACATAGGAAACATGCTTCTGG - Intronic
962043908 3:131735376-131735398 GTGTTCATGAAACATGCTTCAGG - Intronic
963455938 3:145547898-145547920 CAGTACATGAAACATTCTCTAGG - Intergenic
965094875 3:164212752-164212774 AAGCACATGAAACATTCTTCAGG + Intergenic
965422672 3:168481382-168481404 CAGTATAAGAAACATGATAGGGG + Intergenic
965865192 3:173197240-173197262 CTGTACAGGAAACATGCTTTGGG + Intergenic
966530741 3:180976274-180976296 CAGTTTATGAAACACCATTCAGG - Exonic
968435548 4:586055-586077 CTGTATGTGAAACATTCGTCAGG - Intergenic
969144229 4:5106784-5106806 TAGTAAATGAAACATTTTTCAGG - Intronic
969169767 4:5351184-5351206 CAGTACATGAAACATTCTCCAGG + Intronic
969940796 4:10729030-10729052 CATCATATAAAACATGCATCTGG - Intergenic
971530140 4:27677309-27677331 CAGTACATGAAACATCCTCCAGG - Intergenic
971850808 4:31984495-31984517 CAGTACTTGAAACTTGCTTTTGG - Intergenic
973115858 4:46458080-46458102 CAGCATATGGAACATTTTTCAGG + Intronic
973243229 4:47981071-47981093 CAGTATATGACACTTCCTTTGGG + Intronic
973404358 4:49709372-49709394 CAGTATATAATACATACTTTGGG - Intergenic
973404360 4:49709414-49709436 CAGTATATAATACATACTTTGGG - Intergenic
973404364 4:49709498-49709520 CAGTATATAATACATACTTTGGG - Intergenic
973404366 4:49709540-49709562 CAGTATATAATACATACTTTGGG - Intergenic
973404374 4:49709784-49709806 CAGTATATTATACATACTTTGGG - Intergenic
973404385 4:49710110-49710132 CAGTATATAATACATACTTTGGG - Intergenic
973404402 4:49710521-49710543 CAGTATATAATACATACTTTGGG - Intergenic
973404406 4:49710605-49710627 CAGTATATAATACATTCTTTCGG - Intergenic
973404407 4:49710647-49710669 CAGTATATAATACATACTTCGGG - Intergenic
973404414 4:49710773-49710795 CAGTATATAATACATACTTTGGG - Intergenic
973404423 4:49710975-49710997 CAGTATATAATACATACTTTGGG - Intergenic
973404425 4:49711017-49711039 CAGTATATAATACATACTTTGGG - Intergenic
973404436 4:49711268-49711290 CAGTATATAATACATACTTTGGG - Intergenic
973404440 4:49711352-49711374 CAGTATATAATACATACTTTGGG - Intergenic
973404442 4:49711394-49711416 CAGTATATAATACATACTTTGGG - Intergenic
973404450 4:49711604-49711626 CAGTATATAATACATACTTTAGG - Intergenic
973404457 4:49711848-49711870 CAGTATATAATACATACTTTGGG - Intergenic
973488933 4:51107257-51107279 CAGTATATAATACATACTTTAGG - Intergenic
973488942 4:51107467-51107489 CAGTATATAATACATACTTTGGG - Intergenic
973507843 4:51418806-51418828 CAGTATATAATACATACTTTGGG - Intergenic
973507845 4:51418849-51418871 CAGTATATAATACATACTTTGGG - Intergenic
976371726 4:84297128-84297150 CACCACATGAAACATTCTTCAGG + Intergenic
978110825 4:104962169-104962191 CAGCACATGGAACATTCTTCAGG - Intergenic
978842089 4:113227127-113227149 GAGAATGTGAAACATGCCTCTGG - Intronic
979132186 4:117061105-117061127 ACTTATATGAAACCTGCTTCAGG + Intergenic
979712826 4:123801053-123801075 CTGTACATGAAACATTCTCCAGG - Intergenic
980094351 4:128474144-128474166 GAGTATCTCAAACATGCTTGCGG + Intergenic
980106214 4:128591182-128591204 CAGTTTTTGAAACTAGCTTCTGG - Intergenic
980465360 4:133171050-133171072 CTGTAGATGAAACAGGTTTCTGG + Intronic
980818831 4:137985981-137986003 CAGCATATGAAACATTCTCCAGG + Intergenic
980864039 4:138532888-138532910 CAGTACATGGAACATTCTCCAGG + Intergenic
981358030 4:143814254-143814276 AATTATATGAAACATTCTACTGG + Intergenic
981379018 4:144050304-144050326 AATTATATGAAACATTCTACTGG + Intergenic
981969158 4:150645508-150645530 CAGTATCTGAAAAATACTTCTGG - Intronic
982329298 4:154163676-154163698 CTGTACAGGAAACATGATTCTGG + Intergenic
982602045 4:157464075-157464097 ATGTATATTAAACATTCTTCAGG + Intergenic
983931615 4:173459321-173459343 CAGCACATGAAACATTCTCCAGG + Intergenic
986668016 5:10119755-10119777 CTGTACAGGAAACATGATTCTGG - Intergenic
986890764 5:12302211-12302233 CAGCACATGAAACATTCTCCAGG + Intergenic
987429755 5:17818168-17818190 CAGTGTTTGCAACATTCTTCTGG + Intergenic
987439214 5:17935149-17935171 TAGCACATGAAACATGCTCCTGG + Intergenic
987796301 5:22631696-22631718 CTGTATAGGAAGCATGATTCTGG + Intronic
987796370 5:22632236-22632258 CTGTATAGGAAGCATGATTCTGG - Intronic
988436923 5:31187016-31187038 CAGCATATGAAAAAGGCTTTTGG + Intergenic
988626546 5:32882057-32882079 CAGCATATAAAACATTCTGCAGG - Intergenic
989231186 5:39087924-39087946 CAGCACATGGAACATTCTTCAGG + Intergenic
989800306 5:45529961-45529983 AAAGATATGTAACATGCTTCTGG + Intronic
991480541 5:67073770-67073792 AAGTATATGAAAAATACTTAAGG + Intronic
992469148 5:77038725-77038747 CAGTACATTAAAGATGTTTCCGG + Intronic
992800709 5:80293303-80293325 CAACATATCCAACATGCTTCTGG - Intergenic
993057270 5:82996347-82996369 CATTTTATGAAATATGCATCTGG + Intergenic
993101765 5:83549149-83549171 CAATATGTTAAACATGATTCTGG + Intronic
993330920 5:86598807-86598829 CAGTACATGGAACATTCTCCAGG + Intergenic
993335621 5:86654456-86654478 CATTACATGACACATGCTTGGGG + Intergenic
993981869 5:94552469-94552491 CAGCACATGGAACATTCTTCAGG + Intronic
993990889 5:94657469-94657491 TAGTATATGGGACATTCTTCCGG - Intronic
994430848 5:99659137-99659159 CTGTACAGGAAACATGGTTCAGG - Intergenic
997850558 5:137329007-137329029 CATTCTATGAAACATGATTCTGG + Intronic
1000928723 5:167226612-167226634 CAGCACATGAAACATTCTCCAGG - Intergenic
1001224545 5:169932475-169932497 CAGTTGATGGAACATGCTTCTGG + Intronic
1001930864 5:175672143-175672165 GAGGATATGAAACTTGCTTGAGG + Intronic
1003520043 6:6850602-6850624 CTGTATTTTTAACATGCTTCAGG - Intergenic
1003991320 6:11489355-11489377 CAGGATCAGAAATATGCTTCAGG - Intergenic
1004552450 6:16662039-16662061 CAATGTATGAAACACTCTTCTGG + Intronic
1007026015 6:38575036-38575058 CAATACATGACACATTCTTCAGG + Intronic
1007639003 6:43321593-43321615 AAGTGTATGAAACATTCTCCAGG + Intronic
1008557485 6:52688394-52688416 CATAACATGAAAAATGCTTCTGG - Intergenic
1008584696 6:52938022-52938044 TAGACAATGAAACATGCTTCTGG + Intergenic
1008987569 6:57563320-57563342 CAGGATTTGGAACATGCTTCTGG + Intronic
1009176171 6:60461925-60461947 CAGGATTTGGAACATGCTTCAGG + Intergenic
1010277039 6:73980526-73980548 CTATATATGAAAAATGCATCTGG + Intergenic
1010613719 6:77987601-77987623 CAGTGCATGGAACATTCTTCAGG + Intergenic
1010779368 6:79927485-79927507 CTGTATATGCAAAATGCTTCTGG + Intronic
1010809064 6:80278341-80278363 CAGAATACTAAACAGGCTTCAGG - Intronic
1011085719 6:83538230-83538252 CAGTGTATGAAACATCTTTGGGG - Intergenic
1011919330 6:92551948-92551970 CAGAATATGTAATATGCTGCTGG + Intergenic
1012025748 6:93988339-93988361 CAGCACATGGAACATCCTTCAGG + Intergenic
1012239089 6:96851736-96851758 CAGTTTGAGAAAGATGCTTCTGG + Intergenic
1012713977 6:102645764-102645786 CAGTAACCGAAACATGGTTCTGG - Intergenic
1014697061 6:124636001-124636023 CAGGACATGAAACATTCTCCAGG + Intronic
1014737365 6:125109738-125109760 CTGTACATGGAACATTCTTCAGG - Intergenic
1015343141 6:132125443-132125465 CATTATAAGACACTTGCTTCAGG + Intergenic
1015855538 6:137620588-137620610 CAAAATTTGAAACTTGCTTCAGG + Intergenic
1016664380 6:146618781-146618803 CAGCACATGAAACATTCTCCAGG - Intronic
1016911580 6:149204618-149204640 CTGTATAGGAAGCATGATTCTGG + Intergenic
1017019917 6:150131713-150131735 CAGTACAAGAAGCATGCTGCTGG - Intergenic
1017396448 6:154005130-154005152 CAGTATATGAATCATTCTCAAGG + Intergenic
1018348773 6:162933279-162933301 CAGCACATGAAACATTCTCCAGG - Intronic
1018895132 6:168010555-168010577 CAGCAAATGGAACATTCTTCAGG - Intronic
1019054101 6:169208862-169208884 CAGCATATGGAACATTCTTCAGG + Intergenic
1020716624 7:11681671-11681693 CAGTTTAGGAAACATCGTTCAGG + Intronic
1020719313 7:11721488-11721510 CTGTATAGGAAACATGGTTGGGG - Intronic
1023200377 7:37690740-37690762 CAACACATGAAACATTCTTCAGG - Intronic
1024433979 7:49327273-49327295 CTGTCCATGAAACATGCTGCCGG + Intergenic
1025018574 7:55463151-55463173 CAGCACATGAAACATTCTCCAGG - Intronic
1025040275 7:55637114-55637136 CAGCATGTGAAACATTCTCCAGG - Intergenic
1025782673 7:64615704-64615726 TAGTATATGAAACATATGTCTGG + Intergenic
1026115285 7:67490721-67490743 CTGTACAGGAAACATGATTCTGG - Intergenic
1027349799 7:77299582-77299604 CAGCACATGAAACATTCTTCAGG - Intronic
1027578025 7:79955384-79955406 CAATCTAGGAAATATGCTTCTGG + Intergenic
1027628495 7:80573941-80573963 CAGCACATGGAACATTCTTCGGG - Intronic
1028728757 7:94120680-94120702 CTTTATAAGAAGCATGCTTCAGG + Intergenic
1030533669 7:110739771-110739793 CAGCAAATGAAACATTCTCCAGG + Intronic
1031231355 7:119111549-119111571 CAGTATATGAATCATTCTCAAGG - Intergenic
1034787174 7:153936268-153936290 CAGTATATGAAATGTTCTCCAGG + Intronic
1035395211 7:158530473-158530495 CAGTGCATGAAACCTGCTCCAGG - Intronic
1035539650 8:422940-422962 CTGTATATGAATTATGCCTCAGG + Intronic
1036061332 8:5324710-5324732 CAGTGTATGAAAAATGTTACAGG - Intergenic
1036148781 8:6279168-6279190 CATTACATGCAAAATGCTTCAGG - Intergenic
1037128878 8:15383982-15384004 CAGTTTATGAAATTTCCTTCAGG - Intergenic
1037140869 8:15519308-15519330 GATTATATGAAATATACTTCTGG - Intronic
1037369945 8:18165810-18165832 CAGCACATGAAACATACTTCAGG + Intergenic
1037535453 8:19818771-19818793 GAGTAAAGGAAACATGCTGCAGG - Intronic
1039152464 8:34522016-34522038 CAGGATAGGAAACATGCTCCAGG - Intergenic
1040100854 8:43502460-43502482 AAATATAGGAAAAATGCTTCAGG - Intergenic
1041689677 8:60677049-60677071 AAGTATATGAAAGGTGCTTTAGG - Intergenic
1042437728 8:68786842-68786864 CAGGATATGATACATGATCCTGG + Intronic
1042502477 8:69524321-69524343 CAGTACAGGAAACATGGTGCTGG + Intronic
1042607600 8:70561811-70561833 AAGTACACGAAACATTCTTCAGG + Intergenic
1043167967 8:76927923-76927945 CAGTAAATTGAACATGCTTAAGG + Intergenic
1043198186 8:77327695-77327717 TAGGACATGAAACATTCTTCAGG - Intergenic
1046992848 8:120479548-120479570 GCACATATGAAACATGCTTCAGG + Intronic
1047673630 8:127175564-127175586 CTGTATATGAAACATTTTCCTGG - Intergenic
1048130500 8:131691951-131691973 CAGTTTATGAAAAATTATTCTGG - Intergenic
1050346152 9:4690099-4690121 CATTTTATAAAACCTGCTTCTGG + Intronic
1050891897 9:10835209-10835231 CAGGGTCTGAAACATGGTTCAGG - Intergenic
1052113823 9:24624274-24624296 TAGTATTAGAAACATGATTCTGG - Intergenic
1052723310 9:32199121-32199143 CAGCACATGAAACATTCTCCAGG - Intergenic
1053181394 9:35974012-35974034 CAGTATATGCAACATTCTCCAGG - Intergenic
1055252360 9:74323114-74323136 CAGTATACCAAAGCTGCTTCAGG - Intergenic
1056046476 9:82722794-82722816 CAGGCTATGAAACAAGATTCTGG + Intergenic
1056466001 9:86855431-86855453 CAGTATATTAAATATGTTTAGGG + Intergenic
1057150093 9:92788874-92788896 CATTACATGAAACATGCTTATGG - Intergenic
1058237929 9:102516631-102516653 GAATATATGAAACATACTTCTGG + Intergenic
1058373669 9:104298788-104298810 CAGCAGATGAAACCTGCTGCAGG + Intergenic
1058630509 9:106981841-106981863 CATTATATGAAAAATGATACCGG + Intronic
1058652051 9:107184753-107184775 CAGCATATGAAACATTCTTTAGG + Intergenic
1060346728 9:122823285-122823307 CAGTAGATGGAGCAAGCTTCAGG - Intronic
1203417072 Un_KI270333v1:367-389 CAGTATATAATACATACTTTGGG - Intergenic
1203417074 Un_KI270333v1:409-431 CAGTATATAATACATACTTTGGG - Intergenic
1203417080 Un_KI270333v1:576-598 CAGTATATAATACATACTTTGGG - Intergenic
1203417089 Un_KI270333v1:896-918 CAGTATATAATACATACTTTGGG - Intergenic
1203417093 Un_KI270333v1:980-1002 CAGTATATAATACATACTTTGGG - Intergenic
1203417097 Un_KI270333v1:1182-1204 CAGTATATAATACATACTTTGGG - Intergenic
1203417104 Un_KI270333v1:1349-1371 CAGTATATAATACATACTTAGGG - Intergenic
1203417110 Un_KI270333v1:1475-1497 CAGTATATAATACATACTTTGGG - Intergenic
1203417116 Un_KI270333v1:1559-1581 CAGTATATAATACATACTTTGGG - Intergenic
1203417120 Un_KI270333v1:1643-1665 CAGTATATAATACATACTTTGGG - Intergenic
1203417124 Un_KI270333v1:1727-1749 CAGTATATAATACATACTTTGGG - Intergenic
1203417148 Un_KI270333v1:2432-2454 CAGTATATAATACATACTTTGGG - Intergenic
1203417150 Un_KI270333v1:2474-2496 CAGTATATAATACATACTTTGGG - Intergenic
1203417405 Un_KI270336v1:144-166 CAGTATATAATACATACTTTGGG - Intergenic
1203417409 Un_KI270336v1:228-250 CAGTATATAATACATACTTTGGG - Intergenic
1203417413 Un_KI270336v1:312-334 CAGTATATAATACATACTTTGGG - Intergenic
1203417436 Un_KI270336v1:850-872 CAGTATATAATACATACTTTGGG - Intergenic
1203417438 Un_KI270336v1:892-914 CAGTATATAATACATACTTTGGG - Intergenic
1203417440 Un_KI270336v1:934-956 CAGTATATAATACATACTTTGGG - Intergenic
1203417448 Un_KI270337v1:84-106 CAGTATATAATACATACTTTGGG - Intergenic
1203417456 Un_KI270337v1:252-274 CAGTATATAATACATACTTTGGG - Intergenic
1203417466 Un_KI270337v1:538-560 CGGTATATAATACATGCTTTGGG - Intergenic
1203417469 Un_KI270337v1:580-602 CAGTATATAATACATACTTTGGG - Intergenic
1203417474 Un_KI270337v1:748-770 CAGTATATAATACATACTTTGGG - Intergenic
1203417476 Un_KI270337v1:790-812 CAGTATATAATACATACTTTGGG - Intergenic
1203417485 Un_KI270337v1:958-980 CAGTATATAATACATACTTAGGG - Intergenic
1203417490 Un_KI270337v1:1042-1064 CAGTATATAATACATACTTTGGG - Intergenic
1203417492 Un_KI270337v1:1084-1106 CAGTATATAATACATACTTTGGG - Intergenic
1203377921 Un_KI270466v1:544-566 CAGTATATAATACATACTTTGGG + Intergenic
1203378121 Un_KI270467v1:1653-1675 CAGTATATAATACATACTTTGGG + Intergenic
1203378140 Un_KI270467v1:2070-2092 CAGTATATAATACATACTTTGGG + Intergenic
1188599241 X:31941116-31941138 CAGTTGCTGAAACAGGCTTCGGG + Intronic
1188988870 X:36792562-36792584 CAGTACATGAATCTTGTTTCAGG + Intergenic
1189626767 X:42905884-42905906 CAGTATATGAAACATTTTTGAGG + Intergenic
1189888471 X:45574658-45574680 CAGCATATGGAACATTCTCCAGG - Intergenic
1191814948 X:65233307-65233329 CAGTATATGAAACATTCTCAAGG + Intergenic
1192324008 X:70117032-70117054 CAGTACAGGAAACATGATGCTGG + Intergenic
1192677260 X:73210956-73210978 CAGAATAGTAAAGATGCTTCTGG - Intergenic
1193211657 X:78813100-78813122 CAGTACATGGAACATTCTTCAGG + Intergenic
1193451895 X:81680976-81680998 AAGTAAATGAAAACTGCTTCTGG - Intergenic
1193622245 X:83769671-83769693 CAGCACATGAAACATTCTCCAGG - Intergenic
1194176740 X:90659606-90659628 CAGCATATGGAACATGTTTCTGG - Intergenic
1197627906 X:128823725-128823747 GGGGATATGAAAGATGCTTCCGG + Intergenic
1199143871 X:144341984-144342006 CAGCACATGAAACATTCTCCAGG + Intergenic
1200841249 Y:7783726-7783748 CAGCAGATGAAACATGCCCCTGG - Intergenic
1201017668 Y:9622636-9622658 CAGTATTTGAAACATGTTTCAGG - Intergenic