ID: 1099359290

View in Genome Browser
Species Human (GRCh38)
Location 12:81679560-81679582
Sequence ATGTAGAAGATGAATGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 1, 2: 2, 3: 68, 4: 651}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099359290 Original CRISPR ATGTAGAAGATGAATGAAAA GGG Intronic
903409532 1:23129782-23129804 ATGCAGAAAATGAATGAACTGGG - Intronic
905317318 1:37091586-37091608 ATGTAGGAGGTGAAGGAGAAAGG - Intergenic
906470685 1:46127949-46127971 ATGTAAAAGTTGAATCCAAATGG - Intronic
907766518 1:57417780-57417802 ATGTAGAACATGCATCAAAATGG - Intronic
907942633 1:59104301-59104323 TTGGAGAAAATGAAGGAAAAAGG + Intergenic
908316241 1:62935540-62935562 ATATAGAGGATGCATGAATATGG - Intergenic
908926032 1:69256137-69256159 ATGAAGAACATGAGTAAAAAAGG + Intergenic
909059968 1:70868668-70868690 TTCTAGAACAAGAATGAAAATGG + Intronic
909166687 1:72235129-72235151 ATGTTGAATATGAAAGAACATGG + Intronic
909173607 1:72325501-72325523 ATTTTGAAAATAAATGAAAATGG + Intergenic
909182157 1:72438469-72438491 ATCTAGAAAATGACTCAAAAAGG - Intergenic
909420436 1:75458644-75458666 ATGTAAAAAATGAAGGGAAAAGG + Intronic
909597183 1:77419499-77419521 ATGGAAAAGAAGAAAGAAAAAGG + Intronic
909816699 1:80003701-80003723 TTTTAGAAGATGAATGATAGAGG + Intergenic
910683115 1:89888166-89888188 CTGAAGAAAGTGAATGAAAAAGG + Intronic
911404775 1:97422915-97422937 ATGTAGAAGTGACATGAAAATGG + Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911660040 1:100490977-100490999 ATGTGGAAGATGACTTTAAAAGG + Intronic
911905715 1:103566085-103566107 ATGTAGAAGAGCAAGGAAAATGG - Intronic
911907112 1:103584150-103584172 ATGTGGAAGCTGATTGATAATGG - Intergenic
913001849 1:114588533-114588555 ATGTAGAAGATGAGATAACAGGG - Intronic
913419653 1:118651275-118651297 CTGAAGAATAGGAATGAAAATGG - Intergenic
913454335 1:119015615-119015637 ATGTAGAAATAGAAAGAAAATGG - Intergenic
913514399 1:119590868-119590890 ATGTGGCAGAAGAATGGAAAGGG + Intergenic
914463146 1:147903211-147903233 TTGTAGAATTTGAGTGAAAAGGG - Intergenic
915741675 1:158123437-158123459 AGGTAGAAGTTGAATTCAAAGGG - Intergenic
915813326 1:158939265-158939287 TTGAAGAAAATGAATCAAAAGGG - Intronic
916314155 1:163428827-163428849 ATATTTAGGATGAATGAAAAAGG + Intergenic
916319168 1:163483673-163483695 GTTTTGAAGATGGATGAAAAAGG - Intergenic
916771528 1:167913602-167913624 ATGTAGAAGATGGTTCCAAACGG - Intronic
917000322 1:170350815-170350837 AAGAAGAAGAGGAATTAAAAAGG + Intergenic
917002973 1:170380894-170380916 ATGTAAAAAAGAAATGAAAAAGG - Intergenic
917156131 1:172000949-172000971 ATGTAGAAGAGAAATTAAATTGG + Intronic
917338791 1:173953200-173953222 AAGTAGAAGAAAAATAAAAAAGG - Intronic
917409380 1:174742214-174742236 AAGAAGAAGAAGAAAGAAAAGGG + Intronic
917803147 1:178588629-178588651 ATGTAGAAGCTAAAAAAAAAAGG - Intergenic
918132380 1:181641104-181641126 CTGCACAAGATGAATGAGAAAGG - Intronic
918429655 1:184445817-184445839 ATGGTGAAGATTAATTAAAAGGG + Intronic
918961880 1:191289728-191289750 GGATAGAAGATGAATGAAAATGG + Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
920063258 1:203244020-203244042 AGGAAGAAGAAGAAAGAAAAAGG + Intronic
920086372 1:203420815-203420837 ATATAGAAGAGGATTGAAATGGG - Intergenic
920610833 1:207436080-207436102 ATGCAGAAGAAGATTGAAACTGG + Intergenic
921178084 1:212610150-212610172 AAGTAGATGAGAAATGAAAATGG - Intronic
921405205 1:214771566-214771588 ATGTAGAAGTTGCAGGAGAATGG - Intergenic
921742270 1:218699089-218699111 ATGTGGAAGATGAAATTAAATGG - Intergenic
922184802 1:223264819-223264841 CTGTGGAAGGTGAAAGAAAAAGG + Intronic
923432401 1:233935871-233935893 TAGCAGAGGATGAATGAAAAAGG - Intronic
923763941 1:236874662-236874684 GTGAGGAAGATGAAAGAAAAAGG - Intronic
1062928740 10:1338642-1338664 ATCTAAAACATGAATGGAAATGG + Intronic
1062984012 10:1749881-1749903 CTGTAGAAGATCAAAGGAAAGGG + Intergenic
1063055309 10:2497726-2497748 AAGTAGAAGATGATGGAAACAGG + Intergenic
1063762195 10:9092606-9092628 AAGTAAGATATGAATGAAAAAGG - Intergenic
1063802990 10:9602879-9602901 ACTTAGAAGATGTAGGAAAAAGG - Intergenic
1063874966 10:10465647-10465669 AAGTAGATTATGAATGACAAAGG - Intergenic
1064714276 10:18160442-18160464 AAACAGAAGATGAATAAAAATGG - Intronic
1064848727 10:19686159-19686181 CTTTAGAACAGGAATGAAAAAGG + Intronic
1065322580 10:24522976-24522998 ATGGAGATGATTATTGAAAATGG + Intronic
1065372371 10:25001259-25001281 ATATAGAAGAAGAAGAAAAAAGG - Intronic
1065662506 10:28020434-28020456 ATTTAGCAGATGTATAAAAATGG - Intergenic
1065706274 10:28474186-28474208 ATGCAGATGATGAGTGAACATGG + Intergenic
1065900850 10:30206664-30206686 AAGTAGAAGGTGAAAGAGAATGG + Intergenic
1066205951 10:33189398-33189420 ATGTAAAAGATGACGGAAGAGGG - Intronic
1068165016 10:53319086-53319108 ATGAAGAGGAAGAAGGAAAAAGG + Intergenic
1068301867 10:55153690-55153712 TTGTGGAAGACAAATGAAAAAGG - Intronic
1068677721 10:59785043-59785065 CTATAAAAGAGGAATGAAAATGG - Intergenic
1068721296 10:60249164-60249186 ATATAGCAGTTGAATGGAAAGGG + Intronic
1069304902 10:66956997-66957019 ATGTAGAAGATAATTCAAAAGGG + Intronic
1069578001 10:69544461-69544483 AGGAAGAAGAGGATTGAAAAGGG + Intergenic
1070222315 10:74460952-74460974 GTCTAGCAGATGAATGAATAGGG + Intronic
1070342938 10:75514295-75514317 AAGAAGAAGAAGAAGGAAAAAGG - Intronic
1071020568 10:81050084-81050106 ATTTAGAAGATGAATGAAAAGGG - Intergenic
1071402554 10:85289284-85289306 GTTTAGAAAATGAATGAAAATGG + Intergenic
1072729328 10:97834630-97834652 ATGTAGAGAAAGGATGAAAAAGG + Intergenic
1073539161 10:104304205-104304227 AAGAAGAAGATAAATGAAAATGG - Intronic
1074111999 10:110429332-110429354 GTGGTGAAGATGAAAGAAAAAGG - Intergenic
1074203171 10:111257822-111257844 ATGTAGATAATGAATCAAATTGG - Intergenic
1074388556 10:113037130-113037152 TTGTAGAAGATGAAGGAAGCTGG + Intronic
1075414122 10:122249895-122249917 ATGTTGAAAAGGAATGAAAATGG - Intronic
1076206449 10:128608317-128608339 ATCTACAAGAAGAATCAAAAGGG - Intergenic
1077666152 11:4111619-4111641 TTGTTGAAGATCAATGGAAAAGG + Exonic
1078328061 11:10396568-10396590 ATGTGGCAGATGAAGGAAAGAGG + Intronic
1079019128 11:16894643-16894665 ATGAAGAAGGTGAATGGTAAGGG + Intronic
1079679507 11:23276616-23276638 CTAAAGAAGAAGAATGAAAATGG + Intergenic
1079815120 11:25046848-25046870 ATGTAAAAGCAGAATAAAAATGG + Intronic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1079966432 11:26985760-26985782 ATTTTGGAGATGAATCAAAATGG - Intergenic
1079990342 11:27239990-27240012 AAGTAGAAGATGGATGGCAAGGG - Intergenic
1080480800 11:32647862-32647884 ATATTTAACATGAATGAAAATGG - Intronic
1081054140 11:38386982-38387004 ATGTAGAAGCTGAGACAAAAGGG - Intergenic
1082132729 11:48510367-48510389 TGGTAGAAAATGAAAGAAAAAGG - Intergenic
1082139220 11:48587884-48587906 TGGTAGAAAATGAAAGAAAAAGG - Intergenic
1082244098 11:49901129-49901151 TGGTAGAAAATGAAAGAAAAAGG + Intergenic
1082566166 11:54680917-54680939 TGGTAGAAAATGAAAGAAAAAGG - Intergenic
1082647280 11:55743279-55743301 ATGTAAAACATGAAGGAGAAAGG + Intergenic
1082775099 11:57238447-57238469 ATGTAGGAGGTGAGTGAAAAGGG + Intergenic
1082895144 11:58182184-58182206 AAGTACACGATGAATGGAAAGGG + Intergenic
1085840514 11:80006455-80006477 ATGTATTAGATAAATGGAAATGG + Intergenic
1085978043 11:81684201-81684223 GTGTGGAGGATGAATTAAAAGGG + Intergenic
1086004449 11:82021228-82021250 ATGTAGAAAATAACTGTAAAAGG + Intergenic
1086589722 11:88498956-88498978 ATATAGAAGATGAAAAAATATGG - Intergenic
1086659206 11:89393909-89393931 AGGTAGAAGACGACTGAGAAAGG - Intronic
1086752573 11:90516034-90516056 ATGTTGAAAATGTATGAGAAAGG - Intergenic
1086803900 11:91215298-91215320 ATTTTGAAGAAGAATGAAATGGG + Intergenic
1087250863 11:95898053-95898075 ATGTAGTATTTGAAAGAAAAAGG - Intronic
1087295965 11:96374254-96374276 ATATAGAAGATGTCTGACAAGGG + Intronic
1087479307 11:98679918-98679940 ATTTAGAATCTGGATGAAAAAGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088149967 11:106732917-106732939 TTGTAGCAGATGAATGAGACAGG - Intronic
1088203054 11:107361147-107361169 ATGCAGAAGAAGTATGAAACTGG - Intronic
1090661629 11:128886392-128886414 AAGGAGAAGAGGAATGAAACTGG - Intergenic
1091176790 11:133566096-133566118 AAGTAGAAAATGAATGACAGTGG + Intergenic
1091313467 11:134593588-134593610 ATGCACAATATGAATAAAAAAGG - Intergenic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1093224682 12:16467642-16467664 ATGTTGAAGGTGAATGATTATGG - Intronic
1093232039 12:16557196-16557218 ATGTAGAACATGGATAAAATAGG + Intronic
1093668152 12:21839095-21839117 ATGTACAGGATGAAAGAGAATGG + Intronic
1093818560 12:23582188-23582210 AGGTAGAAGACGAAAGAGAAAGG - Intronic
1093954848 12:25203944-25203966 ATTTACATGATAAATGAAAATGG + Exonic
1094131240 12:27078150-27078172 ATCAAGAATAGGAATGAAAAGGG - Intergenic
1094674898 12:32610224-32610246 ATTTGGCAGATGAATGAAATGGG - Intronic
1095638570 12:44459935-44459957 AGGAGGAAGATGAAAGAAAAGGG + Intergenic
1096860016 12:54519136-54519158 AAAAATAAGATGAATGAAAAAGG - Intronic
1097209938 12:57359745-57359767 ATCTAAAAGATGAGAGAAAAAGG - Intronic
1097397449 12:59092882-59092904 ATGTATAAGATTAATGCTAAAGG - Intergenic
1097533240 12:60832650-60832672 ATGCAGAAAATGAAAGAAAAGGG - Intergenic
1098017834 12:66125182-66125204 ATGTAGAAGATAAATGAGAAGGG + Intronic
1098188690 12:67925212-67925234 ATGTAGAAGATAAAAGGGAATGG + Intergenic
1098260027 12:68659534-68659556 ATGTTGTACATGTATGAAAATGG + Exonic
1098483431 12:70992879-70992901 ATTTAAAATATGCATGAAAATGG - Intergenic
1098588223 12:72181061-72181083 AGGTAGAAGAAGACTGAGAATGG + Intronic
1098777300 12:74636682-74636704 CTGCAGAATATGAAAGAAAAGGG - Intergenic
1099319952 12:81133562-81133584 ATGTAGAAGTTGAAAAAAAGTGG - Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099476579 12:83114821-83114843 ATATATAAAATGAATGAAGATGG - Intronic
1099681074 12:85828561-85828583 ATTTAGAAGATTAAGTAAAATGG - Intronic
1100532822 12:95476164-95476186 ATGAAGATGATGAAGGTAAATGG + Exonic
1101492601 12:105223172-105223194 GTGTGGAGGAAGAATGAAAAGGG + Intronic
1101804695 12:108053155-108053177 ATTTAGAAAATGAATCAAGATGG + Intergenic
1101821547 12:108188139-108188161 TTGGGGAAGATAAATGAAAATGG + Intronic
1102988772 12:117299720-117299742 CTGTAGAAGGTGATTAAAAATGG + Intronic
1104163024 12:126199044-126199066 ATGTGGAATTTTAATGAAAAGGG + Intergenic
1105708815 13:22985556-22985578 AATTAGAAGATTCATGAAAAGGG - Intergenic
1106765144 13:32906242-32906264 ATGTAGCAGATGATGGAGAAAGG - Intergenic
1106915822 13:34513188-34513210 AGGTAGAAGATTAATAAAAAGGG - Intergenic
1107183356 13:37487718-37487740 AAGTGGAAGATGAAGGAGAAAGG + Intergenic
1107317793 13:39152101-39152123 AAGCAGAAGATGAATCCAAATGG + Intergenic
1107668663 13:42719386-42719408 ATGTAGAACAGGAAGGGAAATGG + Intergenic
1108974844 13:56426769-56426791 ATGTATAAAATGTATAAAAATGG + Intergenic
1109019460 13:57068682-57068704 AAGAAGAAGGTGAATGGAAAGGG + Intergenic
1109167937 13:59058960-59058982 ATGTAGAATGGGAATGAAGACGG + Intergenic
1109593611 13:64520995-64521017 ATGTAGATCATGAAAAAAAATGG - Intergenic
1109595050 13:64540989-64541011 TTTTAGAAGATAAATAAAAATGG - Intergenic
1109684235 13:65792369-65792391 ATGTAAAAAATGACTCAAAATGG + Intergenic
1110187613 13:72693303-72693325 TTTCAGAAGATGTATGAAAAAGG + Intergenic
1111039778 13:82732069-82732091 TTGTAAAATATGAATGATAATGG - Intergenic
1111321919 13:86642747-86642769 AGGTAGAAGGTGGATAAAAAAGG - Intergenic
1111453977 13:88455167-88455189 AGGTAGAAAGTGATTGAAAAAGG + Intergenic
1111621096 13:90726966-90726988 GTGGAGAAGATGGAGGAAAATGG + Intergenic
1112017608 13:95344432-95344454 ATGTAGAGTATTAATGAAAGAGG + Intergenic
1112467070 13:99653842-99653864 ATGGATGAGTTGAATGAAAATGG - Intronic
1112827522 13:103408682-103408704 ATGGGGAAGATGCAGGAAAAAGG - Intergenic
1112842995 13:103602586-103602608 TTGTGGAAGGTGGATGAAAATGG + Intergenic
1114120480 14:19666188-19666210 AGGAAGAAGATGAAAGAAGAAGG + Intergenic
1114207431 14:20585950-20585972 ATGTAGGAGATCAATGTAGAAGG - Intronic
1114738970 14:25074501-25074523 CTGTAGAATATGAATGTATATGG + Intergenic
1114799933 14:25761979-25762001 ATTTAGAAGTTGATTGAATATGG - Intergenic
1115494600 14:33990609-33990631 TTGGAGAAGATGGAAGAAAATGG - Intronic
1115805137 14:37042584-37042606 CTGTAGAAGATAAATTACAAAGG + Intronic
1116042880 14:39707134-39707156 ATGTGGATGATGAAAGAAGATGG - Intergenic
1116115818 14:40649194-40649216 ATATAGAAAAAGAATGCAAAGGG + Intergenic
1116181079 14:41536648-41536670 ATGAAGCAGAAGAATGAAACTGG - Intergenic
1116381486 14:44274696-44274718 GTTTAGAAGATAAATAAAAACGG + Intergenic
1116594510 14:46822253-46822275 TTTTAGAAGATGGATGAAAGGGG - Intergenic
1116594939 14:46829122-46829144 AAATAGAAAATGAATAAAAAAGG + Intergenic
1116631709 14:47343620-47343642 ATTTAGATAATTAATGAAAATGG - Intronic
1116687854 14:48064833-48064855 ATGTATAGGAGTAATGAAAATGG - Intergenic
1116718326 14:48456974-48456996 AGTAATAAGATGAATGAAAATGG + Intergenic
1116758018 14:48972770-48972792 ATTTAGAGATTGAATGAAAATGG + Intergenic
1116959455 14:50955141-50955163 CTGAAGAAGATAAATAAAAATGG + Intergenic
1117662608 14:58022771-58022793 ATGTACAAAATGAATGAAATTGG - Intronic
1118567152 14:67153959-67153981 ATGTTCAAAAAGAATGAAAAGGG + Intronic
1118779817 14:69000130-69000152 TTGTAGAGCATGAATGAATATGG + Intergenic
1118783969 14:69030098-69030120 CTTTAGAAGATGAGAGAAAAAGG + Intergenic
1120026252 14:79587802-79587824 ATCTAGAATTTGAATGGAAACGG + Intronic
1120142939 14:80948678-80948700 ATGTAACAAATGAATGAGAATGG - Intronic
1120522554 14:85541524-85541546 AAGTAGAAAATGGAGGAAAATGG + Intronic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1121497681 14:94406799-94406821 ATGAAAAAGGTGAATGTAAATGG - Intergenic
1121810401 14:96882952-96882974 ATGTAGCTGATGAATCAAACTGG - Intronic
1121878621 14:97478741-97478763 ATGTAGAATAGGAAAGAAAAGGG + Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1122262960 14:100533656-100533678 ATGTGGAGCAGGAATGAAAAAGG + Intergenic
1122756811 14:103987376-103987398 ATTTGGAAGATGAATGAACAAGG - Intronic
1123895043 15:24820347-24820369 AGGTAGAAGGTAAATGAAATGGG + Intergenic
1124098284 15:26669763-26669785 TTGTAGAAGATGGAAGGAAAAGG - Intronic
1124395989 15:29302123-29302145 ATGAAGATGAAGAGTGAAAATGG - Intronic
1124470874 15:29984576-29984598 AAGTAGAAGATTAATAAATAAGG + Intergenic
1125970233 15:43905435-43905457 ATAAAAAAGATGAAAGAAAAAGG - Intronic
1127204043 15:56694141-56694163 AAGTATGAGATGAATGATAATGG + Intronic
1127894750 15:63287192-63287214 ATGCAGCAGAGTAATGAAAAAGG - Intronic
1128197701 15:65775070-65775092 ATGCAGTGGATGACTGAAAATGG - Intronic
1129007908 15:72389841-72389863 ATGAAGCAGATGCAGGAAAAGGG - Intergenic
1129090966 15:73150233-73150255 ATGTAAAACATGATTTAAAAAGG - Intronic
1130024691 15:80260977-80260999 ATGCAGACGATGTATGAGAAAGG - Intergenic
1131667689 15:94587750-94587772 ATGAAGGAGATGAAAGTAAATGG - Intergenic
1131978991 15:97977433-97977455 ATTTAGAAGATGTATGAAATAGG - Intergenic
1131997434 15:98145798-98145820 ATGAGGGAGATGAATAAAAAAGG + Intergenic
1132160351 15:99535756-99535778 ATGTTGAATGTGGATGAAAAAGG + Intergenic
1132284530 15:100652533-100652555 ATATCTAAGATGAAAGAAAATGG + Intergenic
1132734851 16:1380137-1380159 AAGTGTAAGATGAAGGAAAATGG + Intronic
1133196673 16:4175789-4175811 ACGTGGAGGATGAATTAAAAGGG - Intergenic
1133314015 16:4870897-4870919 AGGAAGAAGATGAAGAAAAAGGG + Exonic
1134001538 16:10786812-10786834 AAGTAGAAGAAGAAAGAAATCGG + Intronic
1134529289 16:14970417-14970439 ATGTAGAAGAAGAAATCAAAAGG + Intergenic
1135833767 16:25804287-25804309 ATGCAGAAGAAAAATGAAAAAGG - Intronic
1136287460 16:29252895-29252917 GGGGAGAAGATGAATGCAAAGGG + Intergenic
1136998966 16:35212350-35212372 ATGTATCAGATGGATGAAGATGG + Intergenic
1137819414 16:51429443-51429465 ATTTAGAAGATGAGAGAAGATGG + Intergenic
1138204130 16:55112347-55112369 AAGTAGAAGATGTAGGTAAAAGG + Intergenic
1139867069 16:70070565-70070587 ATGTAGAAGAAGAAATCAAAAGG - Intergenic
1140991514 16:80217304-80217326 AGGGAGAAGATGAGTGAACAAGG - Intergenic
1141200406 16:81893376-81893398 CTGCAGAAGATGAATTAACAAGG - Intronic
1141921982 16:87141930-87141952 ATATAGATGATGAACAAAAAAGG - Intronic
1143072714 17:4310730-4310752 ATGTAGAAGATTGTTTAAAAAGG + Intronic
1143304673 17:5936966-5936988 ATTTAAAAGATGAAAGAAAATGG + Intronic
1143700521 17:8656464-8656486 AGGTAGAAGGTGAATTATAAGGG - Intergenic
1144843036 17:18200257-18200279 CTGTAGATGAGGAATGAAAGAGG + Intronic
1146235185 17:31153437-31153459 AATTTGCAGATGAATGAAAAAGG - Intronic
1148956295 17:51356347-51356369 AATTAGAAGAGGAAAGAAAATGG - Intergenic
1149278468 17:55072619-55072641 AAGTAGAAGATAGTTGAAAATGG - Intronic
1150459474 17:65336118-65336140 ATATTGAACATGAATAAAAATGG + Intergenic
1150855051 17:68744740-68744762 ATGTATGAGATGAAAGAAAAGGG - Intergenic
1150873145 17:68937710-68937732 GTGTTGAAGATGAATGTAGAGGG + Intronic
1151129694 17:71883548-71883570 ATGTAGAAAATAAATTGAAAGGG + Intergenic
1152206642 17:78977817-78977839 ATGGGGAAGATAGATGAAAAGGG + Intronic
1153655819 18:7281221-7281243 ATGTAGAAGATGGAAAATAAAGG + Intergenic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1155165933 18:23232507-23232529 ATGGAGATGATGAATGCACAGGG - Intronic
1155378632 18:25191257-25191279 ATGGAGAAAATGAATGGAATAGG - Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156028440 18:32684705-32684727 GTGTAGATCATGAATGAAACCGG - Intronic
1156113254 18:33754137-33754159 ATGAAGAAGAAGAAAGAAACTGG - Intergenic
1156585598 18:38427632-38427654 AAAGGGAAGATGAATGAAAATGG + Intergenic
1156609418 18:38708791-38708813 GTGTAGAAAATAAAAGAAAAAGG - Intergenic
1156776920 18:40801762-40801784 ATGGAGAAGATGAATTCTAAGGG + Intergenic
1156829960 18:41480010-41480032 AGCCAGAAGATTAATGAAAATGG + Intergenic
1156934921 18:42691984-42692006 GTGTAGTAGAAGATTGAAAAAGG + Intergenic
1157215326 18:45778117-45778139 AAATTGAAGAGGAATGAAAATGG - Intergenic
1157732249 18:50014256-50014278 ATGGAGAAAATGGATGAGAAAGG + Intronic
1157826945 18:50820874-50820896 GAGTGGAAGATGAAAGAAAAAGG + Intronic
1157967574 18:52225423-52225445 ATGGAGGAGAGGAAGGAAAAAGG - Intergenic
1158123131 18:54072352-54072374 TTGTAGAATATGAATGGAACTGG - Intergenic
1158209056 18:55025798-55025820 GTGAAGAAGATGAAGGAGAAGGG - Intergenic
1158212527 18:55067253-55067275 ATATAGAAAATGTATGCAAAAGG - Intergenic
1158754044 18:60300698-60300720 AGGTAGAAGATGAATGATTGAGG + Intergenic
1159162939 18:64667862-64667884 ATTTAGAGGAAGAATGAAAATGG + Intergenic
1159289829 18:66402264-66402286 ATATAGGAGCGGAATGAAAATGG - Intergenic
1159495634 18:69199941-69199963 ATGTAGTAGAGGAAAAAAAAGGG - Intergenic
1159688564 18:71456465-71456487 ATTTAGGACATGAAAGAAAATGG - Intergenic
1159708393 18:71721587-71721609 ATTGATAAGATGAATGAAAAAGG - Intergenic
1159746314 18:72240237-72240259 TTGAAGAAGATGAATGAAGTTGG - Intergenic
1159772533 18:72563336-72563358 ATCTATAAGATGAGTGGAAATGG + Intronic
1159987346 18:74858649-74858671 AAGTGGAAGATGACTGAACAGGG - Intronic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160278610 18:77464449-77464471 ATATAGATGATAAATGGAAATGG + Intergenic
1160326495 18:77954277-77954299 ATGTAAAAAATGAATGAATCAGG + Intergenic
1162221959 19:9185041-9185063 ATGAAGAAGATGTAGGATAATGG + Intergenic
1164212677 19:23113860-23113882 ATTTAGAAGATGACCAAAAAAGG + Intronic
1165615270 19:37194125-37194147 ATGTTGATGATGACTGAAACTGG + Intronic
1165755843 19:38292409-38292431 ATGTACAAGTTTAATAAAAAGGG + Exonic
1166161214 19:40954823-40954845 AAGTGGAAGATGACAGAAAAAGG + Intergenic
1166869241 19:45861276-45861298 AAGCAGAAGAAGAATGAAACAGG - Intronic
1167986321 19:53320306-53320328 ATGCAGACGATGGTTGAAAATGG + Intergenic
925513419 2:4652893-4652915 ATTCAGAAGATGAATGAAATTGG - Intergenic
926451638 2:13011345-13011367 AGGTAGAAGAAAAATGAAATAGG - Intergenic
926630722 2:15133883-15133905 ATGTAGAGGATGAATTGGAAGGG + Intergenic
926865839 2:17357390-17357412 AAGTAGAAGAGAAATGAAATAGG - Intergenic
927361059 2:22234438-22234460 ATTTGGAAGAAGAATGGAAATGG - Intergenic
927440236 2:23110584-23110606 ATGGATAGGAAGAATGAAAATGG - Intergenic
927725527 2:25419541-25419563 GTGTTGAAGATGAAAAAAAAAGG + Intronic
928588749 2:32791371-32791393 ATGTGGAAGAGGAAGGAAAGGGG + Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
929920911 2:46171002-46171024 AAGTAGATGATAAATGAAAAAGG + Intronic
929988470 2:46762845-46762867 ATGAAGAAAATGAATGAGAATGG - Exonic
930309555 2:49722151-49722173 ATGTAGAATACAAATGAAAACGG + Intergenic
931190217 2:59992955-59992977 ATTGAGAAGATAAATAAAAATGG + Intergenic
932757773 2:74420752-74420774 AAGAAGAAGAAGAAAGAAAACGG - Intronic
932798454 2:74718096-74718118 AAGTAGGAGGTGAATGCAAATGG + Intergenic
932889285 2:75577928-75577950 AGGTAGAAGGTGAATGAAGTTGG + Intergenic
933372976 2:81440750-81440772 ATGTAAGAGATGATAGAAAATGG - Intergenic
933374312 2:81459939-81459961 AAGTAGATCATGAAAGAAAATGG + Intergenic
934535321 2:95128600-95128622 AGGGAGAAGAAGAAAGAAAAAGG + Intronic
934535326 2:95128629-95128651 AGGGAGAAGAAGAAAGAAAAAGG + Intronic
935452499 2:103225937-103225959 TAGTCGAAGATGAAAGAAAACGG - Intergenic
935544759 2:104389124-104389146 ATGGAGAAGATGAAGAGAAAAGG + Intergenic
937041168 2:118821829-118821851 GTGTATATGATGAATAAAAATGG - Intergenic
937576781 2:123433123-123433145 ATGAAGAAAATGTAAGAAAATGG + Intergenic
939282361 2:140080589-140080611 CTGTAGATGATGAGTGAGAATGG + Intergenic
939433989 2:142149500-142149522 ATGTAGAAGACCAATTAGAAAGG - Intergenic
939689234 2:145237230-145237252 ATTTGGAAGATGAGTGCAAAGGG - Intergenic
939885697 2:147679168-147679190 ATTTTGAAGATGAATTAAAGTGG + Intergenic
940556348 2:155233362-155233384 ATGTATAATATGAATGCAGAAGG - Intergenic
940607394 2:155943479-155943501 ATTTAAAAAGTGAATGAAAAAGG - Intergenic
941146634 2:161854990-161855012 ATGTGGAAGATGGAGGAGAAAGG + Exonic
941236458 2:162981578-162981600 ATAAAGAATATGAATCAAAAGGG - Intergenic
941693882 2:168530029-168530051 CTGAGGAAGATGAATGATAAGGG + Intronic
942375886 2:175337064-175337086 ATGTTGAATAGGAGTGAAAATGG + Intergenic
942815458 2:180048190-180048212 ATGTAGAAGAATGATGAAACTGG + Intergenic
943036627 2:182754480-182754502 ATCTTGAAGAAGAATAAAAAGGG + Intronic
943046012 2:182863358-182863380 ATGTGTAAGATGAATAATAATGG + Intronic
943173213 2:184431688-184431710 ATGTAGAAGAGGAATCAGAATGG + Intergenic
943348375 2:186768988-186769010 ATGAATTAGATGAATGATAATGG + Intergenic
943554131 2:189380156-189380178 ATGTCAAAGATGAATGGAATGGG + Intergenic
944080288 2:195780391-195780413 AAGTAAAAGATAAATCAAAATGG - Intronic
944119899 2:196229695-196229717 AGGCAGAAGATAAATAAAAATGG + Intronic
944196338 2:197057989-197058011 ATGCAGGAAATAAATGAAAATGG - Intronic
944472535 2:200069833-200069855 ATGTTGAAGAGAAATGAGAATGG - Intergenic
944503369 2:200384683-200384705 ATATAGATGATGTATTAAAATGG + Intronic
944518284 2:200534753-200534775 ATGCAGAATATGTATAAAAAAGG - Intronic
944878539 2:203987351-203987373 ATGATGAAGATAATTGAAAAAGG - Intergenic
944884079 2:204044706-204044728 ATGGAGAGGATGAGGGAAAAAGG + Intergenic
945487412 2:210413331-210413353 ATGCAGAAGACGATTGAAACTGG - Intergenic
945581761 2:211603378-211603400 ATATAGAATATAAAGGAAAAAGG + Intronic
945621979 2:212151061-212151083 ATATTAAATATGAATGAAAATGG + Intronic
946980434 2:225208078-225208100 ATGTGTAATATGAATGGAAAAGG + Intergenic
946992530 2:225351420-225351442 ATGTAGGAAATGAAGAAAAATGG + Intergenic
947415686 2:229893017-229893039 AAGTAAAAGAAGAATCAAAATGG - Intronic
1169270340 20:4194477-4194499 ATGTGGAATATGAAAGAAAAAGG - Intergenic
1169530389 20:6478788-6478810 ATTTAGATGATGAAGGGAAATGG - Intergenic
1169942144 20:10948703-10948725 ATATAGAAATTGAAAGAAAACGG - Intergenic
1170272900 20:14548390-14548412 ATTTATAAGATAAATGCAAAAGG - Intronic
1170342898 20:15349272-15349294 CTCCAGCAGATGAATGAAAAAGG - Intronic
1170355884 20:15490988-15491010 AAGTAGAAGAGAAAAGAAAAAGG - Intronic
1170713393 20:18811691-18811713 ATGTTGCAGAAGAATGAAAAAGG - Intronic
1170886633 20:20345443-20345465 AGGTAGAAGGTGAAATAAAATGG - Intronic
1171005630 20:21462776-21462798 AGCCTGAAGATGAATGAAAACGG + Intergenic
1171351667 20:24507346-24507368 ATATAGATGATGAATCAGAAAGG - Intronic
1171814000 20:29767287-29767309 CTGTAGAAGCTGAATGGATAAGG - Intergenic
1173243167 20:41316248-41316270 ACATAGAAAATGAATGAAAAGGG - Intronic
1173562911 20:44019053-44019075 ATGTAGCAGGTGTCTGAAAAAGG + Intronic
1173860062 20:46277565-46277587 ATGGTGAAGGTGAGTGAAAAGGG + Intronic
1174015544 20:47485328-47485350 AATTAGAAGAGGATTGAAAAAGG + Intergenic
1177103495 21:16924739-16924761 ATGTACAAGATGAAGAAAAGAGG + Intergenic
1177351077 21:19942392-19942414 ATGTAGAAAATTAGAGAAAAGGG + Intergenic
1177452900 21:21295064-21295086 TGGAAGAAGATGAATGAAAGAGG - Intronic
1177469542 21:21540582-21540604 ATCTAGAATAAGAATGAAACAGG - Exonic
1177707339 21:24724365-24724387 ATGTAGAAGATGGAGTTAAATGG + Intergenic
1177756242 21:25351280-25351302 ATGTAGAAGATTGATAGAAATGG - Intergenic
1177844175 21:26269314-26269336 ATGTAGGAGATGGAGGAAAGGGG + Intergenic
1178027181 21:28481421-28481443 AAGTAGAGTTTGAATGAAAATGG - Intergenic
1178181568 21:30167966-30167988 ATGTAAAAGAAAAAGGAAAAGGG - Intergenic
1178577930 21:33811673-33811695 TTGTATAAGATTAATGAAAGTGG - Intronic
1178637633 21:34318705-34318727 AAGTAACCGATGAATGAAAAAGG + Intergenic
1179244837 21:39623932-39623954 ATGTAGCAGATACATGAAGAGGG - Intronic
1179334850 21:40441100-40441122 ACATAGAATATGAAGGAAAAGGG + Intronic
1179462144 21:41543490-41543512 AAGTAGAAGAGGAGAGAAAAAGG + Intergenic
1179605979 21:42515181-42515203 ATATTAAAGATGAATGAAAATGG - Intronic
1181323601 22:22027334-22027356 AGGTGGAAGATAAATGATAATGG + Intergenic
1182799000 22:33014961-33014983 ATTTACATGATAAATGAAAATGG + Intronic
1182826855 22:33273206-33273228 ATATTGAAGATTAAAGAAAATGG + Exonic
1184277024 22:43414773-43414795 AGGGAGAAGAAGAATGGAAAGGG - Intronic
1184738599 22:46413637-46413659 ATGTAAAAGAAAAATGAAAAAGG - Intronic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
949243508 3:1898326-1898348 GTGAACAAGATGAATTAAAATGG + Intergenic
950417011 3:12874534-12874556 ACCTAGAAGAGGAATGAAGATGG - Intergenic
950604807 3:14069160-14069182 ATTAACAATATGAATGAAAATGG - Intronic
950826362 3:15826738-15826760 GTGTAGAAGATGAACTGAAATGG + Intronic
950882594 3:16335303-16335325 GAGCAGAAGATGAACGAAAATGG + Intronic
951816524 3:26761190-26761212 ATTTAGCACAAGAATGAAAATGG + Intergenic
952038941 3:29238379-29238401 AAGTACAAGATGAGAGAAAATGG + Intergenic
952182048 3:30927276-30927298 ATCTTAAAGTTGAATGAAAAAGG + Intergenic
952432444 3:33236934-33236956 ATGTATAAAATGGATAAAAAGGG - Intergenic
952563062 3:34618509-34618531 ATAGAGAAGCTGAATGAATAAGG - Intergenic
952802072 3:37303262-37303284 ATGTAGAAAAGAAATGAAATAGG + Intronic
953627373 3:44581813-44581835 ATTTAGAAGCTGAATGACCAGGG - Intronic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954804910 3:53212549-53212571 ATGTAAAATATAAATGAAAAAGG - Intergenic
955070463 3:55568517-55568539 ATGTGGAACATGAAGGAAAGAGG - Intronic
955256293 3:57335347-57335369 AGGAGGAAGATGAATGGAAAAGG + Intronic
956483572 3:69697419-69697441 ATGTACAAGATGTATGACAAAGG - Intergenic
956614139 3:71154067-71154089 AAGAAGAAGAAGAATGCAAAGGG - Intronic
956622426 3:71234741-71234763 GTGGATAAGATGATTGAAAATGG + Intronic
957039163 3:75323093-75323115 ATGTACAAGAGGAAAGTAAATGG + Intergenic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957958377 3:87218650-87218672 ATGTGGAGGATAAAAGAAAAAGG + Intergenic
958084092 3:88783695-88783717 TTCAAGAAGATGAATGAAACTGG - Intergenic
958254789 3:91313207-91313229 TTGTCAAAGATAAATGAAAAAGG + Intergenic
958699825 3:97574294-97574316 ATGTGGTAGTTGAATGAAAGAGG + Intronic
959259877 3:104063857-104063879 ATGTGGTAAATGTATGAAAATGG + Intergenic
959373061 3:105553739-105553761 ATGTAAAATATGAATAATAATGG - Intronic
959427742 3:106213791-106213813 AGGTATAAGATGAGAGAAAAGGG - Intergenic
959785685 3:110294863-110294885 TTTAAGAGGATGAATGAAAATGG - Intergenic
959803720 3:110526128-110526150 ATATAGAAAATGAATGACACAGG - Intergenic
959929526 3:111964039-111964061 AAGTAGAAGATGCCTGTAAAAGG - Intronic
961082809 3:124041089-124041111 ATGTAGAACAGGAATGGAAATGG + Intergenic
961129530 3:124453097-124453119 ATGAATAAGATGATTAAAAAGGG + Intronic
961599239 3:128046345-128046367 ATTTGGAAGATGAAAGAAAAGGG - Intergenic
961800873 3:129448093-129448115 ATGAAGAAGATATTTGAAAAAGG - Intronic
962262282 3:133919534-133919556 AGGTAGGAGATGAAGGAAATAGG - Intergenic
962410881 3:135140938-135140960 ATGTGAAAGATGGAGGAAAAAGG + Intronic
962566027 3:136661039-136661061 ATGTATAACAAGGATGAAAAAGG + Intronic
963722962 3:148885218-148885240 ATGTAAAACATGGAAGAAAATGG + Intronic
964019338 3:151989286-151989308 ATGCAGGACATGAATGACAAGGG + Intergenic
964024853 3:152060120-152060142 ATGTAGAAAATAAATGCTAAAGG - Intergenic
964028306 3:152105038-152105060 ATGGAAAAGAGGAAGGAAAAGGG - Intergenic
964490609 3:157231995-157232017 GTCTACAAGATGAATTAAAATGG - Intergenic
964651824 3:159020048-159020070 ATTTACAACATGAATGGAAATGG - Intronic
964941878 3:162167952-162167974 ATGCAGAAGAAAAATGAAAGGGG - Intergenic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965026571 3:163309716-163309738 ATCTAGAAGTTCAATCAAAATGG + Intergenic
965055835 3:163714917-163714939 CTGTAGAAGAGTAATGAAACAGG + Intergenic
965156477 3:165064972-165064994 AAGTACAAGGTGAGTGAAAAAGG + Intronic
965959675 3:174413967-174413989 AGGTAAAAAATGAATAAAAATGG + Intergenic
966310683 3:178590146-178590168 AGGAAGAAGATGAATAAAAATGG - Intronic
966955471 3:184873330-184873352 AGGGAGAAGATGAGTGAGAAGGG + Intronic
968380990 4:95642-95664 GTGGAGAAAATGAATAAAAAAGG - Intergenic
968819402 4:2838107-2838129 CTGCAGGAAATGAATGAAAAAGG - Exonic
969383809 4:6828759-6828781 AAGTAGAAGATGAAGAAAAGTGG - Intronic
970204586 4:13643338-13643360 ATGTAAAAAAAGTATGAAAAAGG + Intergenic
970420349 4:15900118-15900140 AGGAAGAAAATGAATGAAGAAGG - Intergenic
970422216 4:15915953-15915975 ATGTTGAAGATAAATGATAATGG - Intergenic
970477256 4:16436186-16436208 ATATAGAAGATGGAAGAACAAGG - Intergenic
970973791 4:22019223-22019245 AAGGAGAAGAGGAAAGAAAATGG - Intergenic
971232447 4:24810668-24810690 ATGTAAATGTTGAATGAAAATGG + Intronic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
971572000 4:28224846-28224868 ATTTAGAAAATGAAGGAGAATGG - Intergenic
971711524 4:30119316-30119338 ATATTGAATAGGAATGAAAAGGG + Intergenic
972239611 4:37175862-37175884 ATGTAGAAGGTGAAGAAACATGG - Intergenic
972644287 4:40953360-40953382 AATTAGAAGATGAATAAATAAGG + Intronic
972819170 4:42679786-42679808 ATGAACAATAGGAATGAAAAGGG + Intergenic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973555809 4:52081560-52081582 ATGGAGAATAAGAATAAAAAGGG - Intronic
974107632 4:57488681-57488703 AAGTTGAAGTGGAATGAAAAGGG + Intergenic
974384804 4:61190397-61190419 ATGTAGATGATGACTGGGAAAGG - Intergenic
974446013 4:61982776-61982798 ATGGTGAACATGAATAAAAATGG - Intronic
974808335 4:66912262-66912284 TTCTAGCAGATGAATGAAAATGG + Intergenic
976033809 4:80791776-80791798 ATGTAGAATCTCATTGAAAAGGG + Intronic
976400708 4:84603449-84603471 TTGTAGAAGAGGAAAGAACATGG + Intronic
976423086 4:84868233-84868255 ATTAAGAAGAAGAAAGAAAAAGG - Intronic
976767645 4:88614271-88614293 ATGTAAAGGAGGAAAGAAAAGGG + Intronic
977007684 4:91591830-91591852 CTGTAGAAAATGAATTGAAAGGG - Intronic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
977507636 4:97922750-97922772 ATGTAGAAGCCTATTGAAAAGGG - Intronic
977611946 4:99044799-99044821 TTGTAAAAGATAAGTGAAAATGG + Intronic
977639541 4:99341050-99341072 ATGTAATAAATCAATGAAAAAGG - Intronic
977714758 4:100169686-100169708 AAGTAGAAGAGCAATGAACAAGG - Intergenic
978181742 4:105806026-105806048 AAAAAGGAGATGAATGAAAAAGG - Intronic
978280668 4:107008650-107008672 ATGTAGAAGATCAAAGAGAGAGG + Intronic
978461589 4:108960338-108960360 ATGTAAAACATTAATAAAAATGG + Intronic
978910712 4:114060468-114060490 ATGGAGAATATGAATAAAATTGG + Intergenic
978987394 4:115030063-115030085 ATGAAGAGGAACAATGAAAAAGG + Intronic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979956765 4:126962737-126962759 ATGTTTGAGATGAATGAGAATGG - Intergenic
980242595 4:130196412-130196434 ATATAGAATAAGAATGATAAGGG - Intergenic
980258796 4:130420341-130420363 CTGAAGGAAATGAATGAAAATGG + Intergenic
980264633 4:130499400-130499422 TTGTAGAACATAAAAGAAAAAGG - Intergenic
980283264 4:130750347-130750369 CTGAATAAAATGAATGAAAATGG + Intergenic
980461474 4:133120662-133120684 ATGTACTAGATGAGTGAAAAAGG - Intergenic
980476192 4:133320573-133320595 ATGTAGAACATTAAGGAAGAAGG - Intergenic
980649351 4:135689947-135689969 ATGGAGAATAGGAGTGAAAAAGG + Intergenic
980948892 4:139351894-139351916 ATGAACAAGATGAAAGAAAATGG - Intronic
981032681 4:140141322-140141344 CTGTAGAAAATGCATCAAAATGG - Intronic
981408671 4:144401880-144401902 ATGAAGATAATGAAGGAAAAGGG + Intergenic
981797528 4:148613945-148613967 ATCTAGAAGCTGGATGAATATGG + Intergenic
981802126 4:148670154-148670176 CTGTAGAAAATTAATGAAAAGGG + Intergenic
981818521 4:148859221-148859243 ATGTTGAAAATGAATGATGATGG + Intergenic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
982734728 4:158993779-158993801 GTGTAGAAGATGGATTAGAAAGG - Intronic
982737356 4:159020218-159020240 AGATGGAAGAAGAATGAAAAGGG - Intronic
983358054 4:166690418-166690440 ATATTTAATATGAATGAAAAAGG + Intergenic
983853525 4:172613049-172613071 ATGTGGAAGCTGAATGAATGTGG - Intronic
983954192 4:173677734-173677756 ATATAGAAGGTGAATGAGCAAGG + Intergenic
983990322 4:174110856-174110878 CTGTATAATAAGAATGAAAAAGG - Intergenic
984731070 4:183068808-183068830 ATGCAGGAAATGAAGGAAAATGG + Intergenic
985020321 4:185682075-185682097 ATGAAGAAAATAAATGAAAAGGG - Intronic
986444194 5:7807313-7807335 AAGTAGAAGGTGAAAGATAAAGG - Intronic
986600086 5:9464491-9464513 ATTTAAAACATGATTGAAAAGGG - Intronic
986881554 5:12178563-12178585 ATATAAAATATGAATAAAAAAGG + Intergenic
986923136 5:12712619-12712641 ATATAAAATAGGAATGAAAAGGG + Intergenic
987167856 5:15219814-15219836 AAGGAGAAGATGAATGTCAATGG + Intergenic
988337356 5:29923480-29923502 ATGCTGCAGATGAATGGAAAAGG + Intergenic
989069820 5:37498378-37498400 ATTTAGAAGTTGAATAGAAAAGG - Intronic
989150222 5:38291594-38291616 AAATAGAAGTGGAATGAAAATGG + Intronic
989352988 5:40508997-40509019 ATGAAGAAGAAGAAGAAAAAAGG - Intergenic
990768822 5:59219777-59219799 ATGTAGACAATGAATGTAAAGGG + Intronic
991960577 5:72039983-72040005 ATGAGGAAGATGACTGAGAAGGG - Intergenic
992374341 5:76173322-76173344 ATGTTGTACATGTATGAAAATGG - Intronic
992681847 5:79161327-79161349 ATGTAGGAGCTGAAAAAAAAAGG + Intronic
993269765 5:85780232-85780254 ATGTAGATGATGATTATAAATGG + Intergenic
993312476 5:86352558-86352580 ATATAGAGCATGAATGCAAAGGG + Intergenic
993698861 5:91094669-91094691 ATGCAGCATATGAAGGAAAATGG + Intronic
993715059 5:91268322-91268344 CAGGAGAAGATGAAAGAAAAAGG - Intergenic
993890527 5:93466808-93466830 ATGTAGGAGGTGAAAGAGAATGG - Intergenic
994045460 5:95304415-95304437 GTGTAGAAGGAAAATGAAAAAGG + Intergenic
994057395 5:95433657-95433679 TTTTAGAACATGTATGAAAATGG - Intronic
994127407 5:96183799-96183821 ATCTAGAAGATTAAAGAACAAGG - Intergenic
995089370 5:108154746-108154768 TTTAAAAAGATGAATGAAAAGGG + Intronic
996194745 5:120590242-120590264 AAGAAAGAGATGAATGAAAAGGG - Intronic
996318528 5:122188399-122188421 AAGTAGAAGAAGAAGGCAAAGGG + Intergenic
996332878 5:122351126-122351148 AGGTAGAAAAAGCATGAAAAAGG - Intronic
996890115 5:128408814-128408836 AAGGAGAAGATGATTGAGAAAGG + Intronic
997725507 5:136116993-136117015 GTGTGGAAGATGAATGGAAAGGG + Intergenic
998014794 5:138723532-138723554 ATGGAGAAGATGAAAGAGAGGGG + Intronic
998303441 5:141049440-141049462 ATGTAGAAGGTGAGAGGAAAGGG - Intergenic
998396652 5:141822984-141823006 ATGGAGAAGATAAAAGGAAAAGG + Intergenic
998966085 5:147541774-147541796 ATATAGAAAATGAATAAACAAGG + Intergenic
999001515 5:147928867-147928889 AAATAGAAAATGAATGAAAAGGG + Intergenic
999564046 5:152837980-152838002 CTGTAGAAGATGAATAATGAGGG + Intergenic
999875420 5:155800263-155800285 ATATGGAAGATGAATAAAAGAGG - Intergenic
1000218259 5:159185918-159185940 ATGTACAAGATCTATGAAAAGGG + Intronic
1000437563 5:161231625-161231647 ACGTAGAATATTAAAGAAAAGGG + Intergenic
1000463889 5:161551873-161551895 ATGGATAAGATGAATCAATATGG - Intronic
1000705920 5:164512032-164512054 ATGTATAAGATTAATCAAACAGG + Intergenic
1000805166 5:165781590-165781612 ATCAATAAGATGAATGATAAAGG - Intergenic
1001046337 5:168374905-168374927 ATGTAAAGTATGAAAGAAAAAGG + Intronic
1002554483 5:180024820-180024842 GTTTAGAGGAAGAATGAAAAGGG - Intronic
1002811315 6:632528-632550 ATGGATAAAATGAAGGAAAAGGG + Intronic
1003153313 6:3571048-3571070 CTGTAGTAGATGAATGACAGAGG + Intergenic
1003347709 6:5286066-5286088 ATTTAGAAGATGAGCGAAAAAGG - Intronic
1003631860 6:7794620-7794642 AAGGAGAAGAAGAATGTAAAGGG + Intronic
1003892270 6:10574129-10574151 CTGTAGAAGAAGAAAGGAAACGG + Intronic
1004044045 6:12009545-12009567 ATGTGGAGGATGAATGTGAATGG - Intronic
1004523642 6:16385311-16385333 GAGTAGAAGATGGATGAGAAGGG + Intronic
1005169805 6:22969728-22969750 ATGTATTAGATGACTCAAAAGGG + Intergenic
1005213665 6:23499145-23499167 ATGTAGAAAAAGAATGGACAAGG - Intergenic
1005314084 6:24587579-24587601 AAGTAAAAAATGAATAAAAAGGG - Intronic
1006963617 6:37959747-37959769 ATCTAGAAGATGAAAGTTAATGG - Intronic
1007116191 6:39344998-39345020 ATGGAGAAGCTGGATGGAAAAGG - Intronic
1008040464 6:46792621-46792643 ATGTATAAGAGGAACCAAAAAGG - Intergenic
1008401674 6:51070333-51070355 CTGTTCAAGATGAAAGAAAAAGG - Intergenic
1008896273 6:56559681-56559703 ATGTAGAAAATGAGTGTAAAGGG - Intronic
1008949249 6:57137347-57137369 AAATTGAAGATGAAAGAAAATGG - Intronic
1009000569 6:57707870-57707892 TTGTCAAAGATAAATGAAAAAGG - Intergenic
1009189034 6:60607297-60607319 TTGTCAAAGATAAATGAAAAAGG - Intergenic
1009305598 6:62085802-62085824 ATGTTGAAAATTCATGAAAAAGG + Intronic
1009497088 6:64364037-64364059 ATGTTGAAGATGATAGATAAGGG - Intronic
1009609974 6:65929254-65929276 ATGGAGGATATGAATAAAAATGG + Intergenic
1009733424 6:67640770-67640792 TTTTATAAGATGAAAGAAAATGG - Intergenic
1010351463 6:74879898-74879920 AAGTAAAAGAGGAATGAAAGAGG + Intergenic
1010478395 6:76318303-76318325 ATCTAGAAAATGATTGAAATTGG + Intergenic
1010574102 6:77511039-77511061 ATGTTGCAGATGAATGGAAAAGG - Intergenic
1010922328 6:81698287-81698309 ATTTACAAAATTAATGAAAAGGG - Intronic
1011146407 6:84222445-84222467 ATGTAGAATGAGATTGAAAAAGG - Intronic
1011266268 6:85522854-85522876 ATGTACAAGAGGCATGAAAGAGG - Intronic
1011760411 6:90558730-90558752 ATGTAAAAGATGTTAGAAAATGG + Intronic
1012043831 6:94243622-94243644 ATGTAGAAGATAAATAAAGGTGG - Intergenic
1012104588 6:95139853-95139875 CAGTAGAAGATAAATGGAAATGG - Intergenic
1012165773 6:95949744-95949766 ATATATAAGAGGAATAAAAATGG + Intergenic
1012487266 6:99736300-99736322 ATGAAGAAGACTGATGAAAAAGG + Intergenic
1012610689 6:101215440-101215462 ATGTAGAATATGAATTAATGAGG - Intergenic
1012888988 6:104877754-104877776 ATGTAGTCAATGAATGAAACAGG + Intergenic
1012970926 6:105729703-105729725 ATTAATAAGATGAAAGAAAAGGG + Intergenic
1013032574 6:106349298-106349320 ATGTAGAAGAAAAGTGCAAAAGG + Intergenic
1013175859 6:107675827-107675849 ATGTAGGAGGTGTATGAAGACGG + Intergenic
1013723365 6:113059629-113059651 ATGTAAAAAATGCATCAAAATGG - Intergenic
1014093478 6:117432729-117432751 ATGTTGTACATGTATGAAAATGG + Intronic
1014105228 6:117553436-117553458 AAGAAGAAGATAAAGGAAAAAGG - Intronic
1014465595 6:121752812-121752834 AGGTAGAAATTGAATGAAAAAGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1015445284 6:133296752-133296774 AAATAGATGATGAATGAAAAAGG - Intronic
1015560622 6:134511329-134511351 ATGAGGAAGATGAATTAGAATGG - Intergenic
1015679584 6:135790547-135790569 GTGTACAAGATGCAAGAAAACGG - Intergenic
1016089884 6:139963761-139963783 ATGTGGAAGATGAGGAAAAAGGG - Intergenic
1016140096 6:140597856-140597878 TTGTATAAGATGTAAGAAAAGGG + Intergenic
1016228321 6:141770621-141770643 ATCTAGAAAATGCATCAAAAGGG - Intergenic
1016241481 6:141936475-141936497 ATGTATAAGGTAAATGAAAACGG - Intergenic
1016754709 6:147671769-147671791 AACAAGAAGATAAATGAAAATGG - Intronic
1016810718 6:148258777-148258799 ATGTATAAGGGGAATGAAAGAGG - Intergenic
1018745454 6:166758166-166758188 AGGAGGAAGGTGAATGAAAATGG + Intronic
1019748726 7:2715365-2715387 TTGCAGAAGATGAAGGAAATCGG - Exonic
1020462691 7:8442561-8442583 TTGTAGAAGACGAAGGAAAATGG - Intronic
1020496066 7:8854637-8854659 GTGTGGAAGATTATTGAAAAAGG + Intergenic
1020563725 7:9769523-9769545 TTGTAGACGAGGAATAAAAATGG - Intergenic
1020971497 7:14947816-14947838 AAGTAGTAGACGAATGATAACGG - Intronic
1020986027 7:15135496-15135518 GCTTAGAAAATGAATGAAAAGGG + Intergenic
1021242785 7:18224919-18224941 ATATAGAGGATGGATGAAAGGGG + Intronic
1021315326 7:19142374-19142396 ATGGAGAAGACTAACGAAAACGG + Intergenic
1021598591 7:22342079-22342101 TTTTAGAAGATGTATGGAAATGG - Intronic
1021626228 7:22595665-22595687 ATCCAAAAGATGAATGAGAACGG + Intronic
1022388041 7:29920025-29920047 ATATAGAAAATGTATGAGAATGG - Intergenic
1023071268 7:36436592-36436614 ATGGAAAAGATGTAGGAAAATGG - Intronic
1023574565 7:41612510-41612532 CTGTAAAAAGTGAATGAAAACGG + Intergenic
1023943236 7:44783547-44783569 GTGTACAACATGCATGAAAAGGG - Intergenic
1024117088 7:46204793-46204815 AAGTAGAAGATGTAGGAACATGG - Intergenic
1024448510 7:49511239-49511261 ATATTGAATATGAATAAAAATGG + Intergenic
1024500827 7:50103640-50103662 AAGTAGAACTTGGATGAAAAAGG - Intronic
1024750411 7:52458668-52458690 ATGCAGTATATTAATGAAAATGG + Intergenic
1026051201 7:66948205-66948227 ATATAAAAGATGTTTGAAAATGG + Intronic
1026675186 7:72422658-72422680 ATGAAGAATAAGAATGAAACAGG - Intronic
1027773488 7:82435700-82435722 ATGTAGAAGATGGATTAAGGCGG - Intronic
1028267231 7:88741263-88741285 AAGAAGAAGATGAAAGAAATGGG - Intergenic
1028487087 7:91371880-91371902 ATGTATGAAATAAATGAAAAAGG + Intergenic
1028487479 7:91375804-91375826 CTCTAGAAGATGAATAGAAAAGG - Intergenic
1028741824 7:94284097-94284119 ATGGAGTAGAGAAATGAAAATGG - Intergenic
1030150292 7:106397803-106397825 AGGGAGTAGATGAATGATAAAGG + Intergenic
1030671662 7:112344976-112344998 ATGGAGACAATGAATGATAATGG - Intergenic
1030975433 7:116116203-116116225 ATGGAAAAGAAGAATAAAAATGG + Intronic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031470836 7:122167360-122167382 ATGTTGGAGATTAATGAAAAAGG - Intergenic
1031494299 7:122427297-122427319 ATGTAGAAAATGAACTAAAATGG + Intronic
1031609067 7:123803789-123803811 ATGCAGAAGAAGAAAGACAAAGG - Intergenic
1031790686 7:126099344-126099366 AAGTAGAAGAAGAATTAAGAAGG - Intergenic
1032318279 7:130861222-130861244 TTTCAGAAGATGAATGGAAATGG + Intergenic
1033460900 7:141546699-141546721 AAGTGGCAGATGCATGAAAATGG - Intergenic
1036421877 8:8603942-8603964 GGGTCTAAGATGAATGAAAATGG + Intergenic
1038008057 8:23450979-23451001 ATTTGGAAGATGAAGGAAGAGGG - Intronic
1038666975 8:29546302-29546324 GTGTAGAACATGAAGGCAAATGG + Intergenic
1038837279 8:31140354-31140376 ATGTGTAGGATGAATGAAAGAGG + Intronic
1039348282 8:36732342-36732364 ATATGGAAGATGAATGGAAGAGG - Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039772419 8:40700790-40700812 CTGTAGAAGAAGAATGTACAAGG - Intronic
1041032351 8:53750296-53750318 ATGTAAAACAAGAGTGAAAAGGG + Intronic
1041487494 8:58395130-58395152 TGTTAGAAAATGAATGAAAACGG + Intergenic
1041617069 8:59919654-59919676 TTAAAGAAGATGAAAGAAAAGGG - Intergenic
1042071462 8:64940158-64940180 ATGTACAAGATAATTGAAATGGG - Intergenic
1042256161 8:66806015-66806037 ATGTAGAAGAAATATGAAAAAGG - Intronic
1042323269 8:67501006-67501028 TTGAAAAAGAAGAATGAAAAGGG - Intronic
1042448481 8:68917302-68917324 ATTTAGTAAATGAATAAAAATGG + Intergenic
1043223232 8:77692784-77692806 ATGAAGAAAATGGAAGAAAAAGG + Intergenic
1043520867 8:81044070-81044092 GTGTGGAGGATGAATGCAAAAGG - Intronic
1043661696 8:82750974-82750996 AAGTATAAAATGACTGAAAAGGG - Intergenic
1043782979 8:84360509-84360531 ATATCGAAGATTAATGAATAAGG + Intronic
1043918587 8:85953741-85953763 ATGCAGCAGATGAAAGAATAAGG - Intergenic
1044061059 8:87636346-87636368 GTGGAGCAGATGATTGAAAAAGG - Intergenic
1044083335 8:87912286-87912308 ATGTAGAAGCTGAATTGGAAAGG + Intergenic
1044321391 8:90805652-90805674 ATTTACAGGTTGAATGAAAATGG + Intronic
1044418991 8:91969658-91969680 GTGTAGCAGATGAATAACAAGGG - Intronic
1044429429 8:92091154-92091176 TTGTAGAAGAGGAATGCAGAGGG - Intronic
1044917420 8:97129901-97129923 AGATATAAGATGAATGAATATGG + Intronic
1044931465 8:97255759-97255781 AAATAAAATATGAATGAAAATGG - Intergenic
1045562542 8:103279760-103279782 GTGTAGAAAGTGCATGAAAATGG - Intergenic
1045683638 8:104688961-104688983 ATCTAGAAAAGGAAAGAAAAAGG - Intronic
1046192377 8:110813456-110813478 AATTAAAACATGAATGAAAATGG + Intergenic
1046390168 8:113561291-113561313 ATATACAAAATTAATGAAAATGG + Intergenic
1047838941 8:128726492-128726514 ATATAGAAATTGAATCAAAATGG + Intergenic
1048089729 8:131226112-131226134 ATCTAGAAAATGTATCAAAATGG - Intergenic
1050079046 9:1895493-1895515 ATGTGGCAGATGAAAGAAAAGGG + Intergenic
1051048782 9:12907054-12907076 ATTTAGCACATGAATGATAAGGG + Intergenic
1051594016 9:18805917-18805939 TTGTGGAAGATAAATGGAAACGG - Intronic
1051671705 9:19517078-19517100 TTTTAAAAGGTGAATGAAAAGGG - Intronic
1051691593 9:19718799-19718821 AAGTTGAAGAGGACTGAAAATGG - Intronic
1051960362 9:22753289-22753311 ATGAGAAAGATGAATGAAAATGG + Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052197733 9:25737889-25737911 AGGTAGTAGAAGAGTGAAAAGGG - Intergenic
1052358080 9:27527049-27527071 ATGGTGAAAATGAATGTAAAAGG - Intronic
1052370872 9:27663191-27663213 ATCTAGAAGATGAATGGCAAGGG - Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052466980 9:28840845-28840867 ATGTATGAGATGAAGGTAAAGGG - Intergenic
1052635304 9:31095483-31095505 AAGAAAAAGATGAAAGAAAAAGG + Intergenic
1052755911 9:32540532-32540554 ATGTAAAAGAAGTATGACAAGGG + Exonic
1052858299 9:33420910-33420932 TTGTAGATGTTGAATGAAAGAGG - Intergenic
1054248296 9:62690631-62690653 ATGTAGATGAGGAATCATAATGG - Intergenic
1054830958 9:69624022-69624044 AGGTTAAAAATGAATGAAAATGG - Intronic
1055389830 9:75808528-75808550 AGGTAGAAGATGCATAAATATGG - Intergenic
1055396734 9:75883736-75883758 ATGGATATGATGAATGAAAGTGG - Intergenic
1056108871 9:83374805-83374827 ATGGAGAAGAAGAATAAAAGAGG + Intronic
1056370254 9:85946847-85946869 CTGAAGAAGATGAATGGATATGG - Intronic
1057738395 9:97689092-97689114 TAGCAAAAGATGAATGAAAAAGG + Intronic
1058329850 9:103746394-103746416 AATTAGAAAATGGATGAAAATGG + Intergenic
1058343272 9:103924214-103924236 AGGTAAAAGATAAATTAAAAAGG - Intergenic
1058886067 9:109321866-109321888 ATTGAGATGATGAATGGAAAGGG - Intergenic
1059187894 9:112293227-112293249 AAGGAGGAAATGAATGAAAAAGG + Intronic
1059701560 9:116779824-116779846 ATTTAAAAAATGAATGAAAATGG - Intronic
1059998436 9:119936387-119936409 ATGAAGAAGATGAAATATAATGG + Intergenic
1060671123 9:125470734-125470756 ATGTAGGAGATGAATGCAATAGG + Intronic
1061221881 9:129256924-129256946 AGGTAGAAGGTGAGTGAAACTGG + Intergenic
1186246509 X:7621917-7621939 ATGTAGCAGATTTATGAAGATGG - Intergenic
1186835027 X:13429033-13429055 AAGAAGAAGAAGAAAGAAAAGGG - Intergenic
1186877993 X:13835855-13835877 ATGTAAAAGTTGAATGAAGTTGG - Intronic
1187268477 X:17759069-17759091 ATGGGGAAAAAGAATGAAAAAGG - Intergenic
1187660439 X:21540871-21540893 ATTTAGAATATGAATGTACAAGG - Intronic
1187796519 X:23009625-23009647 AAGTAAAAGATGAATAAATATGG + Intergenic
1188083150 X:25870262-25870284 CTGTAGAAGATGAATTTAAGAGG - Intergenic
1188334396 X:28912141-28912163 ATGGATAAGATGAATGGTAATGG + Intronic
1188447390 X:30270081-30270103 ATGTATTAAATAAATGAAAATGG - Intergenic
1188913567 X:35881036-35881058 ATGTGGAAGATGGAGGAAACAGG - Intergenic
1189565976 X:42241514-42241536 ATGAAAAAGTTCAATGAAAAAGG + Intergenic
1189640045 X:43059023-43059045 ATGTTGAAGATGCATATAAAAGG + Intergenic
1189758607 X:44297868-44297890 CAATAGAAGATGAATAAAAATGG + Intronic
1190148913 X:47924561-47924583 TGGTAGAAGATGAATGTAGAAGG - Intronic
1190245379 X:48687323-48687345 AGGTAGATGATGGATGAGAAGGG + Intronic
1190589011 X:51978408-51978430 ATGGAGAATATGTGTGAAAAGGG + Intergenic
1190844403 X:54178410-54178432 ATGTATAAAATGAAGGAAACAGG + Intronic
1191190540 X:57662068-57662090 ATCTGGAAGATGAAGGAAAGGGG - Intergenic
1191826508 X:65371494-65371516 ATCTGGAAAATGAATTAAAAAGG + Intronic
1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG + Intronic
1192637691 X:72835169-72835191 ATGTGGAAGCTGAAGGAAACTGG + Intronic
1192644023 X:72885646-72885668 ATGTGGAAGCTGAAGGAAACTGG - Intronic
1192866475 X:75138596-75138618 TTGTAAAAGATGTATGAAAAAGG - Intronic
1193079750 X:77394728-77394750 ATGTATAGGAAGAATGAATATGG + Intergenic
1193624716 X:83804021-83804043 ATGGAGATGATGAAGAAAAATGG + Intergenic
1193654374 X:84181882-84181904 AAGTAGGAGATATATGAAAAGGG - Intronic
1194487479 X:94503251-94503273 ATGCAGAAAATGAATTACAAGGG - Intergenic
1194698432 X:97084252-97084274 ATTTAAAAGATAAAAGAAAATGG - Intronic
1194725817 X:97395907-97395929 ATGTAGAAGATGAGTAACACTGG + Intronic
1194876642 X:99197741-99197763 ATGTAGGAGGCAAATGAAAATGG - Intergenic
1195054031 X:101125384-101125406 AAATAAAAGAAGAATGAAAAAGG - Intronic
1195112569 X:101662057-101662079 ATGCAGAAGAAGAAAGAAAAGGG - Intergenic
1195530565 X:105950500-105950522 ATGGAGAAAATAAAGGAAAAAGG + Intronic
1195614128 X:106899574-106899596 GTGTGGAAGATGAATCACAAAGG + Intronic
1195718957 X:107847511-107847533 ATGAAGAGAATGAATTAAAAAGG + Intronic
1196242380 X:113357488-113357510 ATGTGCAAGATGAATTAAAATGG + Intergenic
1196272239 X:113725767-113725789 ATGTTAAAGAAGAATAAAAATGG + Intergenic
1196392388 X:115221836-115221858 ATGTAGAAGATGAGGGGAAAGGG + Intronic
1196558386 X:117118772-117118794 ATGGAGGAGATGAGTGAAAACGG - Intergenic
1196935595 X:120727546-120727568 ATGTACAATAAGAAAGAAAATGG + Intergenic
1197711547 X:129674690-129674712 ATGGAGAAAAAGAAAGAAAAGGG - Intergenic
1197903561 X:131399183-131399205 ATGTAAATGCTGAAGGAAAAGGG + Intronic
1197904823 X:131413424-131413446 AAGAAGAAGAAGAAAGAAAAGGG + Intergenic
1198156879 X:133969504-133969526 ATGCAGAAGATGAAAGTCAAGGG + Intronic
1198175866 X:134153834-134153856 ATGAAGGAAATGAAAGAAAAGGG + Intergenic
1198245830 X:134830934-134830956 AAGTAGAAAATGAATGAGATGGG + Intronic
1198611560 X:138407056-138407078 ATGTATAAGATGAATAAATTGGG - Intergenic
1198738754 X:139817632-139817654 CTGTGGAAGATGAATTAGAAGGG + Intronic
1198826585 X:140704780-140704802 ATGAATAAGATTAGTGAAAAGGG - Intergenic
1199073939 X:143509520-143509542 CTGGAGAAGATGAAAGAATAAGG - Intronic
1199386299 X:147226955-147226977 GTTTAGTAGATGAATGAGAATGG - Intergenic
1199437172 X:147825631-147825653 ATGTACAGGATGGATGAGAAGGG - Intergenic
1200947066 Y:8853423-8853445 AATTAGAAAATGAAAGAAAAAGG + Intergenic
1202065720 Y:20937717-20937739 AGTTAGAAAATCAATGAAAATGG - Intergenic