ID: 1099355407

View in Genome Browser
Species Human (GRCh38)
Location 12:81628887-81628909
Sequence CTATAGGCCTTATGTGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099355407_1099355412 15 Left 1099355407 12:81628887-81628909 CCAATTGCACATAAGGCCTATAG 0: 1
1: 0
2: 0
3: 0
4: 54
Right 1099355412 12:81628925-81628947 AGTGCTCAAATACTCAGGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 129
1099355407_1099355411 10 Left 1099355407 12:81628887-81628909 CCAATTGCACATAAGGCCTATAG 0: 1
1: 0
2: 0
3: 0
4: 54
Right 1099355411 12:81628920-81628942 TTTTCAGTGCTCAAATACTCAGG 0: 1
1: 0
2: 3
3: 11
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099355407 Original CRISPR CTATAGGCCTTATGTGCAAT TGG (reversed) Intronic
908146357 1:61248802-61248824 GCATAGGCGTTATGTGGAATTGG - Intronic
908380456 1:63593242-63593264 CTCTAGGCCTCCTGTGAAATGGG - Intronic
918376192 1:183911547-183911569 CTACAGGCCTTAAGTGAAAAAGG - Intronic
923634061 1:235677276-235677298 ATGTATGCCTTATGTACAATAGG - Intronic
1071117218 10:82235562-82235584 ATATAGGCCTTAAGAGCAGTGGG - Intronic
1072931165 10:99664126-99664148 ATATAGACCTTCTGTGCAACTGG - Intronic
1082302540 11:50526819-50526841 ATATTGGCTTTATTTGCAATTGG - Intergenic
1087387360 11:97488818-97488840 CTGTAGGCCTTATGTAGAACAGG - Intergenic
1096900195 12:54869481-54869503 CTTTAGCTCTCATGTGCAATAGG + Intergenic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1100349179 12:93762492-93762514 GTAAAGGCCTCATGGGCAATAGG + Intronic
1115426505 14:33266583-33266605 CTATATTCCTTATGTACACTTGG + Intronic
1118417843 14:65562770-65562792 CTAAAGGCTTTCTGTACAATTGG - Intronic
1138035164 16:53596880-53596902 CTATAAGCGTTATGTGTAAGTGG - Intergenic
1139112624 16:63909636-63909658 CTATAATCCTTATATGAAATTGG - Intergenic
1140016638 16:71193154-71193176 CTATAGGGATCATGTGTAATTGG + Intronic
1141477666 16:84284444-84284466 CTAAAGGCCGATTGTGCAATGGG + Intergenic
1149349047 17:55768883-55768905 CTAAAGGCTTTATGTGCCTTTGG - Intronic
1153909809 18:9696864-9696886 TTTTAGGCATGATGTGCAATGGG + Intergenic
1158654406 18:59316770-59316792 ATAGATGCCTTATCTGCAATCGG + Intronic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
945779891 2:214156207-214156229 TGATAGGTCTTATGTGCAAGAGG + Intronic
946718558 2:222579221-222579243 CTTTAGGCCTTATGTGCCTGTGG - Intronic
1169716754 20:8628130-8628152 CTCTAGGCCATTTGTGGAATGGG + Intronic
1171021013 20:21584034-21584056 CTATAAGCCGTCCGTGCAATCGG - Intergenic
1173454508 20:43191548-43191570 CTATAGCCCTTAGGGACAATTGG + Intergenic
955108270 3:55921770-55921792 TTCTAGGAATTATGTGCAATTGG + Intronic
959162355 3:102737581-102737603 CTGGAGGCCTTATGTGGAACTGG + Intergenic
964030548 3:152133985-152134007 ATAGAGGCTTTATTTGCAATAGG + Intergenic
965564696 3:170102383-170102405 CTCTAGCCCTTTTGTGCAAAAGG + Intronic
965655763 3:170982809-170982831 TTATAGTTATTATGTGCAATAGG + Intergenic
978023089 4:103838070-103838092 ATGTAGGCCATATGTACAATAGG + Intergenic
980279321 4:130699209-130699231 CTTTAGGCCTTATTTGCATAAGG - Intergenic
981551532 4:145946557-145946579 CTATAGCCCTCAAGTGCAAGTGG - Intergenic
986921654 5:12691213-12691235 AAAAAGGCCTGATGTGCAATGGG + Intergenic
988340248 5:29961053-29961075 ATCTAGGCCTTATCTGCATTGGG - Intergenic
990225766 5:53651063-53651085 CAATAGACCTTGTCTGCAATTGG + Intronic
992727974 5:79628778-79628800 ATATAGGGCTTATGAGAAATAGG + Intronic
993334650 5:86643241-86643263 CTAAAGTGCTTATGTGCCATAGG + Intergenic
994009677 5:94886131-94886153 CTATAGGCTTTTTGTGGAAAGGG + Intronic
995315731 5:110770568-110770590 CTATGGTACATATGTGCAATAGG + Intergenic
996043045 5:118838070-118838092 TTATAAGACTTATGTGGAATAGG - Intronic
998321267 5:141234761-141234783 CTATAAACCTTATTTGCGATTGG + Intergenic
1000880226 5:166689040-166689062 CTATAGTCCTGCTGTGCATTAGG + Intergenic
1006510712 6:34519647-34519669 CTCTGGGCCTTCTGTGCACTGGG + Intronic
1008338086 6:50330919-50330941 AAATAGGTCTCATGTGCAATCGG - Intergenic
1009847500 6:69151828-69151850 CTATAGTCCCCATGTGCCATGGG + Intronic
1013097788 6:106961752-106961774 GTATAGCCCAGATGTGCAATAGG + Intergenic
1021496830 7:21284232-21284254 CTATAGGCCATCTCTGCGATAGG - Intergenic
1028485336 7:91351223-91351245 CTAAATGCTTTATGTGTAATAGG + Intergenic
1043449008 8:80348327-80348349 CAATAGACATTCTGTGCAATTGG - Intergenic
1046544093 8:115625438-115625460 CTATAGTCTTTCAGTGCAATTGG - Intronic
1048434814 8:134406342-134406364 CTAAAGGCCTAATGTACAACAGG - Intergenic
1201851172 Y:18482141-18482163 CTTTAGGACTACTGTGCAATAGG - Intergenic
1201882147 Y:18838237-18838259 CTTTAGGACTACTGTGCAATAGG + Intergenic