ID: 1099355412

View in Genome Browser
Species Human (GRCh38)
Location 12:81628925-81628947
Sequence AGTGCTCAAATACTCAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099355407_1099355412 15 Left 1099355407 12:81628887-81628909 CCAATTGCACATAAGGCCTATAG 0: 1
1: 0
2: 0
3: 0
4: 54
Right 1099355412 12:81628925-81628947 AGTGCTCAAATACTCAGGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 129
1099355408_1099355412 -1 Left 1099355408 12:81628903-81628925 CCTATAGCCTCCTGTTGTTTTCA 0: 1
1: 0
2: 1
3: 14
4: 197
Right 1099355412 12:81628925-81628947 AGTGCTCAAATACTCAGGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 129
1099355409_1099355412 -8 Left 1099355409 12:81628910-81628932 CCTCCTGTTGTTTTCAGTGCTCA 0: 1
1: 0
2: 0
3: 30
4: 232
Right 1099355412 12:81628925-81628947 AGTGCTCAAATACTCAGGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099355412 Original CRISPR AGTGCTCAAATACTCAGGAG TGG Intronic
901177688 1:7316741-7316763 TGTGCTGAGATCCTCAGGAGGGG + Intronic
905494646 1:38375296-38375318 AGTCTCCAAATTCTCAGGAGGGG - Intergenic
905498163 1:38412736-38412758 TATGTTCAAATACTTAGGAGTGG - Intergenic
907264190 1:53246053-53246075 AGTGCTCAGAAACTCAAGATAGG - Exonic
907857311 1:58316506-58316528 GGTGCTCAAATCCAGAGGAGAGG + Intronic
908985890 1:70020767-70020789 ATTCCTAAAATACTCAGGATCGG - Intronic
909821413 1:80067155-80067177 TGTGTTCGAATACTCAGTAGAGG + Intergenic
910411411 1:86949689-86949711 AGTGCTCAAATAGCCATGTGTGG + Intronic
910431457 1:87163494-87163516 AGTGCTCAAAGGCACAGCAGGGG + Intronic
911346529 1:96703180-96703202 TGTGCCCAAATACTTAGGGGTGG - Intergenic
912402955 1:109411133-109411155 AGGACTAAAATGCTCAGGAGTGG + Intronic
915278360 1:154805358-154805380 ATTGCTCAATTGCTCAGGGGAGG - Intronic
918075309 1:181166469-181166491 AGTGTTCAAAGACCCAGGCGCGG - Intergenic
920268834 1:204747488-204747510 AGGGGTCAAAGACTGAGGAGAGG - Intergenic
920607902 1:207407947-207407969 AGTTCTTAAATTCTCAAGAGAGG - Intergenic
922252103 1:223858742-223858764 GGAGCTTATATACTCAGGAGAGG + Intergenic
922685012 1:227632266-227632288 ATTGCTCTAATACTTGGGAGAGG + Intronic
924429881 1:243987948-243987970 AGGGCTCAACTACCCATGAGTGG + Intergenic
1064109855 10:12529268-12529290 AGGGAACAAATACTCAAGAGAGG + Intronic
1070820116 10:79349464-79349486 AGTGCTCAGGTACTGAGGACAGG + Intronic
1075291777 10:121237009-121237031 AAAGCTCTCATACTCAGGAGGGG + Intergenic
1076467829 10:130697205-130697227 AGTGCACAAATCATCAGCAGTGG - Intergenic
1077387704 11:2278947-2278969 AGTGACCATATACTCAGGACAGG + Intergenic
1078624785 11:12945170-12945192 AGTACTTAAATTCTCAGGAGTGG + Intergenic
1081009038 11:37784605-37784627 AGTGCTCAAAGAATCCAGAGAGG + Intergenic
1081992346 11:47344579-47344601 AGTCCTCAAATACTCTGGCTGGG + Intronic
1082226101 11:49709314-49709336 AGTTCTCAAATACCTAGGAGTGG - Intergenic
1082720012 11:56662827-56662849 AATGCTCAAATATTCATTAGGGG - Intergenic
1086622987 11:88910429-88910451 AGTTCTCAAATACCTAGGAGTGG + Intronic
1090611086 11:128471394-128471416 AGTGCTCAAGTACACATGTGTGG + Intronic
1095644715 12:44529965-44529987 AGTGTTCAAAGAGTCAGGAGTGG - Intronic
1097074311 12:56381400-56381422 AGAGCTCAGATACTCTGGTGGGG - Intergenic
1099355412 12:81628925-81628947 AGTGCTCAAATACTCAGGAGTGG + Intronic
1101877993 12:108608085-108608107 AGTGCTAAGATCCTCAGGTGGGG + Intergenic
1103890574 12:124235709-124235731 ACAGTTCAAATGCTCAGGAGGGG + Intronic
1104304352 12:127595930-127595952 AGTGTTCATCTACTGAGGAGTGG + Intergenic
1104575225 12:129960553-129960575 TGTGCTGAAATACTCATGTGTGG + Intergenic
1108764887 13:53615214-53615236 AGTGGGCAAATATTCAGGAAAGG + Intergenic
1108960359 13:56219760-56219782 AATGATCAAATATCCAGGAGAGG - Intergenic
1109938771 13:69330827-69330849 AGTTTTAAAAGACTCAGGAGTGG - Intergenic
1112181749 13:97089684-97089706 TGTGGCTAAATACTCAGGAGTGG - Intergenic
1112924793 13:104660939-104660961 AGTGCTCAATTAATGAGGAAGGG - Intergenic
1112985498 13:105444499-105444521 ATTACTGAAATACTCAGCAGTGG - Intergenic
1114139505 14:19894502-19894524 ACAGCTGAAATGCTCAGGAGGGG + Intergenic
1114583522 14:23787674-23787696 AGTTATCTAATGCTCAGGAGAGG + Intergenic
1115392622 14:32870339-32870361 TGTGCATAAATACCCAGGAGTGG + Intergenic
1115529939 14:34317773-34317795 ACAGCTCAAATAGTCAGCAGTGG + Intronic
1117235771 14:53773056-53773078 TCTGCTGAAATATTCAGGAGTGG - Intergenic
1119982907 14:79102263-79102285 TGTTCTCAAATACTCAACAGAGG - Intronic
1122248637 14:100422649-100422671 ACGGAACAAATACTCAGGAGGGG - Intronic
1123689882 15:22829419-22829441 AGTGCAAAAATACTAAGGTGGGG - Exonic
1125207044 15:37165490-37165512 AATGCTAAAATACTAATGAGAGG + Intergenic
1126232040 15:46338605-46338627 AGTACTCCAGTACTCTGGAGTGG - Intergenic
1129321020 15:74775089-74775111 AGTGCTATAATACTAAGAAGTGG + Intergenic
1129604881 15:77019983-77020005 AGAACTCAGAGACTCAGGAGAGG + Intronic
1131407342 15:92176287-92176309 AGTTCTCAAATGGTCAGGACTGG - Intergenic
1131902467 15:97103516-97103538 TGTGCTCAAGCTCTCAGGAGAGG + Intergenic
1137377018 16:47960538-47960560 AGTGCCAAAATATTCAGCAGAGG - Intergenic
1138709935 16:58960218-58960240 AGTGCTGAATTCCTCAGGACAGG - Intergenic
1140440272 16:74982771-74982793 ACTGCTCAAATTCTCAGTAGAGG + Intronic
1143922215 17:10339037-10339059 AGTGCTCAAATACTCTGCTTAGG + Intronic
1148288094 17:46414394-46414416 AGTGCTCAAGTATTCTGGAATGG + Intergenic
1148310264 17:46631978-46632000 AGTGCTCAAGTATTCTGGAATGG + Intronic
1149142232 17:53445508-53445530 AAAGATCAAATAATCAGGAGAGG + Intergenic
1150246529 17:63679770-63679792 ATTGCTCAAAAACTCATGTGTGG - Intronic
1152313022 17:79562340-79562362 AAGGCTCAAGTACTCAAGAGAGG - Intergenic
1153193575 18:2569570-2569592 AGTGCCCACACACTCAGCAGTGG - Intronic
1156694052 18:39745454-39745476 AGTAGTCAAATATTCAGGATGGG - Intergenic
1161895462 19:7076231-7076253 AGAGCTCAGAACCTCAGGAGAGG + Intronic
1164019571 19:21287204-21287226 AGTGGTCATCTGCTCAGGAGTGG - Intronic
1166248578 19:41549256-41549278 TGTGCTCAACTACACAGGACAGG - Intergenic
1166907218 19:46119768-46119790 AGTGCTCAATTGCTCACCAGTGG + Intergenic
926933165 2:18060944-18060966 AGTGTTCAACTACTCAGGACAGG - Intronic
933240435 2:79914978-79915000 AGTCCTCAAATCCTCACAAGTGG - Intronic
940583422 2:155610801-155610823 TTTGCTCAAATACTCTGCAGAGG + Intergenic
944039652 2:195339040-195339062 CTTGCTCTAATACTTAGGAGAGG + Intergenic
944880999 2:204012870-204012892 GGTGATCAAATCCTCAGGTGAGG + Intergenic
947654999 2:231819427-231819449 AGTGCTCAAACACTGCAGAGTGG - Intergenic
1170896374 20:20418478-20418500 AGAGCTCATATACTGAGGAGCGG - Intronic
1171150776 20:22824787-22824809 AGTGCTCAAACAATGAGGATGGG + Intergenic
1171210802 20:23315509-23315531 TGTGCTCATGTTCTCAGGAGGGG - Intergenic
1173740012 20:45393636-45393658 AGTACTCTAATATGCAGGAGTGG - Intronic
1174612632 20:51810903-51810925 AGATCTCAAATACTCAACAGGGG - Intergenic
1179342322 21:40523901-40523923 ACTGCTCAAACTTTCAGGAGAGG - Intronic
954884287 3:53858258-53858280 AGTGCTCAAACACACCAGAGGGG + Intronic
956044046 3:65176273-65176295 AGTGCTCAGAAACTCAGCAGTGG - Intergenic
958844523 3:99249996-99250018 ACTTCTCAAAGATTCAGGAGGGG + Intergenic
960641078 3:119823775-119823797 AGTGATACCATACTCAGGAGTGG - Intronic
961379896 3:126490249-126490271 GCTGCTCAGATACCCAGGAGAGG + Intronic
961484095 3:127205421-127205443 AGTGCCAAACCACTCAGGAGTGG + Intergenic
961944887 3:130675559-130675581 AGTGCTGGAATTGTCAGGAGTGG - Exonic
966421584 3:179739466-179739488 AGTGCTCCATTCTTCAGGAGGGG + Intronic
966871544 3:184293127-184293149 AGTGCTCATTTACTCACTAGTGG + Intronic
969109986 4:4838553-4838575 AGAGCTCAAAGACTCAGGCCTGG + Intergenic
970663699 4:18313698-18313720 AGTACTCAAGTACTCAGTACAGG + Intergenic
971013884 4:22467605-22467627 AGTGCTCAGTTATTCATGAGAGG - Intronic
975923957 4:79426711-79426733 AGTACTGAAATACTAAAGAGGGG + Intergenic
976339495 4:83931282-83931304 ATTTCTCAAATACACATGAGGGG - Intergenic
978159652 4:105530319-105530341 AGTCATCAAGTAATCAGGAGGGG + Intergenic
983076658 4:163334559-163334581 AGTTCTGAAATACTCAACAGTGG + Intronic
983667287 4:170196059-170196081 CTTGCTCTAATACTTAGGAGAGG + Intergenic
983995607 4:174177638-174177660 AGGGCTCAAATACTCAGGACTGG - Intergenic
990661341 5:58019076-58019098 AGTTCTCAGATACTTAGGTGAGG + Intergenic
991916829 5:71613864-71613886 AGGGCTCATATATTCAGGAAGGG + Intronic
993621443 5:90172945-90172967 AGTTCTCAAATATTCAGGCTTGG + Intergenic
994644727 5:102453975-102453997 AGGGTTCACACACTCAGGAGAGG - Intronic
995060257 5:107805731-107805753 AGTGCTCAAATAGTAGGTAGTGG - Intergenic
1000710899 5:164576608-164576630 AATGCTCAAATATACAGAAGTGG - Intergenic
1003762778 6:9199100-9199122 AATGCTCAAAGACTTAGCAGTGG + Intergenic
1004549478 6:16632638-16632660 AGTGCTCCAAAAGCCAGGAGGGG + Intronic
1011545317 6:88476669-88476691 AATGCTCATATACCCATGAGGGG - Intergenic
1021566036 7:22017389-22017411 AATGCTCTAACACACAGGAGAGG - Intergenic
1021911123 7:25386710-25386732 CGTGCTCCATTACCCAGGAGAGG + Intergenic
1024411798 7:49051570-49051592 AGTGCTACAATACACATGAGTGG - Intergenic
1026255467 7:68707509-68707531 AGTGCTTAAAAACACGGGAGAGG + Intergenic
1029484467 7:100831017-100831039 AGTGCTCTAATAATGAGGAAGGG - Intronic
1030756159 7:113290467-113290489 ATTGCTAAAATACTCAAGGGAGG + Intergenic
1034248917 7:149672591-149672613 CCTGCTCTAATACTCGGGAGAGG - Intergenic
1038367614 8:26952701-26952723 AGTGCTAAAATACCCAGCACAGG - Intergenic
1039090680 8:33826102-33826124 AGTGCTCAGAGACTCTGGTGTGG + Intergenic
1041785577 8:61629105-61629127 AATGCTGGAATACTCAGCAGTGG + Intronic
1055084547 9:72300754-72300776 AGTACACACATACTCAGGAATGG - Intergenic
1055605520 9:77966678-77966700 AATGCTAAGATACTCATGAGGGG + Intronic
1056064950 9:82924319-82924341 TGTGCTTAATTACTCAGGAAAGG - Intergenic
1056813642 9:89783534-89783556 AGTGCTGAAAAACTCAGGGTGGG + Intergenic
1056972542 9:91219120-91219142 AGTGCTCACGTTCTCAGGCGGGG + Intronic
1058983061 9:110187991-110188013 TGTGCTCACAAACTCAGGAGAGG - Intergenic
1059083177 9:111271768-111271790 AATGCTCAGATACTGAAGAGGGG - Intergenic
1059475281 9:114541592-114541614 AATGCTGAATTAGTCAGGAGAGG - Intergenic
1060259183 9:122058787-122058809 ATTGCTTAAATACTTAGTAGAGG - Intronic
1186583585 X:10847566-10847588 AAGGCACAAATACTAAGGAGAGG + Intergenic
1186595781 X:10980094-10980116 AGTGATCACATACTCAGGCAAGG + Intergenic
1191737075 X:64398290-64398312 AGTGATCAAATACTGCTGAGAGG - Intergenic
1191782795 X:64886495-64886517 AGGGGTCAAAAACTGAGGAGAGG - Intergenic
1193172236 X:78349475-78349497 ACTGCTCTAATACTTGGGAGAGG + Intergenic
1194302323 X:92203659-92203681 ATTACTCTAAAACTCAGGAGAGG + Intronic
1195612356 X:106882311-106882333 AGTGCTAAAATAATCTGTAGTGG + Intronic
1195811594 X:108838692-108838714 ACAGGACAAATACTCAGGAGTGG - Intergenic
1197015978 X:121626807-121626829 AGTCCTTAAATACTCACCAGTGG + Intergenic
1201724207 Y:17135818-17135840 AATGCTCTAATACTTGGGAGAGG + Intergenic