ID: 1099355411

View in Genome Browser
Species Human (GRCh38)
Location 12:81628920-81628942
Sequence TTTTCAGTGCTCAAATACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099355408_1099355411 -6 Left 1099355408 12:81628903-81628925 CCTATAGCCTCCTGTTGTTTTCA 0: 1
1: 0
2: 1
3: 14
4: 197
Right 1099355411 12:81628920-81628942 TTTTCAGTGCTCAAATACTCAGG 0: 1
1: 0
2: 3
3: 11
4: 188
1099355407_1099355411 10 Left 1099355407 12:81628887-81628909 CCAATTGCACATAAGGCCTATAG 0: 1
1: 0
2: 0
3: 0
4: 54
Right 1099355411 12:81628920-81628942 TTTTCAGTGCTCAAATACTCAGG 0: 1
1: 0
2: 3
3: 11
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099355411 Original CRISPR TTTTCAGTGCTCAAATACTC AGG Intronic
903171095 1:21554234-21554256 TTTTCAGCTCTTAAATACTTTGG - Intronic
905131894 1:35767496-35767518 ATGTCAGTGCTCAAATATTTTGG - Intronic
906243844 1:44259373-44259395 TTTTCTGTGCTCAGGGACTCTGG - Intronic
906336541 1:44936980-44937002 GTTTCAGTGCTCAAAAGCTGTGG - Intronic
906712611 1:47942314-47942336 TCTTAAGTGCTTAAATGCTCTGG - Intronic
909455950 1:75848779-75848801 TTTTCACTGATCAAATATTAAGG + Intronic
910813680 1:91265164-91265186 TTTTCTGTGCTTAAATATTTTGG + Intronic
913212622 1:116594232-116594254 GTTTCAGTGCGTAAATGCTCAGG - Intronic
914720590 1:150285558-150285580 TTTTCTGTCCTCAAATAATAGGG + Intronic
914954946 1:152153468-152153490 TTTTCAGTGCCCAGGAACTCAGG + Intergenic
915712394 1:157913146-157913168 TTTCTAGTGCTCGATTACTCTGG - Intergenic
916383466 1:164240057-164240079 ATTACAGTGGTCAAATACCCAGG - Intergenic
918135220 1:181667277-181667299 TTTTAAGTGGTAAAATAGTCAGG + Intronic
918392387 1:184079802-184079824 TTCTCTGTGCTCAGATACTGTGG + Intergenic
918870938 1:189973736-189973758 TTATCTGGGCTCAAATTCTCAGG - Intergenic
923523282 1:234752617-234752639 TCTTCAGTGTGCTAATACTCTGG + Intergenic
923821518 1:237448280-237448302 TTTTCAGTTTCCAAATATTCGGG + Intronic
924927329 1:248695913-248695935 TTCTCAGTGCTGCAATTCTCTGG - Intergenic
1063262646 10:4407501-4407523 TTTTTGGTACTCAGATACTCTGG - Intergenic
1064313153 10:14230036-14230058 TTTTCAGAGCTCAACTGCACAGG + Intronic
1070696580 10:78568402-78568424 TTTTCACAGCTCAGAAACTCCGG - Intergenic
1074570095 10:114616455-114616477 TTTTCAGTGCCCAGATCCTTTGG - Intronic
1075896549 10:126001317-126001339 TTTTCAGTGCTTAAGTAAACAGG + Intronic
1076464521 10:130669393-130669415 TTCTCAGTGCTCAATTCCCCAGG - Intergenic
1080102846 11:28479469-28479491 TTCTCAGGGCCCAAATACTAGGG - Intergenic
1080927260 11:36770086-36770108 TTTTCAGAGCTCTAGTAGTCAGG - Intergenic
1081837011 11:46164277-46164299 TGTTAAGTGCTGAAAAACTCAGG + Intergenic
1082237665 11:49838963-49838985 TTTTCTGTGCTCCAACTCTCAGG - Intergenic
1084511730 11:69609741-69609763 TCTTCAGTGCACAGTTACTCCGG + Intergenic
1087136979 11:94730946-94730968 CTTTCAGTTCTAAAATTCTCTGG - Intronic
1088762035 11:112940318-112940340 TCTTGTGTGCTCAAATACTCAGG - Intergenic
1091002126 11:131918549-131918571 TTTTCCCAGCTCACATACTCAGG + Intronic
1091461222 12:644667-644689 TTTTCAGGTCTCAAATACTTGGG - Intronic
1093185186 12:16012259-16012281 CTTTCAGTTTTCAAATACACAGG - Intronic
1093293464 12:17358396-17358418 TTTTAAGTGTTCAAATAAACGGG - Intergenic
1094800409 12:34026870-34026892 TTTTCAGTGGCCAAATAGTCAGG + Exonic
1095113199 12:38321168-38321190 TTTTCAGTGGCCAAATAGTCAGG + Exonic
1095543364 12:43337608-43337630 ATTTCAGTGCTCACAGACTTAGG + Intergenic
1096923145 12:55111433-55111455 TTTTCAGTGCTCTCCAACTCAGG + Intergenic
1097073926 12:56378096-56378118 CTTTCAGTTGTCAAATACTGTGG - Intergenic
1099355411 12:81628920-81628942 TTTTCAGTGCTCAAATACTCAGG + Intronic
1099540905 12:83906179-83906201 TTTTCTGAGTTCAAATATTCTGG - Intergenic
1100729614 12:97449857-97449879 TTAAGAGTGCTCAAATACCCAGG - Intergenic
1105585369 13:21738291-21738313 TTTTCAGTGTTCAAATTTTCAGG - Intergenic
1106294450 13:28397696-28397718 TTTTCTATGCTCAAATAATGTGG + Intronic
1106651436 13:31694541-31694563 TTTTAAGCTCTCAGATACTCTGG + Intergenic
1111048608 13:82848177-82848199 TTTTCAGGGCTTAAATACAATGG - Intergenic
1111054678 13:82933203-82933225 TTTTCTGTTCTCACAGACTCAGG - Intergenic
1113175849 13:107563130-107563152 TTTTCACTGCTCAAATAGCAAGG - Intronic
1114728710 14:24967323-24967345 TCTTCAGTGCTCATACAGTCAGG - Intronic
1115045789 14:28991551-28991573 TTTTCTGTGTTAAAATACTTTGG - Intergenic
1117332859 14:54730776-54730798 ATGTCACTGATCAAATACTCTGG + Intronic
1117542367 14:56760869-56760891 TTTTCAGAGCTGACATACACAGG + Intergenic
1117615910 14:57533495-57533517 TTTACAGCGCTCAAAGTCTCAGG + Intergenic
1118678098 14:68210382-68210404 ATTGCAGTATTCAAATACTCTGG + Intronic
1120015132 14:79464491-79464513 TTCTCAGTGCTCCAATACAAAGG - Intronic
1120372947 14:83661517-83661539 TTTTCAGAACTGAAATAATCAGG - Intergenic
1122064099 14:99159700-99159722 TTTGCACTGCTCAGAGACTCTGG - Intergenic
1123775847 15:23578986-23579008 TTTTCAATTCTAAAATATTCTGG - Intronic
1124431852 15:29615016-29615038 ATTTCTGTGCTCCAATTCTCAGG + Intergenic
1125068745 15:35526015-35526037 TTTTCAGTGGTCATATATCCTGG - Intronic
1130174055 15:81549002-81549024 TTTTCTGTGCTCACAGAGTCTGG + Intergenic
1130579184 15:85119507-85119529 TTTTAAGTGCGCAAATAGTATGG - Intronic
1131021924 15:89106313-89106335 ATCACGGTGCTCAAATACTCTGG - Intronic
1131026289 15:89144732-89144754 TTTGCAGTGATGAAATATTCTGG + Intronic
1131997861 15:98149017-98149039 TTTACAGTTATCAAATACTGAGG - Intergenic
1136548285 16:30967452-30967474 TGTTTAGAGCTCAAACACTCAGG - Intronic
1137625267 16:49903667-49903689 TTATCAGTGCTCAAATAAATTGG - Intergenic
1138885138 16:61067779-61067801 TATTCAGTGTTCATATACTGAGG + Intergenic
1140016377 16:71190637-71190659 TCTTCAGTGCTAAAATAATTAGG + Intronic
1140297520 16:73723886-73723908 TCTTCAATGCTTAAATAATCAGG - Intergenic
1146958358 17:36950448-36950470 TTTTCAGGGTTAAAATCCTCCGG + Intronic
1153894484 18:9545966-9545988 TTTTCAGAACTGAAATACTGGGG + Intergenic
1155178183 18:23319733-23319755 TTTACAGTGCTGAAATAGGCAGG - Intronic
1157068706 18:44381282-44381304 ATTTCAGTGCTCAATCACTGTGG - Intergenic
1159669206 18:71201965-71201987 CTTTCAGTGCTGAAATTCTTGGG - Intergenic
1162347327 19:10127049-10127071 TTTTCAGTGGTCACATTTTCAGG - Intergenic
1163709501 19:18838005-18838027 TTTGAAGTGGTAAAATACTCAGG + Intronic
1165412698 19:35671802-35671824 TATGCAGGGCTCAAATACTGCGG - Intronic
1166189850 19:41169133-41169155 CTCTCAGTGCTGAAATCCTCTGG + Intergenic
927772244 2:25873538-25873560 TTGTCACTGCTAAAATCCTCAGG - Intronic
929066813 2:37984833-37984855 TTTTTTTTTCTCAAATACTCAGG - Intronic
929207102 2:39309425-39309447 TTTTCAGTGCTAACATTCTAAGG + Intronic
930596175 2:53390758-53390780 TTTTCAGTTCTAAAATTTTCAGG - Intergenic
931968214 2:67556998-67557020 TTTTCTGTAGTCAAATACTGAGG - Intergenic
934115114 2:88781933-88781955 TTTTCACTTCTAAAATAGTCTGG - Intergenic
934631539 2:95930103-95930125 TTTTCACTTCTAAAATAGTCTGG + Intronic
934802496 2:97178880-97178902 TTTTCACTTCTAAAATAGTCTGG - Intronic
934833700 2:97561696-97561718 TTTTCACTTCTAAAATAGTCTGG + Intronic
935176677 2:100654958-100654980 TTTTTAGTGCTCACATCTTCAGG + Intergenic
938168090 2:129050157-129050179 TTATCAGAGCTCAAATGCTGTGG + Intergenic
938241991 2:129749454-129749476 ATTTCAGAGCTCAAAGACTGGGG + Intergenic
939309419 2:140455206-140455228 TTTTTATTACACAAATACTCAGG + Intronic
940142533 2:150508985-150509007 TGTGCAGTGTTCAACTACTCAGG + Intronic
942327674 2:174789243-174789265 TCTTCAGTGCCCCATTACTCAGG - Intergenic
943738987 2:191390528-191390550 TTTTAAGTGGTCAAATAATACGG + Intronic
944970528 2:204987693-204987715 TTTTCAGTGTTCCAAGACTAAGG + Intronic
945349206 2:208757678-208757700 TTGCTAGTGTTCAAATACTCTGG - Intronic
947848404 2:233264188-233264210 TTTTCAGTGCATACACACTCTGG + Intronic
948193145 2:236075576-236075598 TTTCCAGTGCTGAAAGACCCTGG - Intronic
1169878111 20:10319640-10319662 TTTTCAATCCTCAGCTACTCTGG + Intergenic
1174883590 20:54307309-54307331 TTTTCTGAGCTCCAAAACTCCGG + Intergenic
1178368080 21:32004314-32004336 TGTTCAGTGCTCACCTCCTCTGG + Intronic
1179791957 21:43760909-43760931 TTCTCAGTGCACAAAGACACTGG + Exonic
1181867507 22:25870424-25870446 TTTTCTATGTTTAAATACTCAGG - Intronic
1183768254 22:39899444-39899466 TTTTAAATGCTGAAATCCTCTGG - Intergenic
1185157657 22:49204014-49204036 TTTTCCATTCGCAAATACTCTGG - Intergenic
949328193 3:2890911-2890933 TTTTCAGTGGTAAAATGCTATGG + Intronic
951275812 3:20684557-20684579 GTATTAGTGCTCAAGTACTCTGG - Intergenic
955983856 3:64553152-64553174 TTTGCAGTGATGAAATATTCTGG - Intronic
956690317 3:71872080-71872102 TTTTCAGTGCTCAAACATTCAGG + Intergenic
958871875 3:99569091-99569113 TTTTCTGAGATAAAATACTCTGG - Intergenic
960967580 3:123115924-123115946 TTATCAGTGCTGAAGTATTCTGG + Intronic
961502449 3:127346468-127346490 TTTCCAGGCCTCAGATACTCAGG + Intergenic
963163536 3:142177375-142177397 TGTTCAGTGCTCAAATTTTAAGG + Intronic
964288450 3:155147643-155147665 TTTTCAGTTCTCAAATATCAGGG - Intronic
965752145 3:171986652-171986674 TTTTCATTGATAAAATACTAAGG + Intergenic
966639622 3:182175233-182175255 TCTTCAGTTCTCTACTACTCAGG + Intergenic
968885362 4:3327547-3327569 GTTTGAGTGCTCATATATTCTGG - Intronic
970039092 4:11775874-11775896 TTTTCAGTTCTGAAATACTAAGG + Intergenic
970069528 4:12141695-12141717 TTTTCAAAGCTCACATACTCAGG - Intergenic
970746389 4:19301774-19301796 TTTTCAGTGCTCATTTACTCTGG - Intergenic
971404409 4:26308660-26308682 TTGTCAGTGCTTAAATAAACAGG + Intronic
971920639 4:32934655-32934677 TTTTCAGTGCTCAATCATACTGG - Intergenic
974710696 4:65590210-65590232 TTTACAGTGCTCAAATGAGCAGG + Intronic
976024911 4:80675524-80675546 TTCTCAGAGCTCAAATGCTGTGG + Intronic
976268634 4:83208341-83208363 TTTTCAGTCCACATTTACTCAGG + Intergenic
976479596 4:85524818-85524840 CTTTCAGTGTGCAAATTCTCAGG + Intronic
977454693 4:97243672-97243694 TTTTCATAGCTCAAAACCTCAGG - Intronic
977855384 4:101884596-101884618 TTTTCAGTGCTCTCTAACTCAGG + Intronic
978148559 4:105407483-105407505 TTTCCAGTGGGGAAATACTCAGG - Intronic
978635728 4:110803189-110803211 TCTTAAGTGCTGAAATAGTCTGG - Intergenic
981855581 4:149287009-149287031 TTTTCAGTTCTAAAATTCTCTGG - Intergenic
983508824 4:168586085-168586107 CTTAAAGTGCTCAAACACTCTGG - Intronic
983995608 4:174177643-174177665 TAGTTAGGGCTCAAATACTCAGG - Intergenic
984161591 4:176259204-176259226 TCTTTAGAGCTCAAATACACAGG - Intronic
984195038 4:176649168-176649190 TTTTTAGTGCCTAAGTACTCAGG + Intergenic
984620121 4:181943192-181943214 TCTTCTATGCTCAAATACACAGG - Intergenic
990099497 5:52163847-52163869 TTTTCATTACTTAATTACTCTGG + Intergenic
990336345 5:54776399-54776421 CTTTCAGTGCTCAGCTCCTCCGG - Intergenic
993302692 5:86231504-86231526 ATTTCAGTGCCCAAACATTCTGG - Intergenic
994643255 5:102436407-102436429 TTCACAATGCTCAATTACTCTGG + Intronic
995849940 5:116534446-116534468 TTTTGAGTCCTCAAATATCCTGG + Intronic
996499014 5:124195667-124195689 TTTTCTGTGCTGAAATTATCAGG + Intergenic
999826814 5:155281503-155281525 TTTTCAGTTCTGAATTTCTCAGG - Intergenic
1004640630 6:17511863-17511885 TCTTCAGTTTTCATATACTCTGG - Intronic
1004931523 6:20467262-20467284 TATTCAGTGCTTGAATAATCTGG + Intronic
1006789386 6:36689272-36689294 TTTTAAGTGGTCAAATAAACTGG - Intergenic
1008221961 6:48864989-48865011 TTTTCAATACTAAATTACTCTGG + Intergenic
1010103553 6:72140687-72140709 TTTTCTGATCTCAAAAACTCTGG - Intronic
1010902575 6:81445209-81445231 GTTTGAGTATTCAAATACTCAGG - Intergenic
1014404679 6:121036544-121036566 ATATCACTGCTCAATTACTCTGG + Intergenic
1019076014 6:169388773-169388795 TTTTCAGTGCTCTGACCCTCAGG - Intergenic
1020321359 7:6940920-6940942 TTTTCAGTGTTCCAAAACCCAGG - Intergenic
1020666171 7:11046892-11046914 TTTTCAGTCATCAAGAACTCAGG - Intronic
1021455760 7:20828235-20828257 TTTTCAGTGCTCAGGAACTCTGG + Intergenic
1023456908 7:40349541-40349563 TTGTCAGTGCACAAATTCTGGGG + Intronic
1023737281 7:43246496-43246518 TTTTCAGTGTGCAACTACACAGG - Intronic
1027502806 7:78975384-78975406 TGTTCAGTGCCCAAATACTAGGG - Intronic
1027933507 7:84570992-84571014 TTTTCAGACTTCTAATACTCAGG - Intergenic
1027988482 7:85326453-85326475 TTTTCAATGGTCAACTCCTCTGG + Intergenic
1028270974 7:88788598-88788620 TTTCCAGTGAGCATATACTCTGG - Intronic
1028661068 7:93275957-93275979 TTTTGAGTGCTCTGATAATCTGG + Intronic
1030181110 7:106710039-106710061 TTCTCAGAGCTCAAACACTATGG - Intergenic
1031685290 7:124726387-124726409 TCTTTATGGCTCAAATACTCAGG - Intergenic
1036000152 8:4593631-4593653 TTTTCAGAGCTTTAAGACTCCGG - Intronic
1037663858 8:20950854-20950876 TTTTGGATGCTCAAATACTAGGG + Intergenic
1041369632 8:57144978-57145000 TTTTCAGTACTGAAATAAGCAGG + Intergenic
1042458361 8:69031952-69031974 TTTTCAAAACACAAATACTCAGG - Intergenic
1044304997 8:90628758-90628780 TTGTTAGTGCTCAAAAACTTCGG - Intronic
1044407160 8:91841005-91841027 TTTAAAGTGCTGGAATACTCAGG - Intergenic
1044501271 8:92961198-92961220 TTTTCAGTGCTAAAATATTCTGG - Intronic
1044798169 8:95925205-95925227 ATATGAGTGCTCAAACACTCTGG + Intergenic
1044866414 8:96575258-96575280 ACTTCAGTGCTCAGATACACAGG + Intronic
1045458805 8:102409109-102409131 CATTCAGTGCTCAGATACTTTGG - Intronic
1046999440 8:120559134-120559156 TTTTCAGGGCTGAATTAATCTGG - Intronic
1048227644 8:132604238-132604260 TTTTCTCTGCTCAAATATACTGG - Intronic
1048318125 8:133377006-133377028 TTCCCAGTGCTCAGAGACTCAGG - Intergenic
1049073924 8:140378790-140378812 TTTTCAGTGCTCACATAGGAGGG - Intronic
1052095993 9:24384818-24384840 TTTTCAGTTTTTAAATACCCGGG + Intergenic
1056262053 9:84858632-84858654 TTTTCTGTGCTCACACACCCTGG + Intronic
1056721926 9:89079803-89079825 TTCTCAGAGCTCATATACTCAGG + Intronic
1056813639 9:89783529-89783551 ACTTCAGTGCTGAAAAACTCAGG + Intergenic
1057449649 9:95145727-95145749 TTCTCAGTTCTCACATAGTCAGG - Intronic
1057528590 9:95824251-95824273 TTTTCACTGCTCAAATATCGCGG + Intergenic
1058485658 9:105441165-105441187 CTTTCAGTGCCCAAATATTGGGG - Intergenic
1059904314 9:118964814-118964836 TTTTCTCTGCTTAAAAACTCAGG + Intergenic
1059905873 9:118985250-118985272 TTGTCAGTGCTGAAATCCTGAGG + Intergenic
1062185223 9:135214672-135214694 TTTTCAGGGCCCAAATGATCAGG - Intergenic
1203582484 Un_KI270746v1:23657-23679 TTTTCACTTCTAAAATAGTCTGG - Intergenic
1185986598 X:4841942-4841964 TATGCATTGCTCAAGTACTCAGG - Intergenic
1186220261 X:7342481-7342503 TATTTTGTCCTCAAATACTCAGG + Intronic
1186662130 X:11679357-11679379 TCTACAGTGCTGCAATACTCAGG - Intergenic
1188197981 X:27262755-27262777 TTTTCAGTCCTTAAATCCTTAGG - Intergenic
1188754953 X:33951072-33951094 TTTGCAGTCCTCATATATTCTGG - Intergenic
1188937973 X:36200763-36200785 TTTCCATTTCTCAAATAATCTGG + Intergenic
1188941375 X:36241700-36241722 TTCTCAGTGCTCTAAGACTGGGG - Intronic
1190821954 X:53981811-53981833 TTTTTAGTGCACAAATTTTCAGG + Intronic
1191957958 X:66666855-66666877 TTTTCAGGACCCAACTACTCTGG + Intergenic
1193525941 X:82589371-82589393 TTGTTAGTACTCAAATTCTCTGG - Intergenic
1193848656 X:86507581-86507603 TCTTCTGTGGTCAAATACTACGG + Intronic
1194494848 X:94601754-94601776 TTTTCTTTTCTTAAATACTCAGG - Intergenic
1196687785 X:118527038-118527060 TTTTCATTGCTCTAAAACCCAGG + Intronic